ID: 999226453

View in Genome Browser
Species Human (GRCh38)
Location 5:150028862-150028884
Sequence AAATAAAGAAGACACTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 568}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999226453 Original CRISPR AAATAAAGAAGACACTGGGG AGG (reversed) Intronic
901598465 1:10403601-10403623 AAAAAAAAAAGACACTTGGTGGG + Intronic
901767060 1:11508516-11508538 AAAAAAAGAAGACACACGGAAGG - Intronic
901899321 1:12345047-12345069 ATATAATGATGTCACTGGGGTGG - Intronic
902108566 1:14058726-14058748 AAATAAAGAACAGAAAGGGGAGG + Intergenic
902300297 1:15497347-15497369 AAATAAAGAAGACATAGGCCAGG + Intronic
902882889 1:19384415-19384437 AAATAAAGAGGACAGTGGGAGGG - Intronic
904648759 1:31988307-31988329 AAAAAAAAAAAACTCTGGGGAGG + Intergenic
905479051 1:38248744-38248766 AAATAGAGAAGAGGATGGGGTGG - Intergenic
905703463 1:40036843-40036865 AGATAAAGAGGAAACTTGGGTGG + Intergenic
905819212 1:40976750-40976772 AAATAAAGACAACAGTGGGCTGG - Intergenic
906378327 1:45315079-45315101 AAATAATAAATAAACTGGGGTGG - Intergenic
906530175 1:46519468-46519490 AAAAGGAGAAGGCACTGGGGAGG + Intergenic
907680904 1:56562363-56562385 GCATAAAGAATACACGGGGGAGG + Intronic
907947023 1:59145229-59145251 TCATAAAGAAGACAGAGGGGAGG - Intergenic
908176336 1:61558878-61558900 AAATAAATAAAACACTTGGGTGG + Intergenic
908445495 1:64196180-64196202 AGATAAAGAAGGCTGTGGGGAGG - Intergenic
908567196 1:65369064-65369086 AAATAAAGAAGAAGATGGGCTGG - Intronic
908743167 1:67349410-67349432 CAATAAAGCAGACACTGGCAAGG - Intronic
908768372 1:67573994-67574016 AAAAAAAGACGAGGCTGGGGAGG - Intergenic
909093806 1:71261417-71261439 AAATATAGGTGACACTGGGTTGG + Intergenic
909461016 1:75914207-75914229 ATTTCAAGAAGACACTGAGGAGG + Intergenic
909472232 1:76041438-76041460 AATTAAAGAAGACCTTGGAGGGG - Intergenic
909950927 1:81719603-81719625 AAATGATGAAGTGACTGGGGAGG - Intronic
910035060 1:82779097-82779119 AAACTAAGGAGACAGTGGGGAGG - Intergenic
910369031 1:86496624-86496646 AAGTAAAGATGACAGTGGGAAGG - Intronic
910665988 1:89726426-89726448 ATATCAAGAAGACACTGGGAAGG - Intronic
910719106 1:90266025-90266047 AAATAAAGAAGAAGCTTGAGGGG + Intergenic
911669742 1:100594037-100594059 AAATAAAAAAGAAAATCGGGGGG - Intergenic
912187000 1:107289531-107289553 AAGTATAGAAAACCCTGGGGTGG - Intronic
912251612 1:108017831-108017853 ACATAAAGAACACACTGGAAAGG + Intergenic
912346532 1:108968341-108968363 AACTAAAGAAGAGACTGGGCCGG + Intergenic
913062861 1:115223868-115223890 AAATAGAGAAGAAACGTGGGAGG - Intergenic
913118963 1:115722069-115722091 AAACAAAGATGACACTGGAGAGG + Intronic
913397769 1:118391017-118391039 AAGTAAAGAAGAAAGGGGGGGGG + Intergenic
913544962 1:119859179-119859201 AAATGAAGAAGACTTTGGAGTGG + Intergenic
914676796 1:149912316-149912338 GAATAGAGAGGACCCTGGGGTGG - Intronic
915824829 1:159064427-159064449 GAAAAAAGAAGACCCTGGGTTGG + Intronic
917262179 1:173182078-173182100 TAATAAAGACCATACTGGGGTGG - Intergenic
917389154 1:174514257-174514279 AAAAAAAAAAAAAACTGGGGAGG + Intronic
917996082 1:180439592-180439614 AAAAAAAAAAAATACTGGGGAGG + Intronic
918241257 1:182622503-182622525 AAAAAAAAAAGACACTGAGAGGG - Intergenic
918437846 1:184534852-184534874 AAATATGGAAGAGATTGGGGCGG + Intronic
918790929 1:188827400-188827422 AAACAAAGAACACAATGCGGAGG - Intergenic
919664543 1:200279412-200279434 AAATAAAGATGAAATTTGGGTGG + Intergenic
919854179 1:201694430-201694452 AAAGATAGATGACCCTGGGGAGG + Intronic
919898841 1:202028561-202028583 AAAAAAAGAAGAAAATGAGGCGG + Intergenic
920320696 1:205120133-205120155 AAATAGAAAAGACATTGAGGAGG - Intronic
920902433 1:210124383-210124405 AAAGAAAGAAAACAGAGGGGAGG + Intronic
921098449 1:211907561-211907583 AAATGGGGAAGAGACTGGGGAGG + Intergenic
923620776 1:235577429-235577451 AAAAAAAGAAAACACTGAGATGG - Intronic
923652540 1:235887585-235887607 AAATAAAGGAAACAGTGGGCTGG + Intergenic
924282645 1:242453535-242453557 AAATAATGAATACACTGTGTAGG - Intronic
924579788 1:245313893-245313915 CATGAAAGAAGAGACTGGGGAGG - Intronic
924933749 1:248750958-248750980 AGAGCAAGAAGACACTGGTGAGG + Intronic
1062938755 10:1406657-1406679 AAATAAAGAAGGCTTTGGCGGGG + Intronic
1063183815 10:3632109-3632131 AAATAAGGAAGGCACTGTGTGGG + Intergenic
1063795845 10:9513168-9513190 AAAAAAAGAAAACAGTGGTGTGG + Intergenic
1064607136 10:17054334-17054356 AAAAAAAAAAAAAACTGGGGAGG + Intronic
1064684111 10:17841727-17841749 AAAAAAAAATGGCACTGGGGTGG - Intronic
1064880569 10:20048376-20048398 GAATATAGAAAAAACTGGGGTGG - Intronic
1065359900 10:24879660-24879682 TTCTAAAGAAGACACTGGGGAGG + Intronic
1065745696 10:28839622-28839644 AAAAAAAAAAGACACAAGGGAGG + Intergenic
1066217740 10:33304324-33304346 AAGCTAAGAAGACAATGGGGAGG + Intronic
1066501478 10:35999357-35999379 AAAAAAAGAAGACGGGGGGGAGG - Intergenic
1067131294 10:43567849-43567871 AAACAAAGAAGCCAATGGGCAGG + Intronic
1067241948 10:44505003-44505025 AAAAAAAAAAGACAGAGGGGAGG + Intergenic
1068868514 10:61919359-61919381 AAATGAGGAAGACGGTGGGGTGG - Intronic
1069243379 10:66170229-66170251 AAAAAAAAAAGACAATGAGGAGG - Intronic
1070127857 10:73636224-73636246 AAAGAAAGAGGAGACTGGAGAGG - Intronic
1071500642 10:86201700-86201722 AAAAAAAAAAGACACTGGCTTGG + Intronic
1072040247 10:91600204-91600226 TAATAAAGAAAAACCTGGGGAGG - Intergenic
1072631141 10:97147467-97147489 AAAAAAAGAGGGCACTGGGGAGG + Intronic
1072675215 10:97460592-97460614 AAACAAAAAACACACAGGGGAGG + Intronic
1072957537 10:99900625-99900647 AAAAAAATAAGAAACTGAGGGGG - Intronic
1073228602 10:101946525-101946547 AAATAAAGAATTCACTGGGTGGG + Intronic
