ID: 999231066

View in Genome Browser
Species Human (GRCh38)
Location 5:150062029-150062051
Sequence ACAACAAGGCAGAGTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999231066_999231073 30 Left 999231066 5:150062029-150062051 CCTGCTTGACTCTGCCTTGTTGT 0: 1
1: 0
2: 0
3: 9
4: 203
Right 999231073 5:150062082-150062104 TATTTGTGTATTGAAGACCTTGG 0: 1
1: 0
2: 0
3: 16
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999231066 Original CRISPR ACAACAAGGCAGAGTCAAGC AGG (reversed) Intronic
900576395 1:3384542-3384564 ACAACAAAGCAAAGCCAAGTTGG + Intronic
901147633 1:7077329-7077351 AAATCAAGGCAGAGTCCAGTGGG - Intronic
902943491 1:19816746-19816768 GCCACAAGGGAAAGTCAAGCTGG + Intergenic
905902318 1:41589646-41589668 AGCCCAAGGCAGATTCAAGCTGG - Intronic
909033524 1:70569962-70569984 AGAAGAAGGCAGAGTCCTGCAGG - Intergenic
909111433 1:71483151-71483173 GCAACAAGACAGAGTCCACCAGG + Intronic
910204147 1:84730940-84730962 ACAGCAAGGCAGTGTTAAGAGGG - Intergenic
910206536 1:84754028-84754050 AAAACAAAGTAGAATCAAGCAGG - Intergenic
911164295 1:94711455-94711477 AAAACAAGGTAAAGTCAGGCAGG + Intergenic
911648036 1:100356388-100356410 ACAAAAAGGCATAGAGAAGCTGG + Intronic
912369681 1:109164472-109164494 AAAACAGGGCAGAGACAAGGTGG - Intronic
913046074 1:115074436-115074458 TCCACAAGGGAGAGTCCAGCTGG - Intronic
915216134 1:154341938-154341960 GCAACAGGGGAGAGTCTAGCAGG - Intronic
915279186 1:154810648-154810670 ACCACAAGGCACAGCCAAGGTGG + Intronic
916502039 1:165395708-165395730 CAAAGAAGGCAAAGTCAAGCTGG + Intergenic
917689843 1:177457494-177457516 ACAAGAGGGCATAGGCAAGCAGG - Intergenic
917901745 1:179549624-179549646 AGAAGAAGGTAGAGTCATGCTGG - Intronic
918856506 1:189762583-189762605 AGAACAAGGCAGAGTCTCTCAGG - Intergenic
920975334 1:210780554-210780576 ATAACAAGGGAGAGTCCAGGAGG + Intronic
922964237 1:229674642-229674664 AGAAAAAGGCAGAATCAGGCCGG + Intergenic
924168040 1:241305801-241305823 AAACCAAGGCACAGCCAAGCGGG - Intronic
1066935060 10:41818655-41818677 ACAAAGAAGCAGAGTCAAGATGG - Intergenic
1067059207 10:43069302-43069324 ACAACAATGAAGAGTGATGCAGG + Intergenic
1068156517 10:53206087-53206109 TCTACTAGGCAGAGTCAAGGGGG + Intergenic
1069989195 10:72304110-72304132 ACAACAGGGCAGTGTGGAGCAGG - Intergenic
1071265075 10:83957746-83957768 GCAACCAGGCAGGGTGAAGCAGG + Intergenic
1071665036 10:87546401-87546423 ACAACCAGCCAGAATCAAGAGGG - Intronic
1076191461 10:128486279-128486301 GCAACAAGACAAAGTCAAGCAGG - Intergenic
1079748533 11:24164202-24164224 ACAACAAGGCAAAATTAAGCAGG - Intergenic
1081782109 11:45720350-45720372 AGAAGAAGGCAGAGACAAGATGG - Intergenic
1082092873 11:48104156-48104178 TCCAAAAGGCAGAGACAAGCAGG - Intronic
1088668708 11:112120294-112120316 ACACCAAGGCTCAGACAAGCAGG + Intronic
1089064970 11:115655782-115655804 ACCACGAGGCAGAATGAAGCAGG - Intergenic
1092536151 12:9389123-9389145 AGAAGAAAGCAGAGTCAAGTGGG - Intergenic
1097138030 12:56875687-56875709 ACTAAAGGGAAGAGTCAAGCTGG + Intergenic
1101552085 12:105772602-105772624 ACAAAAAGGCAAAGACATGCTGG + Intergenic
1101832153 12:108267049-108267071 ACAACATGGCAGGGCCAGGCTGG + Intergenic
1104506638 12:129338324-129338346 ACAACAAACCAGGGTCAAGGGGG + Intronic
1108395133 13:49984453-49984475 ACAACAAGGCAGAAGCAGTCTGG + Intergenic
1110396987 13:75041806-75041828 ACAAAAAAGCAGAGGAAAGCTGG + Intergenic
1112239416 13:97666420-97666442 ACAAAAAGGTAGAGGAAAGCTGG - Intergenic
1114074512 14:19149398-19149420 ACAACAAGGAAGAGGCAAGTGGG - Intergenic
1114087756 14:19250577-19250599 ACAACAAGGAAGAGGCAAGTGGG + Intergenic
1116544752 14:46150973-46150995 ACAAAAAGCCACAATCAAGCTGG - Intergenic
