ID: 999223582

View in Genome Browser
Species Human (GRCh38)
Location 5:150001158-150001180
Sequence CGCAGCTTGCACGCTCCTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 148}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999223574_999223582 11 Left 999223574 5:150001124-150001146 CCGCCGGGCCAAGCGCCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223572_999223582 15 Left 999223572 5:150001120-150001142 CCAGCCGCCGGGCCAAGCGCCTC 0: 1
1: 0
2: 4
3: 15
4: 290
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223565_999223582 28 Left 999223565 5:150001107-150001129 CCATCCCCCTCGTCCAGCCGCCG 0: 1
1: 0
2: 2
3: 25
4: 282
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223577_999223582 3 Left 999223577 5:150001132-150001154 CCAAGCGCCTCCGGGAATGTGAG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223568_999223582 24 Left 999223568 5:150001111-150001133 CCCCCTCGTCCAGCCGCCGGGCC 0: 1
1: 0
2: 2
3: 29
4: 332
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223571_999223582 21 Left 999223571 5:150001114-150001136 CCTCGTCCAGCCGCCGGGCCAAG 0: 1
1: 0
2: 0
3: 4
4: 115
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223580_999223582 -7 Left 999223580 5:150001142-150001164 CCGGGAATGTGAGCGGCGCAGCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223579_999223582 -4 Left 999223579 5:150001139-150001161 CCTCCGGGAATGTGAGCGGCGCA 0: 1
1: 0
2: 0
3: 2
4: 44
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223576_999223582 8 Left 999223576 5:150001127-150001149 CCGGGCCAAGCGCCTCCGGGAAT 0: 1
1: 0
2: 0
3: 1
4: 77
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223569_999223582 23 Left 999223569 5:150001112-150001134 CCCCTCGTCCAGCCGCCGGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148
999223570_999223582 22 Left 999223570 5:150001113-150001135 CCCTCGTCCAGCCGCCGGGCCAA 0: 1
1: 0
2: 0
3: 5
4: 70
Right 999223582 5:150001158-150001180 CGCAGCTTGCACGCTCCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999223582 Original CRISPR CGCAGCTTGCACGCTCCTCC GGG Exonic