1073312193 10:102551036-102551058 AAAAAAAGAAGTCACTGGCCAGG - Intronic
1073375241 10:103028778-103028800 AAAGAAAGAAGAAAATGGGAGGG - Intronic
1073657867 10:105436854-105436876 AAATTAAAAATACACTGGGTAGG - Intergenic
1073926218 10:108519494-108519516 AATTGAAGATGAGACTGGGGTGG - Intergenic
1075026584 10:118989213-118989235 AAATAAAGAAGACATAGGCTGGG + Intergenic
1075252485 10:120892992-120893014 AAAAAAAAAAAACACTGGGGAGG - Intronic
1075412600 10:122240070-122240092 TACTGATGAAGACACTGGGGTGG - Intronic
1075669561 10:124255078-124255100 AATTCAAGATGAGACTGGGGTGG - Intergenic
1075784610 10:125040516-125040538 AAATACAGAAGACAATAGAGTGG - Intronic
1076293119 10:129362779-129362801 ACATAAAGAAGGCAGTGGGCTGG - Intergenic
1077865503 11:6218225-6218247 TAAGAAAGAAGACAATGGGGAGG + Intronic
1078381631 11:10847542-10847564 AAATTTAGAAGACATTGGAGGGG - Intronic
1078495914 11:11816760-11816782 AAATAGAGGAGACCCAGGGGAGG + Intergenic
1078730469 11:13969520-13969542 AAATCAAGAAAACAAAGGGGTGG + Intronic
1078927381 11:15886861-15886883 AAGCAAAGGAGACACAGGGGAGG + Intergenic
1078969691 11:16393629-16393651 AAAATAAGAAGACACAGGTGTGG - Intronic
1079250899 11:18786840-18786862 AAAAAGAGAAGGCAGTGGGGAGG - Intronic
1079710351 11:23675818-23675840 AAAAAAAGCAGATACTGGTGAGG + Intergenic
1080139028 11:28892240-28892262 AAATAAAGAAGACAGTAAGTAGG - Intergenic
1081715291 11:45245878-45245900 GAAGAGAGAAGAGACTGGGGTGG + Intronic
1082078038 11:47989784-47989806 AGATAAATAAGACCCTAGGGTGG + Intronic
1082099018 11:48156566-48156588 AAAAAAAAAAAACCCTGGGGTGG - Intronic
1083477653 11:62924406-62924428 AAAAAAAAAAGCCAGTGGGGTGG - Intergenic
1083754544 11:64783924-64783946 AAATAAAAAATACATTGAGGTGG + Intergenic
1083806420 11:65076980-65077002 AAATAAACAAGACACGGGGCAGG + Intronic
1083980212 11:66161484-66161506 AAATAAAGAAGGCACTAGAGTGG + Intronic
1084368816 11:68723998-68724020 AGAAAAAGAAGCCAGTGGGGTGG + Intronic
1084618851 11:70254692-70254714 AAAAAAGAAAGACACTGAGGAGG - Intergenic
1084921959 11:72478297-72478319 AAAACAAGAAGACCCTGGAGTGG + Intergenic
1085263606 11:75223560-75223582 AGATACAGAAGACACCAGGGAGG - Intergenic
1085660104 11:78356187-78356209 AAAAAAAAAAGACACAGTGGTGG + Intronic
1086946241 11:92846514-92846536 TCATCAAGAAGAGACTGGGGTGG + Intronic
1087268122 11:96083157-96083179 GGATAAAGAACACACTGGAGGGG - Intronic
1087481275 11:98703676-98703698 CGAGAAAGAAGACACTTGGGAGG - Intergenic
1087497446 11:98908803-98908825 AAATAAAGATGAGATTTGGGTGG - Intergenic
1088707235 11:112474774-112474796 AAATAAAAAAGGCACTTGAGGGG - Intergenic
1089534748 11:119154142-119154164 AGGTAAGGAAGAGACTGGGGTGG + Exonic
1089617677 11:119704209-119704231 AAAAAAAGGAAACACTGGGGTGG - Intronic
1089656396 11:119950011-119950033 AAAAAAATAAGACACTGTGCTGG + Intergenic
1090836671 11:130459015-130459037 AAAAAAAAAAAACACTTGGGAGG - Intronic
1090922000 11:131215002-131215024 AAAGAAAGAAGAAACCGGGCTGG + Intergenic
1091034334 11:132219631-132219653 ACATGAGGAAGACAGTGGGGGGG - Intronic
1091157380 11:133386197-133386219 AAAGAAAGAAAAAACTGGGTTGG - Intronic
1091175524 11:133554289-133554311 AGATAAAGGAAACACTGGGAAGG + Intergenic
1091804319 12:3345056-3345078 AAAAAAAGAATACATTGGGTGGG - Intergenic
1091832310 12:3558258-3558280 AAATAAAGAAGGGAAAGGGGAGG - Intronic
1092146745 12:6219863-6219885 AAATGAAGAGGACACAGGAGAGG + Intronic
1092298649 12:7223620-7223642 AAATCAAGAAGAAACTGAAGAGG + Intergenic
1092553598 12:9530990-9531012 AAATAAAAAAAAAAGTGGGGGGG - Intergenic
1092688680 12:11081797-11081819 AAATAGAGAAGATATGGGGGAGG + Intronic
1092763270 12:11828781-11828803 AAAGAAAAAAGATAATGGGGAGG - Intronic
1093853965 12:24075979-24076001 AAAGGAGGAGGACACTGGGGAGG + Intergenic
1094518500 12:31159633-31159655 AAATAAAAAAAAAAGTGGGGGGG + Intergenic
1095275811 12:40281331-40281353 AATTAAAGCAGGCACTGTGGAGG - Intronic
1096142016 12:49250227-49250249 AAAAAGAGAAGACACTGGCTGGG + Intronic
1096558705 12:52420292-52420314 AAAGGAAGAAGGCACAGGGGAGG - Intergenic
1098028079 12:66226651-66226673 AAATGAACAACACACTGGTGTGG - Intronic
1098284386 12:68893153-68893175 AAAAAAAAAAGACAGTAGGGTGG + Intronic
1098449202 12:70600685-70600707 AAATAAGGAAGACACTTAGAAGG - Intronic
1098486666 12:71029365-71029387 AAATGATGAAGAAACTGAGGTGG - Intergenic
1098626123 12:72671733-72671755 AACTAAAGAAGACTCTGGCATGG + Intergenic
1098664450 12:73143872-73143894 AAAAAAAATAGACACTGTGGTGG + Intergenic
1098860197 12:75700847-75700869 AAATAAATAAAAGAATGGGGAGG + Intergenic
1099105285 12:78488433-78488455 AAAAAGAGAAGACACTGGAAAGG + Intergenic
1099710423 12:86217152-86217174 AAATAAATAAGAAACTGGAGAGG - Intronic
1100908204 12:99326169-99326191 AATTCAAGATGAGACTGGGGTGG + Intronic
1101217685 12:102601125-102601147 CAATGAAGAAGACACTTGGCTGG - Intergenic
1101681810 12:106975674-106975696 TAATAATGAAGCCACTGAGGGGG - Intronic
1102185319 12:110943189-110943211 AAAGAAAGCTGAAACTGGGGAGG - Intergenic
1102478839 12:113206757-113206779 AAAAAAAAAAATCACTGGGGAGG + Intronic
1102777595 12:115534008-115534030 AAATAAAGAAAAAAGTGGTGAGG + Intergenic
1102842570 12:116141742-116141764 ACATGGAGAAGACACTGGGTTGG - Intronic
1103685936 12:122731898-122731920 AAAGAAAGAAGAAAATGGGGTGG + Intergenic
1104114738 12:125738321-125738343 AAGTAAAGCAGACACTGAAGAGG - Intergenic
1104190146 12:126473881-126473903 AAAAAAAATAGACACTGGTGAGG + Intergenic
1105910219 13:24857491-24857513 AAATAAGGGAGACACAGTGGTGG - Intronic
1105938807 13:25128588-25128610 AAAAAAAAAAGAAAGTGGGGAGG + Intergenic
1106190600 13:27449450-27449472 GCATAAAGAAGAAACTGGAGAGG - Intronic
