ID: 999229794

View in Genome Browser
Species Human (GRCh38)
Location 5:150054967-150054989
Sequence CAGCATCTTGCTCTGTAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8627
Summary {0: 2, 1: 8, 2: 162, 3: 1943, 4: 6512}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999229794_999229797 16 Left 999229794 5:150054967-150054989 CCGGGCTACAGAGCAAGATGCTG 0: 2
1: 8
2: 162
3: 1943
4: 6512
Right 999229797 5:150055006-150055028 AAAAAAAAAGGAAAAGTGGTCGG 0: 1
1: 4
2: 80
3: 1205
4: 10324
999229794_999229798 21 Left 999229794 5:150054967-150054989 CCGGGCTACAGAGCAAGATGCTG 0: 2
1: 8
2: 162
3: 1943
4: 6512
Right 999229798 5:150055011-150055033 AAAAGGAAAAGTGGTCGGTTAGG 0: 1
1: 0
2: 1
3: 15
4: 230
999229794_999229795 4 Left 999229794 5:150054967-150054989 CCGGGCTACAGAGCAAGATGCTG 0: 2
1: 8
2: 162
3: 1943
4: 6512
Right 999229795 5:150054994-150055016 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
999229794_999229796 12 Left 999229794 5:150054967-150054989 CCGGGCTACAGAGCAAGATGCTG 0: 2
1: 8
2: 162
3: 1943
4: 6512
Right 999229796 5:150055002-150055024 AAAAAAAAAAAAAGGAAAAGTGG 0: 31
1: 422
2: 7576
3: 43488
4: 69639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999229794 Original CRISPR CAGCATCTTGCTCTGTAGCC CGG (reversed) Intronic
Too many off-targets to display for this crispr