ID: 999223579

View in Genome Browser
Species Human (GRCh38)
Location 5:150001139-150001161
Sequence TGCGCCGCTCACATTCCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999223579_999223585 14 Left 999223579 5:150001139-150001161 CCTCCGGGAATGTGAGCGGCGCA 0: 1
1: 0
2: 0
3: 2
4: 44
Right 999223585 5:150001176-150001198 CCGGGTAAGTCCCGCCTTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 13
999223579_999223582 -4 Left 999223579 5:150001139-150001161 CCTCCGGGAATGTGAGCGGCGCA 0: 1
1: 0
2: 0
3: 2
4: 44
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223579_999223586 15 Left 999223579 5:150001139-150001161 CCTCCGGGAATGTGAGCGGCGCA 0: 1
1: 0
2: 0
3: 2
4: 44
Right 999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 11
999223579_999223581 -5 Left 999223579 5:150001139-150001161 CCTCCGGGAATGTGAGCGGCGCA 0: 1
1: 0
2: 0
3: 2
4: 44
Right 999223581 5:150001157-150001179 GCGCAGCTTGCACGCTCCTCCGG 0: 1
1: 0
2: 1
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999223579 Original CRISPR TGCGCCGCTCACATTCCCGG AGG (reversed) Exonic
902388942 1:16091638-16091660 TGCGCCCCTCACTGTCCGGGAGG + Intergenic
903931584 1:26865208-26865230 TCCGCCGCTCACTTTCCCATTGG - Intergenic
905599024 1:39234375-39234397 GGCGCCCCTCACCTTCCGGGCGG + Intronic
918114729 1:181485928-181485950 AGCGCCGCTGAAACTCCCGGCGG + Intronic
923744247 1:236686267-236686289 CGCTCCCCTCACGTTCCCGGAGG + Intergenic
1069698898 10:70407700-70407722 GGCGCCGCTCACCTCCCGGGCGG + Intronic
1076702801 10:132282988-132283010 TGCACCAATCACATTCCCAGGGG + Intronic
1083571800 11:63765160-63765182 TGCGCCTCTCAGCCTCCCGGAGG - Exonic
1084429225 11:69102030-69102052 TGAGCACCTCACATGCCCGGGGG - Intergenic
1086250698 11:84810511-84810533 TGGATCGCTCACATTCCTGGTGG + Intronic
1088858065 11:113773787-113773809 TGCGCCCCTCGCCTTCCGGGCGG - Exonic
1089909631 11:122084048-122084070 TGCACTGCTCACAATCCCTGTGG + Intergenic
1119147339 14:72329374-72329396 TGGGCCCCTCACACTCCAGGTGG + Intronic
1124375066 15:29124558-29124580 TGGGCAGCCCCCATTCCCGGGGG + Intronic
1131045079 15:89307989-89308011 TACTCTGCTCACATTCCCAGAGG - Intronic
1132639483 16:971103-971125 GGCCCCGCTCACAGTCCCGGAGG + Intronic
1132934604 16:2474264-2474286 TGCGCCGGTCACATCCCCCCAGG - Intergenic
1133898639 16:9952419-9952441 TAAGCTGCTCACATTCCCAGTGG - Intronic
1137720394 16:50624333-50624355 TTCGCGTCTCACATTCCCTGGGG + Intronic
1138273932 16:55717322-55717344 TGCACCCCTCAAATTCCCGTAGG - Intergenic
1142709194 17:1714515-1714537 TCCGCCCCTCACAGCCCCGGGGG - Intergenic
1159021248 18:63144912-63144934 TGTGCCGCACACGTTCCCGTGGG - Intronic
1160497884 18:79385836-79385858 TGCCCCTCTCACAGTGCCGGAGG - Intergenic
1162799415 19:13102736-13102758 GGAGCCGCTCACTTTCCCTGGGG - Exonic
1168642243 19:58038196-58038218 TGCGCCTCTCACCTTCCTGCTGG - Exonic
938114195 2:128592228-128592250 TGTCCCGCTCACCTGCCCGGGGG - Intergenic
1173975713 20:47185048-47185070 TACACCGCTCAGATTTCCGGTGG - Intronic
1174445314 20:50587114-50587136 TGGGCAGCTCACACTCCTGGAGG + Exonic
1175734290 20:61374469-61374491 TGCTCCACTCACTTTCCCTGTGG + Intronic
1181531058 22:23517778-23517800 TGGGCCGATCACACTCCCTGGGG - Intergenic
1181694118 22:24584575-24584597 TGCGCCGCTTACAGTCCCTGTGG + Intronic
1184263465 22:43333030-43333052 TGAGGAGCTCACATTCCAGGAGG + Intronic
1184654043 22:45932289-45932311 GGCGCTGCTCACATCCCCTGGGG + Intronic
1185397714 22:50601110-50601132 GGCGCGGCTCAGAATCCCGGCGG - Intronic
954035232 3:47847708-47847730 TGCCCTGCCCACATTCCAGGGGG + Intronic
968451142 4:676634-676656 AGCCCTTCTCACATTCCCGGTGG + Intronic
969637031 4:8375193-8375215 AGCCCCGCCCAGATTCCCGGGGG + Intronic
985673675 5:1219337-1219359 AGAGCTGCTCACATGCCCGGCGG - Intronic
999223579 5:150001139-150001161 TGCGCCGCTCACATTCCCGGAGG - Exonic
1003390720 6:5710546-5710568 TCCCCCGCTCACTTCCCCGGGGG + Intronic
1013598667 6:111684175-111684197 TTCTCCACTCACATCCCCGGTGG - Intronic
1025189432 7:56885323-56885345 AGCGCCGCTCAAATCCCTGGGGG + Intergenic
1029224090 7:99012371-99012393 AGCGCCCTTCACATTCCGGGTGG - Exonic
1040587301 8:48756125-48756147 CGGGCTGCTCCCATTCCCGGTGG + Intergenic
1048042130 8:130741133-130741155 TGAGCTGCTCACTTTCCCGTGGG - Intergenic
1049762496 8:144337552-144337574 TGCGCCGCACACCCGCCCGGGGG - Intergenic
1199772789 X:150984556-150984578 TCCGCCGCTGTCATCCCCGGGGG - Intronic