1108331630 13:49390561-49390583 AAATAGAGCAAACCCTGGGGGGG + Intronic
1109685978 13:65819917-65819939 AAATAAAGATGAGATTTGGGTGG - Intergenic
1109901327 13:68776047-68776069 AAAATAAGAAGAAACAGGGGAGG - Intergenic
1110595556 13:77317246-77317268 AAATAAAGAAGTCACCAGGCTGG - Intronic
1110745243 13:79045094-79045116 AAATATAGAAGACAGAGGGCAGG - Intergenic
1110837297 13:80098556-80098578 AAATAAATATAACACTTGGGAGG + Intergenic
1111192313 13:84825494-84825516 AAAAAAAAAAGATACTGGTGGGG - Intergenic
1111421380 13:88015996-88016018 AAATAAAGAAGTAAATGTGGAGG - Intergenic
1111955936 13:94758505-94758527 AAAGATAGAACAGACTGGGGAGG - Intergenic
1112118689 13:96385499-96385521 AAAGACAGAAGACTCTGGGATGG + Intronic
1112322143 13:98417478-98417500 AAAAAAAGAACACATGGGGGTGG + Intronic
1112717643 13:102204919-102204941 AGATAAAGTAGACAATGTGGGGG + Intronic
1112781340 13:102904229-102904251 AAGCAGAGAGGACACTGGGGTGG + Intergenic
1113124587 13:106962604-106962626 AGATAAAGGAGAGACAGGGGTGG + Intergenic
1114791383 14:25662475-25662497 AAAAAAAATAGACAGTGGGGAGG + Intergenic
1114927809 14:27426773-27426795 AGATAATGATTACACTGGGGTGG + Intergenic
1114950844 14:27751671-27751693 AAAGCAAGTAGACAGTGGGGGGG + Intergenic
1115004359 14:28463772-28463794 AATTAAAGATGAGACTTGGGTGG + Intergenic
1115189915 14:30737149-30737171 CTATAAAGAAAACACTGGGCCGG + Intergenic
1115628648 14:35220985-35221007 AGATCAAGAAGAGACTGGGGAGG + Intronic
1115804641 14:37037090-37037112 AAATAAAGCAGAGGCTGGGGCGG + Intronic
1117296648 14:54386606-54386628 GAAAAAACAAAACACTGGGGAGG + Intergenic
1117679270 14:58186657-58186679 AAACAAAGAAGAAACTGATGTGG + Intronic
1117850719 14:59965911-59965933 AAAAAAAAAAGATACTGGTGAGG + Intronic
1118078931 14:62335806-62335828 AAAAAAAAAAAAAACTGGGGCGG + Intergenic
1118764930 14:68903541-68903563 AAAAAAAAAAGCCACTGGTGGGG + Intronic
1118834380 14:69466000-69466022 AAATAAGGAAGACACATGGAGGG + Intergenic
1119012980 14:71015903-71015925 AAAAACAGAAGACAGTGTGGTGG + Intronic
1119234317 14:73006697-73006719 AAAAAAAAAAGGAACTGGGGTGG - Intronic
1119776282 14:77250804-77250826 AAAAAATGAAGTCTCTGGGGTGG - Intronic
1119840749 14:77791029-77791051 AAAAAAAAAAGACACTGCTGTGG - Intergenic
1122052372 14:99068586-99068608 AAATAAAGATGACACAGCAGAGG - Intergenic
1122735984 14:103842286-103842308 AAAAAAAGAAGGCACTCTGGTGG - Intronic
1124123756 15:26916072-26916094 AATTAAAGAAGAAACTGGTGTGG - Intronic
1125671503 15:41476768-41476790 TAATAAAATAGACCCTGGGGTGG + Intronic
1126731802 15:51691220-51691242 AAAAAGAGAAGAGACTGGGGAGG + Intronic
1126927797 15:53610172-53610194 AAATAGAAAGGACACTGGAGAGG - Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127269572 15:57388316-57388338 AAATAAAGAAAATTCTAGGGTGG + Intronic
1127355286 15:58193347-58193369 AAATAAAAAAGAAAATGTGGAGG + Intronic
1127421424 15:58810022-58810044 GAATAAAACAGACACTGAGGTGG - Intronic
1127987185 15:64082662-64082684 AAATTAAGGAGACAATGGTGGGG - Intronic
1128966121 15:72060421-72060443 AAATAAAAGAGCCACTGGTGAGG + Intronic
1129124081 15:73422911-73422933 AAAAAAAAAAGCGACTGGGGTGG - Intergenic
1129511411 15:76125855-76125877 AAAAAAAAAAGGCAGTGGGGGGG + Intronic
1130719503 15:86372788-86372810 AAATTAAGAAGACAAGGGGTAGG + Intronic
1131142086 15:89985031-89985053 GACTGAGGAAGACACTGGGGAGG + Intergenic
1132138601 15:99369214-99369236 AAATAAAGAAGAATCTAGTGAGG - Intronic
1133543174 16:6776113-6776135 CAAGAAAGAATACACTGGGCTGG + Intronic
1133791691 16:9013861-9013883 AAAAAAAAAAGTCAGTGGGGTGG - Intergenic
1134340122 16:13337182-13337204 AATTCAAGATGAGACTGGGGTGG - Intergenic
1134440898 16:14299065-14299087 AAAAAAAGAATACACAGGGCTGG - Intergenic
1134444897 16:14323245-14323267 AAATAAATAAAACACGGAGGAGG - Intergenic
1135065259 16:19304404-19304426 AAAAAAAAAAGACACTAGGCCGG + Intronic
1136050065 16:27643906-27643928 AAATAAAAAAGAAAAAGGGGTGG - Intronic
1136179474 16:28541064-28541086 AAATAAAAAAGATACTGGCCAGG - Intergenic
1137004325 16:35258649-35258671 TAATGCAGAAGACACTGAGGAGG + Intergenic
1137027259 16:35489253-35489275 AACTGCAGAAGACACTGAGGAGG + Intergenic
1138817524 16:60220434-60220456 AATTGGAGAAGACACTGGGGAGG - Intergenic
1139151561 16:64387869-64387891 AAATAAAGAGGACAATGGAAAGG - Intergenic
1140300637 16:73754042-73754064 AAATACACAAGACATTTGGGAGG - Intergenic
1140616303 16:76668387-76668409 AAAGGAAGATGACACTGGGTGGG + Intergenic
1140964292 16:79949733-79949755 AAAAAAAACAGACACTGGAGAGG + Intergenic
1144035222 17:11358954-11358976 AAAGAAAGAAAACTCTGGGCTGG - Intronic
1144142213 17:12360668-12360690 AAAGAGAGAAGACACTGGAGAGG + Intergenic
1144435491 17:15236054-15236076 AAAAAAAAAAGACAGTGGGCGGG - Intronic
1144538675 17:16116240-16116262 AATTAAAGATGAGACTTGGGTGG + Intronic
1146647725 17:34586207-34586229 AAGTAAGGAAGACCCTGGGGAGG - Intronic
1147012774 17:37464844-37464866 AAAAAAAAAAGACAGTGAGGTGG + Intronic
1147173693 17:38637490-38637512 AAACAAAGAAGGAACTGGGCAGG + Intergenic
1147442391 17:40455194-40455216 TAATAATGAGGAAACTGGGGTGG - Intronic
1148331562 17:46816968-46816990 ACATAAAGAAGTCCATGGGGTGG - Intronic
1148680580 17:49471201-49471223 AAATAGAGCAGACTCTGGGCAGG + Intronic
1149349485 17:55772587-55772609 AAAAAAAAAAGACACTGAGGTGG + Intronic
1151220041 17:72605536-72605558 AAAAAAAAAAGACACAGGGAGGG + Intergenic
1153559832 18:6361029-6361051 AAAAAAAAAAGATACTGGGTAGG + Intronic
1153947322 18:10029381-10029403 GGAAAAAGAAGACACTGGGGAGG + Intergenic
1154938040 18:21080674-21080696 AAATAAAAAAAGCACTGAGGTGG + Intronic
1155086317 18:22462750-22462772 AAATAAAAAACAAACTGTGGCGG - Intergenic
