ID: 999223577

View in Genome Browser
Species Human (GRCh38)
Location 5:150001132-150001154
Sequence CTCACATTCCCGGAGGCGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999223577_999223582 3 Left 999223577 5:150001132-150001154 CCAAGCGCCTCCGGGAATGTGAG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223577_999223585 21 Left 999223577 5:150001132-150001154 CCAAGCGCCTCCGGGAATGTGAG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 999223585 5:150001176-150001198 CCGGGTAAGTCCCGCCTTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 13
999223577_999223586 22 Left 999223577 5:150001132-150001154 CCAAGCGCCTCCGGGAATGTGAG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 11
999223577_999223581 2 Left 999223577 5:150001132-150001154 CCAAGCGCCTCCGGGAATGTGAG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 999223581 5:150001157-150001179 GCGCAGCTTGCACGCTCCTCCGG 0: 1
1: 0
2: 1
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999223577 Original CRISPR CTCACATTCCCGGAGGCGCT TGG (reversed) Exonic
905656970 1:39691598-39691620 CTGACCTTCCCGGAGTCGCCGGG + Exonic
906180031 1:43810279-43810301 CTCTCATTCCCACAGGTGCTTGG + Intronic
913047677 1:115088480-115088502 CTCACAGTCCTGCAGGCCCTGGG + Intronic
915602442 1:156930688-156930710 ACCACATTCCAGGAGGGGCTGGG - Intronic
916075643 1:161198591-161198613 CTCGCATCCCGGGAGGGGCTTGG - Exonic
916588480 1:166167171-166167193 CTCACCCACCCGGTGGCGCTTGG - Intergenic
919739262 1:200972492-200972514 CCCGCCTTCCCGGGGGCGCTGGG + Intronic
1073425969 10:103455740-103455762 CTCATCTTCCCACAGGCGCTGGG - Exonic
1073521298 10:104132496-104132518 CTCACCCTCCCGGAGCAGCTGGG - Intronic
1075492098 10:122880056-122880078 CTCACGTTCCCCGAGGAGCGCGG - Intergenic
1075664847 10:124222806-124222828 CTCCCACTGCTGGAGGCGCTTGG + Intergenic
1076128361 10:127993816-127993838 GTCACATTCCCCCAGGCACTAGG + Intronic
1084510006 11:69597471-69597493 CTCACAGTTCCGGAGGCCCCAGG + Intergenic
1084693070 11:70738163-70738185 CACACATTCCAGGAGGGGCTTGG + Intronic
1087131574 11:94673427-94673449 CTCCCATTCCCGGGGTAGCTAGG + Intergenic
1088333535 11:108677855-108677877 CTCACAGTCCTGGAGGCGGTGGG - Intronic
1091370033 11:135050025-135050047 CTCTCATTCCCCCAGGCACTAGG - Intergenic
1100618238 12:96248060-96248082 TTTACATTTCGGGAGGCGCTTGG + Intronic
1106481691 13:30141712-30141734 CTCACAGTTCTGGAGGCACTCGG + Intergenic
1110596641 13:77326993-77327015 CTCACATTCCCGGGGTGGCGGGG - Intronic
1114187365 14:20413204-20413226 CTCCCCTTCCCGGAGCCGCCGGG + Intronic
1122886445 14:104712540-104712562 CCCACTTGCCTGGAGGCGCTCGG - Exonic
1123718215 15:23044574-23044596 CTCACCTGGCCAGAGGCGCTAGG + Intergenic
1123719024 15:23047413-23047435 CTCACCTGGCCAGAGGCGCTAGG + Intergenic
1131295726 15:91147602-91147624 CTCTCATTCCCGAAGGCCATAGG + Intronic
1133286027 16:4691243-4691265 CTCACAAACCTGGAGGCCCTGGG - Intergenic
1133338363 16:5021044-5021066 CTGACATCCCTGGAGGCCCTGGG - Intergenic
1135065882 16:19309466-19309488 GTCACATTATCAGAGGCGCTGGG + Intronic
1135325688 16:21523962-21523984 CTCACAGTCCCGGAGGCCAGAGG - Intergenic
1138651553 16:58464013-58464035 CTCGCCTTCCCGGCCGCGCTGGG + Exonic
1143034822 17:3988734-3988756 CTTACATTCCCGAAAGTGCTTGG - Intergenic
1144873778 17:18386082-18386104 CTCACAGTCCTGGAGGCTGTAGG + Intronic
1145158689 17:20559708-20559730 CTCACAGTCCTGGAGGCTGTAGG - Intergenic
1146686699 17:34845933-34845955 CCCACATCCCTGGAGGCACTAGG - Intergenic
1148250074 17:46069626-46069648 CTCAGCCTCCCGGAGGAGCTGGG - Intronic
1155228444 18:23750820-23750842 CTCACATGCCCCAAGGCACTTGG - Intronic
1158115359 18:53989700-53989722 CTCAGCTTCCCGGAGTAGCTGGG + Intergenic
1160436587 18:78856821-78856843 GTCACTGTCCAGGAGGCGCTTGG - Intergenic
