ID: 999223576

View in Genome Browser
Species Human (GRCh38)
Location 5:150001127-150001149
Sequence ATTCCCGGAGGCGCTTGGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999223576_999223582 8 Left 999223576 5:150001127-150001149 CCGGGCCAAGCGCCTCCGGGAAT 0: 1
1: 0
2: 0
3: 1
4: 77
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223576_999223581 7 Left 999223576 5:150001127-150001149 CCGGGCCAAGCGCCTCCGGGAAT 0: 1
1: 0
2: 0
3: 1
4: 77
Right 999223581 5:150001157-150001179 GCGCAGCTTGCACGCTCCTCCGG 0: 1
1: 0
2: 1
3: 2
4: 51
999223576_999223585 26 Left 999223576 5:150001127-150001149 CCGGGCCAAGCGCCTCCGGGAAT 0: 1
1: 0
2: 0
3: 1
4: 77
Right 999223585 5:150001176-150001198 CCGGGTAAGTCCCGCCTTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 13
999223576_999223586 27 Left 999223576 5:150001127-150001149 CCGGGCCAAGCGCCTCCGGGAAT 0: 1
1: 0
2: 0
3: 1
4: 77
Right 999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 11

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999223576 Original CRISPR ATTCCCGGAGGCGCTTGGCC CGG (reversed) Exonic
903641507 1:24863245-24863267 ATTCCTGGAGGCGCTGAACCAGG + Intergenic
904171536 1:28594890-28594912 ATTCCAGGGGGAGCTTGGCTTGG + Exonic
904820988 1:33244184-33244206 ATTCCCAGAGGGGCAGGGCCAGG + Intergenic
908585673 1:65564756-65564778 ATTACCGGAAGAGCTTAGCCTGG + Intronic
909952756 1:81738820-81738842 TTTACCTGAGGCCCTTGGCCTGG + Intronic
910634661 1:89394160-89394182 ATTTCTGGAGGCTCTTTGCCCGG + Intergenic
912977863 1:114346270-114346292 ACTCCCGGGGGCCCTGGGCCAGG - Intergenic
916075641 1:161198586-161198608 ATCCCGGGAGGGGCTTGGCAGGG - Exonic
916725206 1:167517225-167517247 ATCCCCCGAGGCGCTGGCCCGGG + Intronic
917925086 1:179782548-179782570 ATTCTCAGAGGCCGTTGGCCAGG + Intronic
923723488 1:236487025-236487047 CTTTCTGGAGGCACTTGGCCAGG - Intergenic
1063371603 10:5525953-5525975 ATTCCCGCAGGCTCCTGGACTGG + Exonic
1063393708 10:5666700-5666722 GTTCCCGGAGGCGCTGTCCCTGG + Intergenic
1067456599 10:46423558-46423580 AATCCCTGAGGCCCTTGGCTGGG + Intergenic
1067630603 10:47961081-47961103 AATCCCTGAGGCCCTTGGCTGGG - Intergenic
1072536743 10:96370039-96370061 AGTCCCGGAGACGCTGGGGCCGG - Intronic
1077867533 11:6235089-6235111 ATTCCAGGAGACGCTTGGAGTGG + Intronic
1079121499 11:17688333-17688355 ACACCCGTAGGAGCTTGGCCTGG - Intergenic
1081856100 11:46304908-46304930 CTTCCCGGAGGCCGGTGGCCAGG + Intronic
1083328355 11:61885197-61885219 ATTCACGGTGGGGCTTGGGCAGG - Intronic
1084019532 11:66409405-66409427 ATCCCCGAAGGCGCTAGGCCTGG - Intergenic
1084019700 11:66410155-66410177 CTTCCTGGAGGCGTTTGACCGGG + Intergenic
1093894521 12:24562062-24562084 ATCCCCGGGGGCGGCTGGCCGGG - Intergenic
1094060042 12:26303796-26303818 ATTCCCAGAGGATCCTGGCCAGG + Intergenic
1096633496 12:52944572-52944594 ATTCCTGGTGGGGCTGGGCCAGG + Intronic
1102007370 12:109597142-109597164 TGTCCCGGAGGCGGTGGGCCTGG + Exonic
1112291258 13:98145153-98145175 ATTCTGGGAGGCGCTGGGCTAGG - Intronic
1112424583 13:99286083-99286105 ATTCCTGGAGGCGCTGGATCTGG + Intronic
1113532427 13:111037998-111038020 ATTCCCAGAGACACTTGGCAAGG + Intergenic
1120155260 14:81086213-81086235 ATTCCAGGAGACTCTTGCCCAGG - Intronic
1122757972 14:103997621-103997643 ACTCCCAGAAGAGCTTGGCCAGG - Intronic
1129541071 15:76347229-76347251 ACTCCCGGAGCCGCAGGGCCGGG - Intergenic