1155630919 18:27891223-27891245 AGATAAAAAAAGCACTGGGGTGG + Intergenic
1156070232 18:33198060-33198082 AAATAAATCAGACAGTGGGAGGG + Intronic
1157347414 18:46852362-46852384 AAAAATAGAAGGCAATGGGGAGG - Intronic
1158060830 18:53339145-53339167 AAAGAAAGAAGACAGTGGCCTGG - Intronic
1158387167 18:57008133-57008155 AACGAAAGAAGACCCTGGGGAGG - Intronic
1158508812 18:58071420-58071442 AAATGAAGAATTCACTGGAGGGG + Intronic
1159523579 18:69558373-69558395 AAATAAAAAGGGCACTGGAGTGG - Intronic
1160845747 19:1165285-1165307 GAATAAAGGAGGCCCTGGGGAGG + Intronic
1161833388 19:6627147-6627169 AAGGAAAGAAGACAATGGGAGGG - Intergenic
1162719521 19:12654013-12654035 AAAAAAAGAAAAGGCTGGGGTGG - Intronic
1162720275 19:12657975-12657997 AAAAAAAGAAGAAACTCGAGGGG + Intronic
1162891356 19:13735513-13735535 AAAAAACACAGACACTGGGGTGG - Intronic
1163119536 19:15208823-15208845 AAAAAAAGAAGAGGCTGAGGCGG + Intergenic
1163930091 19:20381345-20381367 AAAAAAAGAAAATACTTGGGGGG - Intergenic
1164953589 19:32361618-32361640 AAGGAAGGAAGACACTGAGGAGG - Intronic
1165208993 19:34217609-34217631 AAAAAAAAAAAACACGGGGGGGG - Intronic
1165233199 19:34400308-34400330 AAATAAAGATGCCACGGAGGAGG + Exonic
1165666012 19:37629265-37629287 AAAAAAAAAAGATACTGGTGGGG - Intronic
1165704589 19:37966655-37966677 AACAGAAGAAAACACTGGGGAGG - Intronic
1166947554 19:46406249-46406271 AAAAAAAAAAGACATGGGGGTGG - Intergenic
1167010125 19:46801724-46801746 AAAAAAAGAAGAAGCTGGGGAGG - Intergenic
1167533560 19:50034163-50034185 AAAGACAGAAGACCCTGGGATGG - Intronic
1167699762 19:51035603-51035625 AAAAAAAAAAGACACAGGGAAGG + Intergenic
1167926414 19:52824666-52824688 AAATAAAGAAAAATCTGGAGAGG + Intronic
1167926995 19:52829367-52829389 AAATAAAGAAAAAAATAGGGGGG - Intronic
1167986467 19:53322291-53322313 AAATAAAAAATACACTTGAGAGG - Intergenic
925112713 2:1350115-1350137 AAATGTAGAAGGCACTGGGGGGG - Intronic
925739643 2:6994554-6994576 AAATGAATATGACCCTGGGGAGG + Intronic
925908203 2:8552201-8552223 AAAAAAAGAATACACTGAAGTGG + Intergenic
926077548 2:9952792-9952814 AAATAACTAAGAAACTGGGAGGG - Intronic
926309231 2:11662453-11662475 AAATAGAGAAAACAGAGGGGAGG + Intronic
926632730 2:15151831-15151853 AAATAAAAAAGACTCTTGAGTGG - Intergenic
927458253 2:23275883-23275905 AAAAAAAGAAGAAACATGGGTGG + Intergenic
927477254 2:23423345-23423367 GAAGAGAGAAGACCCTGGGGTGG - Intronic
927675199 2:25100487-25100509 AAAAAAAGAAAATACAGGGGAGG - Intronic
927785055 2:25968125-25968147 AAATGAAAGAGACAATGGGGAGG + Intronic
927876976 2:26664079-26664101 AAATAAAGAAGACACACAGGTGG - Intergenic
928020183 2:27698463-27698485 AAATTAAGCAGAGACTGAGGTGG + Intergenic
928571034 2:32608705-32608727 AAATAAAGAATAGGCCGGGGCGG - Intronic
929293157 2:40215997-40216019 AAAAAAAGCATACACTGGGAAGG - Intronic
929370275 2:41215049-41215071 AAATAAAGAACATATTGGTGTGG - Intergenic
929902049 2:46013422-46013444 AAACCAAGAAGACTCAGGGGAGG + Intronic
930224214 2:48776093-48776115 AAATGAAGAGGATACTGGGTAGG - Intronic
930493287 2:52105193-52105215 AAAAAAAAAAGAAACTGAGGAGG + Intergenic
931261115 2:60620202-60620224 AAAAAAAAAAGGCAGTGGGGTGG + Intergenic
931531740 2:63222380-63222402 TAAAAAACAAGACACTGGCGTGG + Intronic
933408025 2:81887638-81887660 AAATAATGAAAACACAGGGAGGG - Intergenic
933585349 2:84174079-84174101 AATCAAAGAAGACAGTGGAGAGG + Intergenic
936010345 2:108921443-108921465 AAATCAAGAAAACAGAGGGGAGG + Intronic
936043122 2:109164930-109164952 AAATAAAAATGACAATGGGGAGG + Intronic
936745904 2:115576029-115576051 AAATAAAGATGACAGTGAGGAGG - Intronic
937627655 2:124061526-124061548 AAAGAAAGAAGACCATGGGGAGG + Intronic
938667654 2:133555360-133555382 AAATGAAGAGGACATTGTGGTGG - Intronic
938687784 2:133757051-133757073 AATTAAAGATGACATTTGGGTGG + Intergenic
939383390 2:141465356-141465378 AAATAAGGAAGAAACTGGGCAGG + Intronic
940713837 2:157195618-157195640 AAAAAAAGAAGACACATGGTGGG + Intergenic
940761240 2:157741740-157741762 GAACAGAGAAGACAGTGGGGAGG + Intronic
942373838 2:175315217-175315239 AAAAATAGCAGACACTGGTGAGG - Intergenic
942431605 2:175917473-175917495 AATTAAAGAACAAGCTGGGGTGG + Intergenic
942436904 2:175988738-175988760 TAATAAAGAAGACATTTGGAAGG - Intronic
942524434 2:176838472-176838494 AAATAAATAAGACATGAGGGAGG + Intergenic
942999717 2:182310993-182311015 AGATACAGAAGACACAGTGGAGG + Intronic
943231039 2:185252501-185252523 AAATAAAAAAAACACAGAGGAGG - Intergenic
944971476 2:204998122-204998144 AATTAGAGAAGACACGGGGAGGG + Intronic
945131562 2:206578888-206578910 AAAAACAGTAGACACTGGCGTGG - Intronic
945789109 2:214281376-214281398 AAATTTAGAAGACAATGGGACGG - Intronic
946126215 2:217565393-217565415 GAAGAAAGAAGTCACTGGAGAGG + Intronic
946336859 2:219043418-219043440 AAAAAAAAAAATCACTGGGGAGG + Intergenic
946798410 2:223382505-223382527 TAATCAGGAAGAGACTGGGGAGG + Intergenic
947041658 2:225928826-225928848 AAAGAAGGAAGACACAGGAGGGG + Intergenic
947283836 2:228487656-228487678 AGGCAAAGAAGACAATGGGGAGG - Intergenic
947505694 2:230706894-230706916 AAAAAAAGAATGCACAGGGGTGG - Intergenic
948345149 2:237289877-237289899 AAATAAATAAAACAGTGTGGGGG + Intergenic
948744043 2:240072609-240072631 AAATAAAGAAGAGATTGGGAAGG + Intergenic
1169160174 20:3370862-3370884 AAACAAAGAAGAGATTTGGGTGG - Intronic
1169696066 20:8387991-8388013 AAAAAAAGAAGAAACTGAGAAGG + Intronic
1169836768 20:9888828-9888850 AAAAAAAGAAAACTCTGGCGTGG + Intergenic
1170826390 20:19799782-19799804 AAATGAAGAAAACGCTGGGGTGG - Intergenic
1171155528 20:22869460-22869482 TAATAAAGAAGACTCCGGGGTGG + Intergenic
