ID: 999223580

View in Genome Browser
Species Human (GRCh38)
Location 5:150001142-150001164
Sequence AGCTGCGCCGCTCACATTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999223580_999223582 -7 Left 999223580 5:150001142-150001164 CCGGGAATGTGAGCGGCGCAGCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223580_999223586 12 Left 999223580 5:150001142-150001164 CCGGGAATGTGAGCGGCGCAGCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 11
999223580_999223590 29 Left 999223580 5:150001142-150001164 CCGGGAATGTGAGCGGCGCAGCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 999223590 5:150001194-150001216 CGAGGGCCGCGCCGAGCCGCTGG 0: 1
1: 0
2: 1
3: 17
4: 148
999223580_999223591 30 Left 999223580 5:150001142-150001164 CCGGGAATGTGAGCGGCGCAGCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 999223591 5:150001195-150001217 GAGGGCCGCGCCGAGCCGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 99
999223580_999223585 11 Left 999223580 5:150001142-150001164 CCGGGAATGTGAGCGGCGCAGCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 999223585 5:150001176-150001198 CCGGGTAAGTCCCGCCTTCGAGG 0: 1
1: 0
2: 0
3: 1
4: 13
999223580_999223581 -8 Left 999223580 5:150001142-150001164 CCGGGAATGTGAGCGGCGCAGCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 999223581 5:150001157-150001179 GCGCAGCTTGCACGCTCCTCCGG 0: 1
1: 0
2: 1
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999223580 Original CRISPR AGCTGCGCCGCTCACATTCC CGG (reversed) Exonic
900584623 1:3426527-3426549 AGCTGTGCCGCTGACACTCAAGG + Intronic
902388940 1:16091635-16091657 ACCTGCGCCCCTCACTGTCCGGG + Intergenic
905599023 1:39234372-39234394 AGAGGCGCCCCTCACCTTCCGGG + Intronic
912659056 1:111512610-111512632 AGCTGCAGCACTCACATTCCTGG - Intronic
917664982 1:177217772-177217794 AGCTGCCCCACACAAATTCCAGG - Intronic
917708380 1:177657888-177657910 AGCTAAGCCACTCAGATTCCAGG + Intergenic
921075690 1:211698698-211698720 AGCGCCGCCGCTCACCTACCTGG + Intergenic
923731992 1:236560573-236560595 AACTCAGCAGCTCACATTCCTGG + Intronic
1069698897 10:70407697-70407719 AGAGGCGCCGCTCACCTCCCGGG + Intronic
1072578412 10:96720399-96720421 CGGGGCGCCGCTCACATCCCTGG + Exonic
1073148436 10:101295519-101295541 AGCTGCCCCACACACATCCCAGG + Intergenic
1075253259 10:120902010-120902032 AGCTGCAGCGCTCTCATTTCTGG - Intronic
1075341201 10:121648115-121648137 AGCTGTGCTGCTCACAGCCCAGG + Intergenic
1080046631 11:27815498-27815520 TGCTTTGCCGCTCACATTACTGG - Intergenic
1085022221 11:73217100-73217122 AGCTGGGCCACGCACCTTCCAGG - Intergenic
1085614134 11:77982073-77982095 AGCTGCAACACTCACTTTCCAGG - Intronic
1086250697 11:84810508-84810530 AACTGGATCGCTCACATTCCTGG + Intronic
1104061180 12:125269907-125269929 AGATGTGCCTCCCACATTCCAGG + Intronic
1104692870 12:130839513-130839535 AGCTGCACCCAGCACATTCCGGG - Intergenic
1105071282 12:133235724-133235746 CCCCGCGCCCCTCACATTCCAGG + Exonic