1131063128 15:89416688-89416710 GTTCCCGGCGGGGCCTGGCCTGG + Intergenic
1139000669 16:62506314-62506336 ATTTCTGGAGGCCCTGGGCCGGG + Intergenic
1141945448 16:87305980-87306002 TTTCCCGGAGGCTCTGGGGCTGG - Intronic
1147934762 17:44005215-44005237 ATTCCCGGCGGCGCTGGTCTGGG - Intronic
1149856716 17:60088971-60088993 ATTTCCAGAGGTGCTAGGCCTGG - Intergenic
1151423924 17:74017361-74017383 ACTCCCTGTGGCCCTTGGCCGGG + Intergenic
1152880017 17:82809199-82809221 CTTCCTGGAGGCCCCTGGCCAGG + Intronic
1154076468 18:11207107-11207129 ATTCTCGCAGGCTGTTGGCCTGG - Intergenic
1160123664 18:76151635-76151657 CTTGCAGGAGGCGCCTGGCCTGG - Intergenic
1160561352 18:79758768-79758790 GTTCCAGGAGGCACTTGGTCGGG + Intergenic
1164514793 19:28924631-28924653 AATCCCTGAGGAGCTTGGCTGGG + Intergenic
1165007428 19:32818329-32818351 AGACCCGGAGGTGCTGGGCCAGG + Intronic
1165742271 19:38211324-38211346 ATTCCAGCAGGCGCTGGGCGGGG + Intronic
1168622312 19:57889195-57889217 ATTCCCAGAGGCGCTTCTGCAGG + Intronic
925398871 2:3557946-3557968 GTTCCAGGAGGCTCATGGCCTGG - Intronic
928093426 2:28390455-28390477 GCTCCCGGCGGCGCCTGGCCGGG + Intergenic
928869394 2:35958900-35958922 ATTCCAGGAGACTCTTGCCCAGG - Intergenic
930234478 2:48875623-48875645 ATTCCTGGAGGGGCTTGAGCTGG + Intergenic
948255878 2:236567805-236567827 ATTCTCGCAGGCGCCTGGGCCGG + Intronic
1172656985 20:36543430-36543452 CTTCCTGGAGGCCCTGGGCCCGG + Intronic
1173455458 20:43197823-43197845 ATTGCCAGAGGCACCTGGCCTGG + Intergenic
1180074316 21:45455090-45455112 ACGCCCAGAGGCGCCTGGCCTGG - Intronic
1183044677 22:35210466-35210488 CCTCCCAGAGGCGCTTGCCCTGG - Intergenic
1184682268 22:46078745-46078767 ATTCCAGCAGCGGCTTGGCCTGG - Intronic
954291182 3:49650857-49650879 AAGCCCTGAGGGGCTTGGCCTGG - Exonic
968047157 3:195630900-195630922 AGTCCAGGAGGAGCCTGGCCAGG + Intergenic
968307490 3:197659144-197659166 AGTCCAGGAGGAGCCTGGCCAGG - Intergenic
968976688 4:3825778-3825800 AATTCAGGAGGGGCTTGGCCAGG - Intergenic
969617232 4:8260993-8261015 ATTCCGGGAGCTGCTGGGCCTGG + Intergenic
969798161 4:9541894-9541916 CCTCCTGGAGGGGCTTGGCCAGG + Intergenic
972532875 4:39976986-39977008 TTTCCCGGAGGGGACTGGCCGGG - Intronic
975172079 4:71243936-71243958 ATTCCCGGAAGTTTTTGGCCTGG - Intronic
985744447 5:1638233-1638255 AGTCCAGGAGGAGCCTGGCCAGG - Intergenic
992138634 5:73772870-73772892 ATTCCAGGAGCCACTTGCCCAGG - Intronic
992778786 5:80109965-80109987 ATTCCTGGAGGAGGTTGCCCTGG + Intergenic
999223576 5:150001127-150001149 ATTCCCGGAGGCGCTTGGCCCGG - Exonic
1002457756 5:179355433-179355455 ATTCCTGGAGCCACCTGGCCGGG - Intergenic
1023695719 7:42844203-42844225 ATGCCTGGAGGAGCTTGTCCTGG - Intergenic
1031981829 7:128132591-128132613 ATTCCAGGAAGCGGTTGGCTGGG + Intergenic
1042241208 8:66666505-66666527 TGTCCCGGAGAAGCTTGGCCCGG + Exonic
1055326639 9:75137191-75137213 ATTCCTGGAGGTGCTAGGGCAGG - Intronic
1061285467 9:129620176-129620198 GCCCCCGGAGGCGCGTGGCCAGG - Exonic
1062464687 9:136675802-136675824 AGCCCCGGAGGCGCTGGGCTGGG - Intronic
1188003994 X:25005138-25005160 ATTCCCCGAGGGGCCGGGCCGGG + Intronic
1189575485 X:42348727-42348749 ATTCCCAGAGGCCCTTTTCCTGG + Intergenic
1200158101 X:153988776-153988798 ATTCCCGGAGGCCTTCGGCGTGG - Intergenic
1200217510 X:154374576-154374598 AATCCCCGAGGCGCCTGGCGCGG - Exonic