ID: 999223574

View in Genome Browser
Species Human (GRCh38)
Location 5:150001124-150001146
Sequence CCCGGAGGCGCTTGGCCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999223574_999223586 30 Left 999223574 5:150001124-150001146 CCGCCGGGCCAAGCGCCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 11
999223574_999223585 29 Left 999223574 5:150001124-150001146 CCGCCGGGCCAAGCGCCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 999223585 5:150001176-150001198 CCGGGTAAGTCCCGCCTTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 13
999223574_999223582 11 Left 999223574 5:150001124-150001146 CCGCCGGGCCAAGCGCCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223574_999223581 10 Left 999223574 5:150001124-150001146 CCGCCGGGCCAAGCGCCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 999223581 5:150001157-150001179 GCGCAGCTTGCACGCTCCTCCGG 0: 1
1: 0
2: 1
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999223574 Original CRISPR CCCGGAGGCGCTTGGCCCGG CGG (reversed) Exonic
901058774 1:6462033-6462055 CCAGGAGGCGCTCTGCCCGCAGG - Exonic
902044287 1:13513581-13513603 CTCGGGGGCGCATGGCCGGGGGG + Exonic
907308129 1:53524929-53524951 CGCGGAGGCGCGTGTCCCGTAGG - Intronic
907377210 1:54053605-54053627 CCCAGAGGCGCGAGGGCCGGCGG + Exonic
912977861 1:114346267-114346289 CCCGGGGGCCCTGGGCCAGGAGG - Intergenic
918497470 1:185156721-185156743 CCCGGGCGGGCTTGGCACGGAGG - Exonic
919973622 1:202596811-202596833 CCCGGAGGCCCATCGCCCAGTGG - Exonic
920256914 1:204661716-204661738 CCCGGATGCCCTTGGCAGGGAGG + Intronic
1070975595 10:80603613-80603635 CCCGGGCGCGCTGGGCTCGGCGG - Exonic
1074772616 10:116743163-116743185 CAGGGAGGTGCTTGCCCCGGAGG + Intergenic
1078094364 11:8287586-8287608 CCAGGAGGCTCCTGGCCTGGAGG + Intergenic
1078164542 11:8871002-8871024 CCGGGAGCCGCGCGGCCCGGAGG + Intronic
1083448627 11:62727491-62727513 ACCGGCGGCGATTGGCCCGGGGG - Intergenic
1084595028 11:70111815-70111837 CCCGGGGGGGTGTGGCCCGGCGG - Intronic
1085047715 11:73363107-73363129 TCCGGAGGGGCATGGCCAGGAGG + Intronic
1086959811 11:92970145-92970167 CCAGGACGCGCTTGGCACAGAGG + Intronic
1089244010 11:117105184-117105206 CCAGGAGGGGCTGGGCACGGTGG + Intergenic
1091649748 12:2301153-2301175 GCAGGAGGCGCTTGGCCCCAGGG + Intronic
1094839055 12:34335356-34335378 CCCGGAGCGTCTTGGCCCCGGGG + Intergenic
1094840611 12:34341270-34341292 CCCGGAGCGGCTGGGCCCCGCGG + Intergenic
1094840726 12:34341650-34341672 CCCGGAGCAGCTGGGCCCCGCGG + Intergenic
1094841478 12:34344329-34344351 CCCGGAGTGGCTGGGCCCGCGGG - Intergenic
1094841955 12:34345952-34345974 CCCGGAGCTGCTGGGCCCCGCGG - Intergenic
1096252220 12:50040617-50040639 CTGGGAGGCACTTGGCCTGGGGG - Intergenic
1099202146 12:79690117-79690139 CCCGGGGGGGCCGGGCCCGGGGG + Exonic
1102162389 12:110780149-110780171 CCTGGAGGGGCTTGGCGAGGTGG + Intergenic
1104692839 12:130839330-130839352 CCCGGAGGGGCGGGGCCTGGGGG + Intergenic
1105943534 13:25171174-25171196 CCCAGAGCCGCAGGGCCCGGCGG - Exonic
1113450320 13:110404787-110404809 CCCAGAGGCGCTAGGTCCTGTGG - Intronic
1118849205 14:69571849-69571871 CCTGGAGGCGCTGGCCCGGGCGG - Exonic
1127753656 15:62068736-62068758 CCCCGGGGCGCTCTGCCCGGGGG + Exonic
1130550013 15:84884383-84884405 CCCGGAGTCTCCTGGCCTGGAGG + Intergenic
1132350910 15:101139290-101139312 CCCTGAGGCCCCTGGCCCTGAGG + Intergenic
