ID: 999229556

View in Genome Browser
Species Human (GRCh38)
Location 5:150053672-150053694
Sequence CTGTCTAGCCCCAAAGAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999229554_999229556 11 Left 999229554 5:150053638-150053660 CCTCTCAGAGAGGGAGATCTCAC 0: 1
1: 0
2: 0
3: 9
4: 136
Right 999229556 5:150053672-150053694 CTGTCTAGCCCCAAAGAGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999229556 Original CRISPR CTGTCTAGCCCCAAAGAGCC TGG Exonic
901758465 1:11455609-11455631 CTGCCTCGCCCCAAGGAGCAAGG + Intergenic
903083169 1:20829388-20829410 CAGTCTAGCCACAAAGTGACTGG + Intronic
906214536 1:44031087-44031109 CTGTCTCGCCGCAAAGATCGGGG - Intronic
906700900 1:47857353-47857375 CTGTTTAGGCACAATGAGCCGGG + Intronic
908576900 1:65469586-65469608 CTTTCCAGCCACAAAGAGCAAGG + Intronic
914851261 1:151316018-151316040 CTGTATAACTCCAAGGAGCCTGG - Exonic
920159861 1:203988292-203988314 TTCTCTAGCCACAAAGATCCAGG + Intergenic
921305837 1:213795929-213795951 CTGTCTAAAACCAAGGAGCCTGG - Intergenic
922580339 1:226692601-226692623 CTGTCTTCCTCCAGAGAGCCTGG + Intronic
923534852 1:234841134-234841156 CTGTCTAGTCCCAAAGGGGCTGG + Intergenic
1065871623 10:29960813-29960835 TTGGCTAACCCCAGAGAGCCAGG + Intergenic
1067288452 10:44924335-44924357 CTGTCTGGCCCCAGAGCTCCTGG + Intronic
1071866078 10:89733749-89733771 CTGTCCAGCCTCAAAGAGGAAGG - Intronic
1072219857 10:93317930-93317952 CTGCCGAGCCCCTCAGAGCCAGG - Intronic
1072237898 10:93468980-93469002 CTGTGTAGCCAGAAAGAGGCAGG - Intronic
1074575152 10:114661917-114661939 CTGTGTAGCCCCAAAACACCTGG - Intronic
1074847502 10:117411134-117411156 CTGTTCAGCCCCAAAATGCCTGG - Intergenic
1076779519 10:132716540-132716562 CTGTCTGCCACCAAAGGGCCGGG - Intronic
1076887691 10:133270110-133270132 CTGCCTACCCCCAAAGCCCCTGG + Intronic
1077303023 11:1855832-1855854 CTCTATAGCCCCCAAGAGCAAGG + Intronic
1081805826 11:45890017-45890039 CTGTCTAGACCCGCTGAGCCTGG - Intronic
1086052138 11:82605506-82605528 AAGTCTATACCCAAAGAGCCAGG + Intergenic
1088815378 11:113417079-113417101 CTGTTTAGCCCCAAGGAGTGAGG - Intronic
1090241038 11:125182003-125182025 AAGTGCAGCCCCAAAGAGCCAGG - Intronic
1090271648 11:125390055-125390077 CTGTCTAGGCAAAGAGAGCCCGG - Intronic
1092933288 12:13337344-13337366 GTGTCTAGTCACACAGAGCCAGG - Intergenic
1095801061 12:46269798-46269820 CGGCCTAGGCGCAAAGAGCCGGG + Intronic
1096427102 12:51513246-51513268 ACATCTAGCCACAAAGAGCCAGG - Exonic
1098576295 12:72046735-72046757 CTGTCTACACCCAAAGAACCAGG - Intronic
1102381477 12:112470384-112470406 CTTTCTACCCCCAAAGGGGCGGG - Intronic
1104900661 12:132188115-132188137 CTCACTAGCCCCTCAGAGCCAGG + Intergenic
1112104794 13:96229215-96229237 CTGTCTAGCACCAAAGTGATAGG - Intronic
1112295576 13:98183896-98183918 ATGTCAAGCCTCAGAGAGCCAGG - Intronic
1114556898 14:23567391-23567413 GTGTCAAGACCCTAAGAGCCCGG + Exonic
1121979855 14:98445132-98445154 TTGTTTAGCCCCACAGAGCAGGG - Intergenic
1122089973 14:99331434-99331456 GTGTCTAGCCCCAAAGAGGGAGG - Intergenic
1122876389 14:104667892-104667914 CTTTATAACTCCAAAGAGCCTGG + Intergenic
1122987754 14:105220426-105220448 CTGTCAGGCCCCAAAGACCGAGG + Intronic