1172527929 20:35611821-35611843 AAAAAAAAAAGACTGTGGGGAGG - Intergenic
1172914043 20:38430637-38430659 AAATAAATAACAGACTGGGCTGG + Intergenic
1173261122 20:41437303-41437325 AGATAAAGAAGACAATGCTGAGG - Exonic
1173430574 20:42983749-42983771 AAAGAAACACGACAGTGGGGTGG - Intronic
1173647461 20:44642389-44642411 AAAGAAAAATCACACTGGGGTGG + Intronic
1173938702 20:46891683-46891705 AATTAAACCAGACTCTGGGGTGG - Intergenic
1174024874 20:47565722-47565744 AAAAAAGGAAGAAACTGAGGAGG + Intronic
1174066058 20:47866860-47866882 AAAAAAAGAATAGACTGAGGTGG - Intergenic
1176003877 20:62848739-62848761 AAAAAAAGTAAACACTGGGCCGG + Intronic
1177045143 21:16159942-16159964 AAAAAAAGAAGACACAGAGGGGG + Intergenic
1177096086 21:16835196-16835218 AAATAAAAAATCCACTGGGTAGG + Intergenic
1177267194 21:18799937-18799959 AAATACTGAAGACACTGGAAAGG + Intergenic
1177387991 21:20432710-20432732 TAATTAAGAAGAAAGTGGGGAGG + Intergenic
1177946532 21:27477452-27477474 AAATTAAGTATACACTTGGGAGG + Intergenic
1178162051 21:29929093-29929115 AAATAAAGCAGATACTGCAGAGG + Intronic
1178476648 21:32943249-32943271 AAGAAAAGAAAACACTGGGCAGG - Intergenic
1178849445 21:36200844-36200866 AAAAAAAAAAGACACGGGGAAGG + Intronic
1180797697 22:18614822-18614844 CAAGAAAAAGGACACTGGGGTGG + Intergenic
1181224020 22:21380438-21380460 CAAGAAAAAGGACACTGGGGTGG - Intergenic
1181254612 22:21554379-21554401 CAAGAAAAAGGACACTGGGGTGG + Intronic
1181561192 22:23702114-23702136 AAAAAAAAAGGACACTGGTGTGG + Intergenic
1181688583 22:24545595-24545617 AAAAAAAGAATATAGTGGGGTGG - Intronic
1181871743 22:25904795-25904817 AAATAAAATAGACACTAAGGAGG + Intronic
1182096628 22:27630409-27630431 AAAGAAAGAAGGCACGGGGCGGG - Intergenic
1182362947 22:29758041-29758063 AGAGAAAGAAGACACTGAGATGG - Intronic
1183280862 22:36931698-36931720 AAAGAAAGCAGAAACTGGGCAGG - Intronic
1183465286 22:37977305-37977327 AAAAAAAAAAGACTCTGTGGAGG - Intronic
1183511485 22:38237789-38237811 AAAAAAAAAAGACAGTAGGGAGG - Intronic
1183579228 22:38713593-38713615 AAATAAAGAAGGAACTGGTCAGG + Intronic
1183989909 22:41590740-41590762 AAAAAAAGAAGAATCTGGGAAGG - Intergenic
1184749340 22:46475644-46475666 AAATAAAGAAACGAATGGGGGGG + Intronic
949187251 3:1206933-1206955 AACTAAAGATCACACTGGTGAGG - Intronic
950144359 3:10637497-10637519 AAATGAAAAAGACACTGGATGGG + Intronic
950192378 3:10986621-10986643 AAAGAATGTGGACACTGGGGAGG - Intergenic
950235870 3:11319766-11319788 AAATCCACAAGACACAGGGGTGG - Intronic
950520901 3:13497158-13497180 AAAGAAAGAAAAAACTGGTGAGG - Intronic
950661544 3:14469748-14469770 AAGCAAAGAAGACAGTGAGGAGG - Intronic
950682689 3:14595865-14595887 AAATAAAGAAGAGAAGGGGGAGG - Intergenic
950739525 3:15039080-15039102 AAATACAGAGGGAACTGGGGGGG + Intronic
951693948 3:25426731-25426753 AAATAAAGGAAACTCTGGAGAGG - Intronic
951887590 3:27539242-27539264 AAAAAAAGAGTATACTGGGGTGG + Intergenic
951970078 3:28433909-28433931 AAAAAAAAAAAAAACTGGGGTGG - Intronic
952125223 3:30291793-30291815 AAAAAGAAAAGACACTAGGGTGG + Intergenic
952574418 3:34758093-34758115 TAAATAAGAAGACACTGGAGAGG + Intergenic
952658226 3:35813677-35813699 AAATAATTAAGACACAGGAGTGG + Intergenic
953297452 3:41734621-41734643 CAACAAAGAAGAGACTGAGGTGG + Intronic
953867594 3:46597426-46597448 AAATAAAGAAATCTCTGGGCTGG - Intronic
953991812 3:47489718-47489740 AAAGAAAGAAGACACTTGCCGGG - Intergenic
954079880 3:48207391-48207413 AAAGAAAGAAAACCCTAGGGAGG + Intergenic
954477194 3:50758246-50758268 AAAGAACTAAGACTCTGGGGCGG - Intronic
954598353 3:51846850-51846872 AAATAAAAAAGTCACTAGAGTGG - Intergenic
955082279 3:55668991-55669013 AATGAAAGAAGACACTGGGAGGG - Intronic
955822090 3:62907263-62907285 AAATGTGGAAGACACAGGGGTGG + Intergenic
956075843 3:65504535-65504557 ACACAAAGAAGACATTGGGGAGG + Intronic
956318269 3:67964875-67964897 AAAGAAAGAAGACATTGGAATGG - Intergenic
956343025 3:68247604-68247626 AAATAAAAATGACACGGGTGGGG - Intronic
956454187 3:69404752-69404774 CAATCAAGAAGACACTGAGAAGG + Intronic
957297451 3:78351223-78351245 AAAGAAAGAAGGAAGTGGGGAGG - Intergenic
957319742 3:78614281-78614303 AAAAAATGAAGACACTTTGGAGG + Intronic
957324010 3:78668599-78668621 AAATCAAGAACTCACTGGGCTGG + Intronic
959004137 3:101000004-101000026 AATTAAAGAAGACACAGATGAGG - Intergenic
959976121 3:112462009-112462031 CAAAAAATAAGACACTGGTGAGG + Intergenic
960301901 3:116012708-116012730 GAATAAAGAAGAGCCTGAGGTGG + Intronic
961794810 3:129401856-129401878 AAAACAAGAAGACACAGGGATGG + Intronic
962507698 3:136064418-136064440 AAAAAAATAAGACTCTGGAGGGG + Intronic
962625179 3:137219071-137219093 AAATAAAAAAAATACTGAGGTGG + Intergenic
962959221 3:140294552-140294574 AAAAAAAAAAGACATTGGGGAGG - Intronic
963118457 3:141754420-141754442 AAAAAAAAAAGACAGTGGTGAGG - Intergenic
963486042 3:145935433-145935455 CAATAAAGGAGATACTGGGGAGG - Intergenic
963902739 3:150747633-150747655 AACTAAAGAAGAAAATAGGGAGG + Intronic
964074962 3:152682712-152682734 AAAGAAAGCAAAAACTGGGGAGG - Intergenic
964115673 3:153133894-153133916 AAATAAATAAGATCCTGTGGTGG + Intergenic
964264109 3:154874978-154875000 AAGAAAAGAAGACCTTGGGGAGG + Intergenic
965005717 3:163019825-163019847 AAAAAAAAAATACAGTGGGGAGG - Intergenic
965676228 3:171199927-171199949 AAGTGAAGTGGACACTGGGGAGG - Intronic
965739544 3:171859302-171859324 AAAAAAAGAAAACAGTGTGGAGG + Exonic
966621241 3:181966549-181966571 AGAAAAAGAAGAGACTGTGGGGG - Intergenic
966814870 3:183881759-183881781 AAATACAAAAGATACTGGGCGGG + Intronic
966835918 3:184049412-184049434 AGAGAAAGAAGACAGTGTGGAGG + Intergenic
966957263 3:184895633-184895655 AAAAAAAAAAGAGAGTGGGGGGG - Intronic