1132588095 16:714963-714985 CCTCGAGGCGCTTGGACCGTGGG + Intronic
1132887155 16:2187318-2187340 CCCAGGGGCGCTGGGCCCAGTGG - Intronic
1135566698 16:23516696-23516718 CCCTGAGGTGCATGGCCAGGTGG - Intronic
1136498587 16:30658737-30658759 GCTGGAGGAGCTGGGCCCGGAGG + Exonic
1138105229 16:54284414-54284436 CCGGGAGGGGCAGGGCCCGGGGG - Intronic
1139570240 16:67807000-67807022 CCCGCGGGCGCTAGGCTCGGGGG + Intronic
1139961828 16:70722325-70722347 CTCGGAGGGGCCTGGCCTGGGGG - Intronic
1141124222 16:81388629-81388651 CCCGGACGTGCTCGGCCCGGTGG + Exonic
1142159652 16:88550449-88550471 TCCGGAGCGGCATGGCCCGGAGG + Intergenic
1142716150 17:1748010-1748032 CCAGGAGGGGCTGGGCGCGGTGG + Intronic
1143030531 17:3964632-3964654 GCCGGGGGCGCGTGGCCCGGGGG + Intergenic
1144789928 17:17851876-17851898 CCCTGAGGTGCTTGGCACAGGGG - Intronic
1146187132 17:30731530-30731552 CGCGGAGGCGCTTCTCGCGGAGG - Intergenic
1146332167 17:31936890-31936912 CGCGGAGGCGCTTCTCGCGGAGG - Intergenic
1147142868 17:38469046-38469068 CCTGGAGGCGAGTGGCACGGGGG + Intronic
1147864801 17:43545400-43545422 CCCTGAGGCGCTTAGTCTGGGGG + Intronic
1150283322 17:63941874-63941896 TCCGGATGCCCTTGGCCCCGCGG + Exonic
1151875987 17:76868585-76868607 CCCGGAGGCGCTGGGGACCGGGG + Intronic
1152353684 17:79796900-79796922 CACGGAGGCCCTAGGCCCGGGGG + Intronic
1152390522 17:80001472-80001494 CCAGGCTGCGCTGGGCCCGGAGG + Intronic
1160699323 19:498405-498427 CCCGGAGGGGCTTGGAGCTGGGG - Intronic
1160732134 19:646104-646126 CTCGGGGGCGCTGGGCCCAGAGG - Intergenic
1160738489 19:675464-675486 CCTGGAGGCGCTGCGCCCGAGGG - Intergenic
1161328831 19:3676561-3676583 CCCGACGGCGCGTGGCCAGGAGG + Intronic
1161938085 19:7384428-7384450 CTCAGAGGCACTTGCCCCGGGGG - Intronic
1165040898 19:33066688-33066710 CCGGGAGGAGCATGGCCCGCGGG - Intergenic
1166331298 19:42079469-42079491 GCCGGGGGCGCAGGGCCCGGAGG + Exonic
1168644964 19:58053877-58053899 CCCGGGGGCCCTTGCTCCGGGGG - Exonic
925609716 2:5692766-5692788 CCGGGAGGCGCTGGACACGGAGG + Exonic
926195240 2:10759689-10759711 GCCGGAGGGGCTGGGCACGGTGG + Intronic
927836355 2:26402135-26402157 CCCGGAGGCGGTGAGCGCGGGGG + Exonic
930700893 2:54456899-54456921 CGCGGAGGCCCCTGGCGCGGAGG + Intronic
934503112 2:94874201-94874223 CCCGGAGGCCCTCGCCCCCGAGG + Intronic
938796017 2:134718853-134718875 GCCGGTGGCGCGTGGCCCCGGGG + Exonic
940283474 2:152010774-152010796 CCCGGCGGCGTTTGGCACTGGGG + Intronic
942132921 2:172898482-172898504 CCCAGAGGAGCTTGTCCCAGTGG - Intronic
947399096 2:229714529-229714551 GCAGGAGGCGCCCGGCCCGGCGG - Exonic
1169478181 20:5950890-5950912 CCCGGAGACTCTTAGCCCCGTGG + Exonic
1172656989 20:36543433-36543455 CCTGGAGGCCCTGGGCCCGGGGG + Intronic
1173169596 20:40713368-40713390 CCTGGAGGGGCTGGGCCAGGTGG - Intergenic
1176084042 20:63287885-63287907 CCCGGGGGCGCTGGGGACGGGGG - Exonic
1178948421 21:36966729-36966751 CCCCGCGCCGCCTGGCCCGGGGG - Intronic
1179810352 21:43865637-43865659 CTCGGTGGCGCTGGGCCCAGCGG + Intronic
1179873772 21:44257090-44257112 ACTGGAGGGGCTGGGCCCGGTGG + Intronic
1180172961 21:46070040-46070062 GCCAGAGGCGCTTGGCCTGCAGG + Intergenic
1181778837 22:25178532-25178554 CACGGAGGCGCCTGGGCCAGAGG + Intronic
1183702199 22:39457177-39457199 GCCGGAGCCGCTTGAGCCGGCGG + Intergenic
1184112598 22:42404056-42404078 CCCGGAGGGGCTGGGGCAGGAGG - Intronic
