ID: 999223586

View in Genome Browser
Species Human (GRCh38)
Location 5:150001177-150001199
Sequence CGGGTAAGTCCCGCCTTCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 12
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 11}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999223576_999223586 27 Left 999223576 5:150001127-150001149 CCGGGCCAAGCGCCTCCGGGAAT 0: 1
1: 0
2: 0
3: 1
4: 77
Right 999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 11
999223579_999223586 15 Left 999223579 5:150001139-150001161 CCTCCGGGAATGTGAGCGGCGCA 0: 1
1: 0
2: 0
3: 2
4: 44
Right 999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 11
999223577_999223586 22 Left 999223577 5:150001132-150001154 CCAAGCGCCTCCGGGAATGTGAG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 11
999223574_999223586 30 Left 999223574 5:150001124-150001146 CCGCCGGGCCAAGCGCCTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 11
999223580_999223586 12 Left 999223580 5:150001142-150001164 CCGGGAATGTGAGCGGCGCAGCT 0: 1
1: 0
2: 0
3: 3
4: 57
Right 999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 11

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999223586 Original CRISPR CGGGTAAGTCCCGCCTTCGA GGG Exonic