1165213864 19:34255103-34255125 CGCACCTTCCCGGCGGCGCCAGG + Intronic
1165423089 19:35732080-35732102 CTCGCCATCCCGGAGGCCCTTGG + Exonic
1165742268 19:38211319-38211341 TTCTCATTCCAGCAGGCGCTGGG + Intronic
1165815688 19:38640630-38640652 CTCACATACCCTGAGGCGGCTGG - Intergenic
1166294579 19:41882918-41882940 GTCACCTCCCCGGAGGTGCTGGG - Intergenic
1166916498 19:46199089-46199111 CTCCCCTTCCCAGAGGGGCTGGG + Intergenic
1167643778 19:50695240-50695262 CTCACATGCCGGGGGGCGCGGGG + Intronic
1175108031 20:56628430-56628452 CTCACCTTACCCGTGGCGCTCGG + Intergenic
1179145582 21:38764748-38764770 CTCCCATTTCTGGAGGCACTGGG + Intergenic
1179312327 21:40207758-40207780 CTCACAGTCCTGGAGGCTCGAGG + Intronic
1182952526 22:34390832-34390854 CTCGCATTCCAGGAGCCACTAGG + Intergenic
953793452 3:45965794-45965816 CTCACATGCCCGGCGGGGCTGGG + Intronic
955770074 3:62377233-62377255 CTCAAACTCCCGGCGGCGGTAGG + Intergenic
961591662 3:127985873-127985895 CTCAGATTCCTGGACGTGCTCGG - Exonic
966239942 3:177744960-177744982 CTCACATTCCATGGGGTGCTTGG - Intergenic
968451146 4:676641-676663 CTCACATTCCCGGTGGCCTCGGG + Intronic
986000762 5:3628939-3628961 CTCACATTCCCGGAGGCTGGGGG - Intergenic
996967723 5:129324157-129324179 CTCACATTGCCAGATGCACTTGG + Intergenic
997436824 5:133881657-133881679 CTCACCTTCACGGAGGCCCCTGG - Intergenic
998508859 5:142694824-142694846 CTGACATTCCTGTAGGCTCTGGG + Intronic
999223577 5:150001132-150001154 CTCACATTCCCGGAGGCGCTTGG - Exonic
1002805313 6:568047-568069 CTGACATTCCAGTAGGTGCTGGG - Intronic
1003607766 6:7580203-7580225 TTCATATTCCCAGCGGCGCTTGG - Exonic
1003961762 6:11215384-11215406 TTAATATTCCAGGAGGCGCTGGG + Intronic
1007550694 6:42727635-42727657 CTCATCTTCCCCGAGGTGCTCGG + Intergenic
1021996467 7:26182908-26182930 CTCACCATCCCGGAGTAGCTGGG + Intronic
1023141810 7:37109540-37109562 CTCACACTCCCGGATCCCCTGGG - Intronic
1026258230 7:68731528-68731550 CTCACATTCCTGGTGGGGCTGGG - Intergenic
1026840395 7:73667662-73667684 CTCAGATTCCGGGAGGGGCGGGG + Intergenic
1026964445 7:74430394-74430416 CTCAAAGTCCCAGAGGAGCTGGG + Intergenic
1034880202 7:154757186-154757208 CTCACGTTCCCTGAGGAACTGGG + Intronic
1034880213 7:154757226-154757248 CTCACATCCCCTGAGGAACTGGG + Intronic
1039223013 8:35356206-35356228 ATCACATTCCTGGAGTAGCTTGG - Intronic
1041330598 8:56719793-56719815 CTCACATCCCCGCAGCCGCGTGG + Intergenic
1042314941 8:67415977-67415999 CTCACATTCATGGAAGGGCTAGG + Intergenic
1043302048 8:78745807-78745829 CTCACATTTCTAGAGGCTCTGGG + Intronic
1046512971 8:115222074-115222096 CTGACATTCCTGGTGGGGCTGGG - Intergenic
1046799318 8:118407827-118407849 CTCACATTCCCTGAGGAACATGG + Intronic
1048611250 8:136025580-136025602 CTCACATTCCTGGTAGCCCTAGG - Intergenic
1048860649 8:138722399-138722421 CTCAGCTTCCAGGAGGCCCTGGG + Intronic
1053740453 9:41130752-41130774 CTCACATGCTGGGGGGCGCTGGG - Intergenic
1054443448 9:65286926-65286948 CTCACATGCTGGGGGGCGCTGGG - Intergenic
1054486828 9:65734577-65734599 CTCACATGCTGGGGGGCGCTGGG + Intergenic
1054687897 9:68300550-68300572 CTCACATGCTGGGGGGCGCTGGG + Intergenic
1057775179 9:98002039-98002061 CTCAGATTCCTGGCGGTGCTAGG + Intronic
1059771455 9:117430517-117430539 CTCACAGTCCTGGAGGCTCGAGG + Intergenic
1060112925 9:120919422-120919444 GTCACATTCCCGGAGGCCCCAGG - Intronic
1185805260 X:3051052-3051074 CTGACATTCCTGGTGGGGCTGGG + Intronic
1192712643 X:73607503-73607525 CTGACATTCCAGGAGCCACTGGG + Intronic
1193437643 X:81496774-81496796 ATCATATTCCCGTAGGCTCTGGG - Intergenic
1197837620 X:130712288-130712310 CTGACATTCCTGGTGGGGCTGGG - Intronic
1199794591 X:151181816-151181838 CTCCCATTCCCCGAGGGGGTTGG + Intergenic
1201276010 Y:12299552-12299574 CTGACATTCCTGGTGGGGCTGGG - Intergenic