1125391544 15:39197886-39197908 TTGTCAGTCCCCAAAGAGCCTGG - Intergenic
1127771265 15:62232713-62232735 CTACCTAGACCCAAAGAGACTGG + Intergenic
1130199353 15:81810676-81810698 CTGTCTGCCCCCCAAGTGCCTGG + Intergenic
1133552017 16:6865452-6865474 CTTTCTAGCCCCACACACCCAGG + Intronic
1136429533 16:30188480-30188502 CTACGTACCCCCAAAGAGCCGGG + Exonic
1139727311 16:68911662-68911684 CTGTCTCGGCCCAAAGTGCTGGG + Intronic
1144483690 17:15647663-15647685 CTGTCTAGCCTCCAGGAGCTTGG - Intronic
1144914997 17:18717361-18717383 CTGTCTAGCCTCTAGGAGCTTGG + Intronic
1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG + Intergenic
1146768808 17:35549259-35549281 CTGGATAACCCCAAAGAGCAAGG - Intronic
1147264811 17:39228089-39228111 CTGTCTCCTCCCAAAGAGCAGGG + Intergenic
1149775029 17:59350491-59350513 CTTTCTAGCACCAGACAGCCTGG + Intronic
1150832385 17:68535757-68535779 CTGTTTAGGCCCAAAGTGCTGGG + Intronic
1153063094 18:1014192-1014214 CTGCCTAACCACAAAGAGGCTGG + Intergenic
1155400124 18:25429087-25429109 CTCTCTTCCCCCCAAGAGCCCGG + Intergenic
1155983499 18:32205361-32205383 CTGTCTCGCCCCACACAGGCAGG - Intronic
1157569504 18:48703269-48703291 CTGTCTGCCCCCACAGTGCCTGG - Intronic
1158412275 18:57217964-57217986 CAGTCTAGCCCCTCAGTGCCAGG + Intergenic
1163019757 19:14475712-14475734 CTCTCTAGCTCCAAAGCCCCAGG - Intergenic
1164195669 19:22955997-22956019 CTTTGTAGCACCAAAAAGCCAGG - Intergenic
925905822 2:8539219-8539241 GTGTCAAGCAGCAAAGAGCCTGG + Intergenic
926414900 2:12639920-12639942 CTTTATAGCCCTAAAGAGCTTGG + Intergenic
936038881 2:109134025-109134047 CTGTCGAGACCCAAAGAACATGG - Intronic
942759687 2:179383407-179383429 CTTTCTAGCCCAAATGATCCTGG - Intergenic
948515997 2:238504318-238504340 CTGGCCAGCCCCCACGAGCCCGG - Intergenic
948965507 2:241376549-241376571 CTGCATAGCCCCACAGAGGCAGG + Intronic
1170807401 20:19644460-19644482 CTGTTTATCCCCAAAGACACGGG - Intronic
1172242672 20:33423618-33423640 GGCTCTGGCCCCAAAGAGCCAGG + Intronic
1175585727 20:60138307-60138329 CTGTCGAGCCCCTAAAAGTCTGG - Intergenic
1175874322 20:62222201-62222223 CTGACCAGCCCCGGAGAGCCTGG + Intergenic
1176649240 21:9530412-9530434 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1181094077 22:20494253-20494275 CTGTCTCACCCCAGATAGCCAGG - Intronic
1183270701 22:36860967-36860989 CAGGCTAGGCCCAGAGAGCCTGG + Exonic
1183655277 22:39180801-39180823 CTGGCTCTCCCCAAAAAGCCAGG + Intergenic
1184117149 22:42428872-42428894 CTGTCCAGCCCCAAAGTCCTTGG + Intronic
949657045 3:6232761-6232783 CTATCCAGCCCCAAAGAGGAGGG - Intergenic
952436631 3:33277806-33277828 CTGTTTGGCCCGAGAGAGCCTGG + Intronic
953490182 3:43343557-43343579 CTCTCTTGCCCCAAAGAGTTAGG - Intronic
955960003 3:64330824-64330846 TTGTCTAACCCCACAGAGCTAGG + Intronic
958478223 3:94612903-94612925 CTGTGTAGCCCTATAGAGACTGG + Intergenic
960159378 3:114333482-114333504 ATGTCTAGCCCCAGAAGGCCTGG + Intergenic
968057742 3:195705595-195705617 CAGTTTAGCCCTAAAGAGCCAGG + Intergenic
974551458 4:63380087-63380109 CTGCCAAGCCCCAAGGAGCGTGG - Intergenic
976584473 4:86779643-86779665 CTGACTAGCCCCAAAATGCAAGG - Intronic
998508661 5:142693166-142693188 TTGTCTTGTCCCATAGAGCCTGG - Intronic
999229556 5:150053672-150053694 CTGTCTAGCCCCAAAGAGCCTGG + Exonic