966974748 3:185073955-185073977 AAAAAAAGAAGAGGCTGGGTTGG - Intergenic
967071098 3:185962928-185962950 AAATATGGGAGACAGTGGGGAGG + Intergenic
967423815 3:189303430-189303452 AAATAAAGAAGGCACTGGATTGG - Intronic
967507699 3:190271613-190271635 ATAGAAAGAAGACACTCGGACGG + Intergenic
967815951 3:193798254-193798276 AAATAATCAAAACACTGAGGAGG + Intergenic
968598696 4:1498872-1498894 AAGGAAAGAAGAGACTGGTGAGG - Intergenic
969466538 4:7360556-7360578 AAAAAAAGAAGGGACTGGGAGGG - Intronic
969569936 4:8002315-8002337 AATCAAAGAAGACACTGGGTTGG - Intronic
969761412 4:9186602-9186624 CCATAAACAAGACACTGTGGGGG + Intergenic
970221008 4:13811014-13811036 AAATGAAGAAGAGACTTGGGTGG - Intergenic
971052976 4:22882030-22882052 AAATTAAGATGACATTTGGGTGG - Intergenic
971505832 4:27365623-27365645 AAAAAAAAAAGGCACTGGGCAGG - Intergenic
971758258 4:30730591-30730613 AAATAATAAATACACTTGGGGGG - Intronic
972060119 4:34859152-34859174 AATTAAAGAAGACACTTGAAGGG + Intergenic
972100712 4:35411810-35411832 AAATAAAGATGATATTGGGGTGG + Intergenic
972705504 4:41538854-41538876 AAGCAAGGAAGACATTGGGGAGG + Intronic
973047057 4:45547750-45547772 AAGAAAAAAAGACACTGGTGAGG + Intergenic
974113332 4:57550796-57550818 AAATAAAGAGTACAGTGGGATGG - Intergenic
974139220 4:57863093-57863115 AATTAAAGACGAGACTTGGGTGG - Intergenic
974887491 4:67837806-67837828 AAATGAAGAAGCCTCTGAGGTGG + Intronic
975586025 4:75950120-75950142 AAACAAAAAAAACACGGGGGGGG + Exonic
975619395 4:76280843-76280865 AAAGACAGAAGACACTGGCCAGG - Intronic
975939895 4:79630017-79630039 TAATAGAGAAAACACTTGGGAGG - Intergenic
976799136 4:88968669-88968691 AAAAAAGGAAGAAAGTGGGGTGG - Intronic
977020474 4:91752883-91752905 AAATAAAGAATGCAATGGAGTGG + Intergenic
977401029 4:96532868-96532890 TAATAAAGAAGAGACTGGCCAGG - Intergenic
977476162 4:97512632-97512654 AAATAAAGAAAAGATAGGGGTGG + Intronic
977804813 4:101284647-101284669 AAAAAAAAAAGACATGGGGGTGG - Intronic
978501875 4:109418310-109418332 AAATACAAAAGACTCTTGGGAGG - Intergenic
978780205 4:112544386-112544408 AAAGAAACAAGATTCTGGGGTGG + Intronic
979397937 4:120211261-120211283 AGATCAAGAAGGCATTGGGGAGG + Intergenic
980862457 4:138516038-138516060 AGAGAAAGTAGTCACTGGGGAGG - Intergenic
980984723 4:139684336-139684358 AATTCAAGATGAGACTGGGGTGG + Intronic
981165885 4:141556341-141556363 AAAGAAAACAGACACTGGGCTGG - Intergenic
982962162 4:161853532-161853554 AAAAAAAAAAGCCACTTGGGAGG - Intronic
983142083 4:164162681-164162703 AAATAAGGAAGACAATGAAGTGG + Intronic
983238002 4:165201575-165201597 AAATAAATAAGACACAGAGTTGG + Intronic
983279286 4:165660009-165660031 AAAGACACAAGACACTGGCGCGG - Intergenic
983393354 4:167162046-167162068 AAAAAAAGAAGACACAGAGAAGG + Intronic
984444948 4:179824938-179824960 ACATAAAGGGGACACTGGGATGG - Intergenic
984812251 4:183805831-183805853 AAATAAAAATCACACTGGCGTGG + Intergenic
986030966 5:3892209-3892231 GAATACAGAAGACAATGGGAAGG + Intergenic
986623765 5:9704293-9704315 AAAAAAAGAAGATACTCTGGGGG - Intronic
986769004 5:10954960-10954982 AACTAAAGAAGACACAGCTGTGG - Intergenic
986859270 5:11906226-11906248 AACTCAAGAAGTCAGTGGGGAGG + Intergenic
987201954 5:15586272-15586294 AGAGAAAGAAGACAAGGGGGAGG - Intronic
987299541 5:16585249-16585271 AAACAGATAAGACAGTGGGGAGG + Intronic
987311023 5:16681210-16681232 AAATAAAGTACACACTAGGAAGG + Intronic
987674280 5:21053909-21053931 ATATAAAGAACACATTTGGGTGG + Intergenic
988142386 5:27260473-27260495 TAATAAAGAACACTCAGGGGAGG + Intergenic
988829625 5:34974715-34974737 AAATGAATAAAACACTGAGGTGG - Intergenic
989054398 5:37352833-37352855 AGATAAAGTAGACACAGGGCAGG + Intronic
989161891 5:38399246-38399268 AAATAAAAAAGAACCTGGGGAGG - Intronic
989610263 5:43284077-43284099 AAAAAAAGAATGCACTGGTGAGG - Intergenic
990078118 5:51876485-51876507 AAATAAAAAATTCACTGGGTTGG - Intergenic
990592390 5:57279701-57279723 GAATAAAGAAAAGACTGGGCTGG + Intergenic
990682042 5:58255787-58255809 AAAAACAGAAAACACTGGAGAGG - Intergenic
991058901 5:62350569-62350591 AGATCAAGAAGACACTAGGCTGG - Intronic
991308466 5:65208324-65208346 AATTAAAGAAGACTCTCTGGGGG + Intronic
991354866 5:65757935-65757957 AAATAAAAAAGATACTGGCCGGG + Intronic
993088228 5:83391468-83391490 AAATAAAGAAGCAATTGGGCTGG - Intergenic
993480328 5:88416664-88416686 CCATAAAGAAGAAACTTGGGTGG + Intergenic
993598467 5:89889489-89889511 AAATGGAGAAGAAACTGGAGAGG + Intergenic
993635727 5:90341219-90341241 ATAAAAAGAAGAGACTTGGGAGG + Intergenic
994013517 5:94937495-94937517 AAATAAAGAAGAAAGTAGGTGGG - Intronic
995622629 5:114043426-114043448 AAAAAAAAAAGATACTGGTGAGG + Intergenic
996087133 5:119316506-119316528 AGATAAAGAAGACCCTAGTGTGG + Intronic
996373986 5:122783238-122783260 AAAAAAACAAGTCACTGGGCAGG - Intronic
996560732 5:124826179-124826201 AAATACACAAGACACTGGAATGG - Intergenic
996982787 5:129519801-129519823 AAATCAAGAAGACACAGAGAAGG - Intronic
997773778 5:136579351-136579373 AAGAAAAGACAACACTGGGGAGG + Intergenic
998211832 5:140205484-140205506 AAAGAAAGAAGGCACTGGACTGG - Intronic
998739673 5:145186298-145186320 AAACAATGAAGACATTAGGGTGG - Intergenic
999226453 5:150028862-150028884 AAATAAAGAAGACACTGGGGAGG - Intronic
999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG + Intronic
1000672337 5:164078153-164078175 AATTCAAGATGACACTTGGGTGG - Intergenic
1000920960 5:167136589-167136611 AAATAAAGAAGAAATAGGGGTGG - Intergenic
1001964728 5:175902180-175902202 CAGGAAAGCAGACACTGGGGTGG + Intergenic
1003241836 6:4351959-4351981 AAATGAAGAAGCCACTGGGAGGG - Intergenic