1118166617 14:63342517-63342539 AGCTGCGATGCTCACATTGGTGG - Intergenic
1122834811 14:104425433-104425455 AGAGGCCCCGCTCACAGTCCTGG - Intergenic
1136490488 16:30604788-30604810 AGAAGCGCCGCTCGCAGTCCGGG + Exonic
1143790649 17:9292678-9292700 AGCAGCACAGCTCACAGTCCTGG + Intronic
1143861176 17:9891880-9891902 AGGTGCTCCACACACATTCCTGG + Exonic
1147886915 17:43690615-43690637 AGCGGCGCCCCCCAAATTCCGGG + Intergenic
1150139893 17:62718711-62718733 AACAGCGCGACTCACATTCCTGG - Intronic
1150631440 17:66883130-66883152 AGCTGGGCTGATAACATTCCTGG - Intronic
1161379591 19:3958094-3958116 AGCTGAGCCGCTCCCCCTCCAGG + Intergenic
1166299715 19:41906796-41906818 AGGTGCCCCACTCACCTTCCTGG - Exonic
925826336 2:7851313-7851335 AGGTGAGCCTCTCACCTTCCTGG - Intergenic
942461602 2:176172143-176172165 AGTTGCGCCGCGCAGATTCCAGG + Exonic
942500549 2:176585904-176585926 AACTGGGCTGCTCACATTGCAGG - Intergenic
947846919 2:233251935-233251957 ACCGGCGCCGCTCACACTGCAGG - Exonic
1169197756 20:3692614-3692636 AGCTGCCTCACTCTCATTCCTGG - Exonic
1180183173 21:46127001-46127023 AGCTGCGGCTCTCACATCTCTGG + Intronic
1184285156 22:43466428-43466450 AGCTTCGCAGCTCACATTTCTGG + Intronic
963115346 3:141724358-141724380 AGCTGCGCCCCTCAGACACCAGG + Intergenic
981811678 4:148782559-148782581 AGCTGGACCCCTCACCTTCCTGG + Intergenic
986245573 5:6003779-6003801 ACCTGTTCCGCTCACCTTCCCGG + Intergenic
988397999 5:30721231-30721253 AACTGAGCCACTCACATTTCTGG + Intergenic
994756602 5:103800772-103800794 AGGTACTCCGTTCACATTCCTGG + Intergenic
996594439 5:125185038-125185060 AGCTGGGAGGCCCACATTCCAGG + Intergenic
999223580 5:150001142-150001164 AGCTGCGCCGCTCACATTCCCGG - Exonic
1006643934 6:35503544-35503566 AGGTGCGGGGCTCACATTTCGGG + Exonic
1007955802 6:45916890-45916912 AACTGCAGCCCTCACATTCCTGG - Intronic
1008965543 6:57310795-57310817 AGAGGCGCCCCTCACTTTCCAGG + Intergenic
1015787394 6:136931839-136931861 TGCTGCTTCGCTCACATCCCTGG - Intergenic
1026840389 7:73667652-73667674 AGCAGGGCGGCTCAGATTCCGGG + Intergenic
1028038365 7:86015425-86015447 AGATGGCCCGTTCACATTCCAGG - Intergenic
1031911147 7:127517870-127517892 AGCTGTGCACCCCACATTCCTGG + Intergenic
1034330515 7:150278346-150278368 AGCTGCACCAGTCACATTTCAGG + Intronic
1034667528 7:152831502-152831524 AGCTGCACCAGTCACATTTCAGG - Intronic
1040563141 8:48542429-48542451 AGCTGCGCCTCTCACTGTACTGG - Intergenic
1042878798 8:73465171-73465193 AGCTGGGCCCCTCAATTTCCCGG + Intronic
1049130173 8:140832504-140832526 AACTGCCCCCTTCACATTCCAGG - Intronic
1062653456 9:137590198-137590220 CTCCGCGCCGCTCACCTTCCCGG + Exonic
1192206198 X:69098086-69098108 AGCTGGGCCACCCACTTTCCAGG + Intergenic
1192885885 X:75335417-75335439 AGATGCGCCCCTCACTTCCCAGG + Intergenic
1193273892 X:79562810-79562832 AGGTGTGCCTCTAACATTCCTGG - Intergenic
1200158621 X:153992463-153992485 AGCTGCTCCTCACTCATTCCAGG + Intergenic