1184472287 22:44702632-44702654 CCCGGAGGCCCTGGAGCCGGGGG + Intronic
1185050871 22:48553392-48553414 CCCGGAGGCGCCCGGGCCAGAGG + Intronic
1185418602 22:50722740-50722762 CCTGGAGGCTCTTGGCCCCAGGG + Intergenic
954291178 3:49650854-49650876 CCCTGAGGGGCTTGGCCTGGGGG - Exonic
954444667 3:50540303-50540325 CACGGAGGCCCATGGCCCGTGGG + Intergenic
955228243 3:57078651-57078673 GCCTGAGGCCCTTGTCCCGGCGG - Intronic
961743069 3:129046168-129046190 CCGGGAGGCGCACGGCCGGGCGG - Intergenic
963189012 3:142448125-142448147 CCCGGCCGCGCGAGGCCCGGAGG - Intergenic
966183154 3:177204852-177204874 CCAGGAGGCGCCGGGCGCGGTGG + Intergenic
966787753 3:183636127-183636149 CCCGGCGGCGCCCGGCCCCGCGG - Intronic
967316284 3:188154319-188154341 CCCGGAGGCGCTCGCGCCGGGGG - Intronic
968619707 4:1598344-1598366 CCGCCAGGCCCTTGGCCCGGAGG + Intergenic
969285428 4:6199720-6199742 CCCGGCGGCGCGGGGCCCGAAGG - Intronic
969715952 4:8868220-8868242 GCTGGCGGCGCGTGGCCCGGCGG - Exonic
971196230 4:24473157-24473179 CCGGGACGCGCATGGCCCGGCGG - Intergenic
972437217 4:39045253-39045275 TCCGGAGGGGCTGGGCCGGGCGG + Intronic
972532873 4:39976983-39977005 CCCGGAGGGGACTGGCCGGGCGG - Intronic
975139184 4:70902644-70902666 CCCGGGAGCGCTGGGCCAGGAGG - Intronic
981069985 4:140524375-140524397 CCCGGGGGCGCCTGGGCCGGCGG + Intronic
981528740 4:145732987-145733009 CCCGGCGGCGCCTTGCGCGGAGG - Intronic
986192488 5:5510065-5510087 CCCAGAGGCGCTGGACCCAGTGG - Intergenic
990417965 5:55604951-55604973 CCGGGAGGTGCTGGGCCCGGTGG + Intergenic
992080296 5:73230404-73230426 CCCTGAGGCGCTGGGCGCAGCGG - Intergenic
999223574 5:150001124-150001146 CCCGGAGGCGCTTGGCCCGGCGG - Exonic
1002189977 5:177473133-177473155 CCCGGGGCCGCGTGGCCCTGCGG - Exonic
1002416004 5:179121347-179121369 CCGGGACGGGCTCGGCCCGGAGG + Intronic
1006082800 6:31577153-31577175 CCAGGAGGGCATTGGCCCGGCGG - Exonic
1008174163 6:48246185-48246207 CCAGGAGTTGCTTGGCCTGGGGG - Intergenic
1008932452 6:56954889-56954911 CCCGGCGGGGCTGCGCCCGGGGG - Intergenic
1014797997 6:125748180-125748202 CCTGGCGGGGTTTGGCCCGGGGG - Intronic
1018172187 6:161152016-161152038 CTCGGAGGTGGCTGGCCCGGTGG + Intronic
1019174263 6:170152184-170152206 CTCCGAGGAGCTCGGCCCGGTGG + Intergenic
1022133346 7:27424429-27424451 CCCGGAGGTGCCTTGCCCGCAGG + Intergenic
1030227638 7:107169684-107169706 CGCGGAGCCGCTGGGCCCCGGGG + Intronic
1032201374 7:129825344-129825366 CCCGGGGGCACGTGGCCGGGGGG - Intergenic
1035353772 7:158265126-158265148 TCCGCAGGCCCCTGGCCCGGTGG + Intronic
1039484320 8:37899333-37899355 CCCCGGGGCCCTTGGCCCGCAGG + Exonic
1049419480 8:142510579-142510601 CCCGGAGGAGCTGGGGGCGGCGG + Intronic
1060279589 9:122206858-122206880 CATGGAGGAGCTTGGGCCGGAGG - Intronic
1061069354 9:128299373-128299395 CTCGGAGGGGCTGGGCACGGTGG + Intergenic
1061397968 9:130353770-130353792 CCCTGAGGGGCTTGGCTCTGGGG + Intronic
1061828400 9:133275453-133275475 CCCGGAGCCGCTCGGCCCCAGGG - Intergenic
1062362372 9:136193916-136193938 CCCGGAGCCGCTTTCCCCGCGGG + Intergenic
1062387455 9:136318623-136318645 CCTGGAGGCCCTGGGCCCAGGGG + Intergenic
1062610581 9:137371673-137371695 CCCGGGGGTGCCTGGCCTGGGGG - Intronic
1062610603 9:137371719-137371741 CCCGGGGGTGCTTGGCCCAGGGG - Intronic
1203564004 Un_KI270744v1:78065-78087 CCCGGAGGCCCTCGCCCCCGAGG + Intergenic