1003378510 6:5601545-5601567 AAAAAAAGACGAGAGTGGGGAGG + Intronic
1003576370 6:7299695-7299717 AAAAAAAAAAGACAGTGGGCTGG + Intronic
1004112173 6:12729705-12729727 ACATACAGGACACACTGGGGAGG + Intronic
1005022823 6:21433949-21433971 AATTAATGCAGACACTGGGAGGG + Intergenic
1005486540 6:26305694-26305716 AACTAAAGAGGAGACTGGGAGGG + Intergenic
1006077328 6:31542225-31542247 GAATAAAGATAACAGTGGGGGGG - Exonic
1006219092 6:32472909-32472931 AAAGAAAGGAGATAATGGGGAGG + Intergenic
1006231265 6:32589136-32589158 AAAGAAAGGAGATAATGGGGAGG + Intronic
1006472570 6:34236976-34236998 AAAAAAAGAAGCCACCGGAGCGG - Exonic
1006650436 6:35546766-35546788 AAAAAAAAAAGAAACTAGGGCGG - Intergenic
1006781335 6:36634436-36634458 AAACAAACAAAACACTGGTGTGG - Intergenic
1006972657 6:38062666-38062688 AAATTAAGCAGACAATGGGCTGG - Intronic
1007204280 6:40135894-40135916 AACTAAAGATGAGACTTGGGTGG - Intergenic
1007403857 6:41621337-41621359 AAATAAAAAATACACTGGAGTGG - Intergenic
1007418073 6:41703612-41703634 AACAAAAGAAGACAGTGGAGAGG + Intronic
1008448964 6:51627003-51627025 CAAAAAAGAAGACACTGTGGTGG - Exonic
1008588629 6:52971021-52971043 AAAAAAAAAAGGCAGTGGGGGGG - Intergenic
1008766128 6:54917434-54917456 ATGTAAAGAAGACATTGGGAAGG - Intronic
1010701190 6:79049387-79049409 AATTAAAGAAAACACTTGGAAGG + Intronic
1011070650 6:83378180-83378202 AAATAATTAATACAATGGGGGGG + Intronic
1011840703 6:91494796-91494818 AAATAGAGAAAAAATTGGGGTGG - Intergenic
1011865882 6:91826384-91826406 AAATTATGAAGACAATGGGAGGG - Intergenic
1012755228 6:103222307-103222329 AAAAAAAAAAGATACTGGTGAGG - Intergenic
1012940324 6:105408606-105408628 AAATAAAGATGAGAATGGGGAGG + Intergenic
1013527673 6:110989917-110989939 AAAGAAAAAAGAAACTGGGCCGG - Intronic
1014106777 6:117573421-117573443 AAAGAAAGAAGAGGCTGGGTGGG + Intronic
1014311171 6:119803628-119803650 AAACCATGCAGACACTGGGGTGG - Intergenic
1015115758 6:129647676-129647698 AAAAAAAAAAGGCAGTGGGGTGG + Intronic
1015128474 6:129782630-129782652 AAATGAAAAAGACACTAGAGGGG + Intergenic
1015466414 6:133553189-133553211 AAAAAAAGAAGGCTCTGGGCAGG + Intergenic
1015710496 6:136134031-136134053 AAATTAAGGAGACATTGTGGGGG + Intronic
1015847425 6:137535413-137535435 AAATAAAGAAGCCACGGCTGGGG - Intergenic
1016619108 6:146087215-146087237 AAATAATTAAGACACAGGAGAGG - Intronic
1018022025 6:159770507-159770529 AAATTAAGAATTCACTGGGATGG + Intronic
1018486339 6:164244592-164244614 AGAGAAAGCAGACACTGGGGCGG - Intergenic
1019032779 6:169026873-169026895 AAATAAAGAAGAAAAATGGGTGG + Intergenic
1020140508 7:5608954-5608976 AAAGAAAGGAGAGACTGGGCTGG + Intergenic
1020148856 7:5666303-5666325 AAAGGAAGAATGCACTGGGGTGG + Intronic
1020286598 7:6686411-6686433 AAATAAAGAAAATCCTGGGCTGG - Intergenic
1020641336 7:10757866-10757888 AAAGAAAGAAGCCACGGTGGAGG - Intergenic
1021087792 7:16444014-16444036 AAAAAAAAAAGACTCTGTGGGGG - Intergenic
1021350723 7:19590647-19590669 AAAAATAAAAGACACTGGTGAGG - Intergenic
1021598952 7:22344749-22344771 AAAAAAAGAAAAAAGTGGGGAGG - Intronic
1021654088 7:22857824-22857846 AAAAAAAGAATATACTGGGCGGG - Intergenic
1022453315 7:30535812-30535834 AAAAGAAGAAAACTCTGGGGTGG - Intronic
1022656213 7:32321617-32321639 AACTTCAGCAGACACTGGGGAGG + Intergenic
1023608006 7:41947148-41947170 AAGTAAAGAAAGCACTAGGGTGG + Intergenic
1023853491 7:44164556-44164578 AAATGAAAAAGTCACTGGAGGGG + Intronic
1024224752 7:47317702-47317724 AAAGAAAGATGACACTGAAGTGG + Intronic
1025192448 7:56906493-56906515 AAAAAAAAAAGACTCTGGGGTGG + Intergenic
1025679500 7:63670431-63670453 AAAAAAAAAAGACTCTGGGGTGG - Intergenic
1026609348 7:71843825-71843847 GAAGAAAGAGGACACAGGGGAGG - Intronic
1028898179 7:96065347-96065369 AAAAAAAGAAAAGAGTGGGGAGG - Intronic
1029319990 7:99750338-99750360 AACAAAGGAAGAAACTGGGGTGG - Intergenic
1029917579 7:104227702-104227724 AAAAAAATAGGAAACTGGGGAGG + Intergenic
1030683604 7:112459460-112459482 GAAAACAGAAGACACTGAGGTGG + Intronic
1031275674 7:119719839-119719861 AAAAAAAGAAAAAACTGGGGTGG + Intergenic
1031341335 7:120605880-120605902 AATTAAAGAAGAGATTTGGGTGG - Intronic
1032122365 7:129166374-129166396 AGATAGAGAAAACACAGGGGAGG - Intronic
1032788458 7:135221023-135221045 AATTAAAGATGACATTTGGGTGG + Intergenic
1032997382 7:137463206-137463228 CAGTAAAGAAGACACTGGTGAGG + Intronic
1033000221 7:137495415-137495437 AAAGAAAGAAAACTCTGAGGAGG + Intronic
1033042495 7:137930933-137930955 AAAAAAAAAAGAAACTGGGCTGG + Intronic
1034247746 7:149661740-149661762 AAATACAAAATACACTGGGAAGG - Intergenic
1034413684 7:150954275-150954297 AAAAAAAGAAAACACTGGCCAGG + Intronic
1034571909 7:151962902-151962924 AAATAAAGAAGACATGGGCCGGG - Intronic
1035439386 7:158883643-158883665 AAAAAAAGAAGTCACTGGTCAGG - Intronic
1035439438 7:158883958-158883980 TATTAAAGAAGTCACTGGGCCGG - Intronic
1036456271 8:8911246-8911268 AAAAGAATAAGACATTGGGGAGG + Intergenic
1036612699 8:10363655-10363677 AAAGGAAGAACACACAGGGGTGG + Intronic
1037071901 8:14660764-14660786 AAATAAAGAAGAAACTGGAGAGG + Intronic
1037613491 8:20496000-20496022 ACATAGAGAAGACTCTGGAGGGG + Intergenic
1039014393 8:33129720-33129742 AAAGAAAAAAGGCATTGGGGGGG + Intergenic
1039167032 8:34693818-34693840 AAATATTGAAGAAACTGGAGTGG - Intergenic
1039789932 8:40867433-40867455 AAACTGAGAAGCCACTGGGGAGG - Intronic
1039954403 8:42196008-42196030 AAATAAAGAAGTAACTTGGTGGG - Intronic
1041205074 8:55491118-55491140 AAATAAAAAATACACTGGATTGG - Intronic
1041841156 8:62273048-62273070 CAATACAGAAATCACTGGGGTGG + Intronic
1042186457 8:66140930-66140952 AAATGAAGTAGTCCCTGGGGTGG + Intronic