1001708241 5:173757657-173757679 CTGTCTGTCCCCAGAGAGTCTGG - Intergenic
1006829009 6:36957726-36957748 CAGTCTACCCCTACAGAGCCTGG - Intronic
1007860955 6:44907970-44907992 CTGTGGAGGACCAAAGAGCCAGG + Intronic
1009874946 6:69493978-69494000 CTGTCTGTCCCCAAAGAGGGAGG - Intergenic
1011656711 6:89558555-89558577 CTCTCTTGCCCCAAAGCTCCCGG - Intronic
1014402551 6:121008755-121008777 CTGGCTAGCCCCAATGACCAGGG + Intergenic
1015717160 6:136204804-136204826 CTGTCTGCCCCCAAAGCTCCTGG - Intergenic
1019200162 6:170307325-170307347 CTGTCTTTCCCCCAAGAGCTGGG - Intronic
1023660802 7:42469149-42469171 CTGATTAGCCCCCTAGAGCCAGG - Intergenic
1024588545 7:50861350-50861372 CCGTCAAGCCCCAGACAGCCAGG + Intergenic
1024789035 7:52941319-52941341 CTGTCTTGCTCCACAGAGACTGG - Intergenic
1025275778 7:57580467-57580489 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1025758155 7:64365034-64365056 CTCTTTAGCACCAAAAAGCCAGG + Intergenic
1026969196 7:74457720-74457742 CTGGCTTGTCCCAAAGAACCTGG - Intronic
1027423448 7:78039681-78039703 CTGTTTAGCACCAATGTGCCAGG - Intronic
1029612864 7:101636657-101636679 CTATCTTTCCCCTAAGAGCCAGG + Intergenic
1031999465 7:128255303-128255325 CTGGCTGACCCCAAAGAGCCTGG - Exonic
1031999540 7:128255797-128255819 CTGGCTGACCCCAAAGAGCCTGG + Exonic
1037490064 8:19389551-19389573 GTGTCTGGCCCTGAAGAGCCTGG - Intronic
1037855704 8:22369191-22369213 CTGTCTCTTCCCAAAGGGCCAGG + Intronic
1037967452 8:23145492-23145514 CTGTGTATCCCCAAGGACCCTGG - Intronic
1040339803 8:46434796-46434818 CTGTCTGGCTGCAAAGCGCCAGG - Intergenic
1041176039 8:55197513-55197535 CTGTCTAACACCAAAGCGCTGGG + Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1043009064 8:74859334-74859356 CTGTCCAGCCCCACAGCACCAGG + Intergenic
1047460934 8:125064699-125064721 CTGTTTACCTCCTAAGAGCCCGG - Intronic
1051084451 9:13331957-13331979 TTGTCTGTCCCCAAAGAGTCTGG + Intergenic
1051115441 9:13688645-13688667 ATGTCTAGAACCAAAGAGCAGGG + Intergenic
1051323552 9:15938203-15938225 CAGTCTAGACCCAAACAGCATGG - Intronic
1055129066 9:72753857-72753879 CTGTCTCGCCCCAAAGTTCGGGG - Intronic
1057305753 9:93911081-93911103 CTGTCCAGCCCTATGGAGCCAGG - Intergenic
1060218104 9:121750557-121750579 CTGTGTGGCCCCAAAGGGCAAGG - Intronic
1061674219 9:132206713-132206735 ATGTCTGTCCCCAAAGAGCTGGG - Intronic
1203626979 Un_KI270750v1:33960-33982 CAGTATAGCCCCAGATAGCCAGG - Intergenic
1185622850 X:1464191-1464213 CTTTCTCGCCCAAGAGAGCCTGG + Exonic
1187020612 X:15377671-15377693 CCATCTAGCCACAAAGGGCCAGG - Intronic
1194122348 X:89976500-89976522 CTTTCAAGCTCCAAAGAGGCTGG - Intergenic
1195762268 X:108259378-108259400 CTGTCTAGCCTCAATGGTCCAGG + Intronic
1198128467 X:133670943-133670965 CTGTCTATCCTCAGACAGCCAGG - Intronic
1198812102 X:140546482-140546504 CTCTCTAGCCCCAAAGATAAAGG + Intergenic
1200475208 Y:3633939-3633961 CTTTCAAGCTCCAAAGAGGCTGG - Intergenic
1202168170 Y:22014378-22014400 CTGTTTAACACCAAAGAGCATGG + Intergenic
1202223191 Y:22571990-22572012 CTGTTTAACACCAAAGAGCATGG - Intergenic
1202319924 Y:23623670-23623692 CTGTTTAACACCAAAGAGCATGG + Intergenic
1202550844 Y:26046386-26046408 CTGTTTAACACCAAAGAGCATGG - Intergenic