1043636715 8:82392905-82392927 AAATAAATCAGACACTTGGCTGG - Intergenic
1043772788 8:84225725-84225747 AAATAAAGAGGACACCGTGAAGG - Intronic
1044184042 8:89230752-89230774 AAAGAAAGAAGAAATTGGGAAGG + Intergenic
1045086558 8:98693098-98693120 CAAAAAAGAAGACACAGGGCTGG + Intronic
1045687252 8:104724897-104724919 AAAGAAAGAAGACCCTGCTGAGG - Intronic
1046040344 8:108896076-108896098 AAATCAAAAAGTCACTGGAGGGG + Intergenic
1046161553 8:110373729-110373751 AAAAGAAGATAACACTGGGGAGG + Intergenic
1046932265 8:119853728-119853750 AAACAAGGACGACACTTGGGTGG - Intronic
1049895923 9:112083-112105 AGATAAAGAAGACACAAGGTTGG + Intergenic
1050686435 9:8175185-8175207 CAATAAAGAAGACTCTGGGCAGG + Intergenic
1050728263 9:8676868-8676890 AAATATAGATGACAATGGGCCGG - Intronic
1050779565 9:9314879-9314901 AAACAAAGAAGACAATGACGAGG - Intronic
1052203189 9:25807199-25807221 AAAGAAAATAGACATTGGGGTGG + Intergenic
1053739105 9:41122266-41122288 AGATAAAGAAGACACAAGGTTGG + Intergenic
1054689245 9:68309056-68309078 AGATAAAGAAGACACAAGGTTGG - Intergenic
1055017919 9:71639019-71639041 AAAAAAAGAAGACAAGGAGGAGG + Intergenic
1055178685 9:73354666-73354688 AAATAAAGAGGAAACTAGGAAGG - Intergenic
1055467774 9:76582541-76582563 AAAGAAAGAAAAGACTGTGGAGG - Intergenic
1055672694 9:78623344-78623366 TAATAAGGAAGACTCTAGGGTGG + Intergenic
1055747695 9:79468254-79468276 AAAAAAAAAAGACACTGGTCAGG + Intergenic
1055815189 9:80196614-80196636 AAGTAAAGAAGAAACAGGTGTGG + Intergenic
1055830005 9:80367169-80367191 AACCAAATAAGACACTTGGGAGG + Intergenic
1056265045 9:84888693-84888715 AAAGACAGAAGTCCCTGGGGTGG - Intronic
1056742868 9:89275291-89275313 AAATAAAGATGAGATTTGGGTGG + Intergenic
1057549520 9:96041660-96041682 AAAGAAAGCAGAAACTGGGCAGG + Intergenic
1057570061 9:96197665-96197687 AATTAAAGAAAAAAGTGGGGTGG + Intergenic
1057754169 9:97818094-97818116 AAATCAAGATGATGCTGGGGAGG + Intergenic
1058003783 9:99894571-99894593 CAATAAAGCAGACAGTGGTGAGG + Intergenic
1058732277 9:107861846-107861868 AGAAAAAGAAGAAAATGGGGAGG - Intergenic
1058892141 9:109370465-109370487 AAATAAAAAATAAACTGGTGTGG - Intergenic
1059102165 9:111482666-111482688 AAAGAAAGAAAACCCTTGGGGGG + Intronic
1059282154 9:113144205-113144227 AAAGAAAGAAAAAAATGGGGAGG - Intergenic
1060634325 9:125188387-125188409 AAAAAAAGAATACACTGAGTCGG + Intronic
1061067776 9:128289438-128289460 AAAAAAAAAAGAAAGTGGGGTGG - Intergenic
1061348948 9:130048772-130048794 AAAAAAAGAGGAAACTGGGCCGG - Intergenic
1061600317 9:131665429-131665451 GAATAAAGATGGCACTGGGCAGG - Intronic
1061609537 9:131737356-131737378 GAATGAGGAAGACACTGGAGGGG - Intronic
1061886313 9:133592687-133592709 AAGTAAAGAAGTCACTGGCCTGG - Intergenic
1185825336 X:3243882-3243904 AAAAAAAGAAGAGAGGGGGGAGG + Intergenic
1186828799 X:13369195-13369217 AAATAAAGAAGAAAATAAGGGGG - Intergenic
1187481093 X:19656340-19656362 AAGCCAAGAAGACAATGGGGAGG + Intronic
1187500376 X:19833719-19833741 AAAGAGAGAAGACCCTGGGAAGG - Intronic
1188053511 X:25514589-25514611 CAATAAAGAAGAGAGTGGGAGGG - Intergenic
1188188074 X:27140583-27140605 AAATAAAGAAGACATGGGCCAGG - Intergenic
1189824768 X:44907024-44907046 AAATGGAGAAGAGAGTGGGGGGG - Intronic
1189912428 X:45824528-45824550 ATATAGAGAAGGCACGGGGGAGG + Intergenic
1190005699 X:46735794-46735816 CAAGCAAGAAGACAGTGGGGTGG - Intronic
1190016824 X:46834929-46834951 AAAAAAAAAAGGCAGTGGGGAGG - Intergenic
1190195438 X:48314084-48314106 ATATAAAGCAGACACTTGGCAGG + Intergenic
1190415570 X:50177141-50177163 AAATAATAAAACCACTGGGGTGG + Intergenic
1190466909 X:50734384-50734406 AAAGAAAGATGAGACTGGGTGGG - Intronic
1191674443 X:63779567-63779589 AATTCAAGATGAGACTGGGGTGG + Intronic
1192136100 X:68602259-68602281 AAAAAAATAGGACACAGGGGTGG + Intergenic
1192911086 X:75605044-75605066 AAATAAAAAAGGAAGTGGGGAGG - Intergenic
1194645111 X:96450054-96450076 AAGGAAAGAAAACACTAGGGGGG + Intergenic
1194939097 X:99987883-99987905 AAAAAAAAGTGACACTGGGGTGG + Intergenic
1195382634 X:104285138-104285160 AAAAAAAAAAGCCAGTGGGGTGG - Intergenic
1195391664 X:104368617-104368639 CAAAAAAGAAAACACTGGGGTGG - Intergenic
1195725243 X:107908500-107908522 AGATAAAAAATACACTGGAGGGG - Intronic
1195769768 X:108338143-108338165 TAATAGAGAAATCACTGGGGAGG + Intronic
1195814958 X:108874722-108874744 TAGTACATAAGACACTGGGGAGG - Intergenic
1196267259 X:113665056-113665078 AAATAAAGCAGACCAAGGGGAGG + Intergenic
1196779641 X:119372039-119372061 AAAAAAAGCAGACACTGGCAAGG - Intergenic
1198836245 X:140807451-140807473 AAAAAAAAAAGACAATGGGTTGG - Intergenic
1198870313 X:141171929-141171951 AAAAAAAAAAGACACTAGGCCGG + Intergenic
1198930019 X:141846196-141846218 AAAAAAAAAAAACACTGGTGAGG - Intronic
1199242171 X:145560071-145560093 ATACAAAAAATACACTGGGGAGG + Intergenic
1199355265 X:146855231-146855253 AAATCAAGATGAGATTGGGGTGG - Intergenic
1199769941 X:150968862-150968884 AGAAGAAGAAGATACTGGGGTGG + Intergenic
1199905316 X:152222686-152222708 AAATAATGAAGACTCTACGGTGG - Intronic
1200683061 Y:6235649-6235671 TAATGAAGAAGACCCTGGGATGG + Intergenic
1200706819 Y:6450192-6450214 AGAAAAAGAAGAAACTGTGGAGG + Intergenic
1200832441 Y:7700230-7700252 TAAAGAAGAAGACACTGGGATGG - Intergenic
1201020120 Y:9647643-9647665 TAATGAAGAAGACAGTGGGATGG - Intergenic
1201027293 Y:9714516-9714538 AGAAAAAGAAGAAACTGTGGAGG - Intergenic
1201049572 Y:9918733-9918755 TAATGAAGAAGACCCTGGGATGG - Intergenic
1201360071 Y:13136805-13136827 AAATAAAAAATCCACTAGGGAGG + Intergenic
1201495203 Y:14585347-14585369 AAATAAAGAGGAAACTTGGATGG + Intronic
1202117121 Y:21479963-21479985 AAATAAAAGAGGTACTGGGGTGG - Intergenic