1119098370 14:71855600-71855622 ACAAAATGGCAGAGGCCAGCAGG - Intergenic
1121704378 14:95980510-95980532 GCCACAAGGAAAAGTCAAGCTGG + Intergenic
1122012131 14:98759023-98759045 ACTACAAGGCAGGGTGATGCAGG - Intergenic
1122167884 14:99843841-99843863 AAAAGAAGGCAGAGTCAGGTTGG - Intronic
1125804669 15:42483152-42483174 AAAACCAGGCAGATTCTAGCGGG - Intronic
1128518655 15:68360854-68360876 ACAACAAGGCCGAGTCAGATGGG - Intronic
1128793892 15:70451042-70451064 AGAACCAGACAGAGCCAAGCTGG - Intergenic
1130615278 15:85400741-85400763 TCAACAAAACAGAGACAAGCTGG - Intronic
1136041600 16:27583855-27583877 CAAAGAAGGCAGAGTCAAGAGGG - Intronic
1138269235 16:55682937-55682959 CCACCAAGGCAGAGTCAGGACGG + Intronic
1139224290 16:65218967-65218989 ACAACAAGGCAGAGACAGTGGGG - Intergenic
1139353508 16:66352996-66353018 AGAACAAGGCAAGGTGAAGCTGG - Intergenic
1141713341 16:85713016-85713038 ACAACAAAGCACCGTCAACCAGG + Intronic
1142604248 17:1072882-1072904 ACTACAAATCAGAGTCAGGCCGG + Intronic
1143949790 17:10623523-10623545 ACAACGAGGCGGATACAAGCTGG - Intergenic
1147151304 17:38516147-38516169 TCAAGAAGGCAGAATCAGGCTGG + Intergenic
1148179850 17:45596459-45596481 ACATCAGGGCCAAGTCAAGCAGG + Intergenic
1148269049 17:46249442-46249464 ACATCAGGGCCAAGTCAAGCAGG - Intergenic
1149603617 17:57909609-57909631 ACACCCAGGCAGAGAGAAGCTGG + Intronic
1150629472 17:66869020-66869042 ACAACAAGGCAGATTTAATAAGG - Intronic
1151589545 17:75034329-75034351 CAAACAGGGCAGAGGCAAGCAGG + Intronic
1153242293 18:3042026-3042048 ACAACAAAGCAAAGTGAAGGAGG + Intergenic
1156521945 18:37729410-37729432 ACAAAAAGGCAGAGGAAAGGTGG + Intergenic
1157486571 18:48091686-48091708 ACAGCGAGGCAGAGTCTAGCAGG + Intronic
1157494083 18:48142827-48142849 ACAGGAAGGAAGAGTCAAGAAGG - Intronic
1159216090 18:65392600-65392622 ACAACATGTCAGTTTCAAGCTGG - Intergenic
1161772944 19:6241277-6241299 ACTGCCAGGCAGAGTCCAGCTGG + Intronic
1163202079 19:15776757-15776779 ACAAAAAGGCAGAGGAAAGGGGG + Intergenic
1164095821 19:22009284-22009306 ACTGCAAGCCAGAGTCAGGCTGG + Intronic
1164115321 19:22214149-22214171 ACTGCAAGTCAGAGTCAGGCTGG + Intergenic
1164162330 19:22635324-22635346 ACTGCAAGCCAGAGTTAAGCTGG - Intronic
1164199047 19:23001850-23001872 ACTGCAAGCCAGAGTCAGGCCGG + Intronic
1166904807 19:46100764-46100786 GCTAAAAGGAAGAGTCAAGCTGG - Intergenic
1167411019 19:49343799-49343821 ACAACACTGAAGAATCAAGCCGG - Intronic
1167922366 19:52792305-52792327 GCAAAAAGGAAAAGTCAAGCTGG + Intronic
925079672 2:1054021-1054043 ACAACAAGGCCAAGACATGCAGG - Intronic
926844008 2:17113610-17113632 ACAAGAAGGCAGACACAAGGAGG - Intergenic
927033976 2:19152487-19152509 ACCAAAGGGAAGAGTCAAGCTGG - Intergenic
929366815 2:41168737-41168759 ACACCAAGACAGAGGTAAGCTGG + Intergenic
932448895 2:71797209-71797231 ACAAACAGTCAGAATCAAGCCGG - Intergenic
934676064 2:96250423-96250445 ACAGAAAGGCAGAGTGAAGTGGG - Exonic
937261004 2:120586844-120586866 GCAACAGGAAAGAGTCAAGCGGG + Intergenic
938070949 2:128308009-128308031 AAAACAAGGCTGAGTGAAGACGG + Intronic
938170048 2:129068010-129068032 AAAACAAGGCAGAATAAAGAAGG + Intergenic
938488847 2:131745893-131745915 ACAACAAGGAAGAGGCAAGTGGG - Intronic
940248865 2:151651080-151651102 AAAACAAGGCAAACTGAAGCTGG - Intronic
942162804 2:173209817-173209839 ACAACAAGGCGGAGTGGAGGTGG + Exonic
942286106 2:174418014-174418036 ACAACAATGCATAATCAAGATGG + Intronic
942501336 2:176593803-176593825 ACAGCATGGCAAAGCCAAGCAGG + Intergenic
943595436 2:189849770-189849792 AGAACAAGGCTGAGCCAAACTGG - Intronic
943878632 2:193108870-193108892 ACATCAAGGGAGAGTCCAGGTGG + Intergenic
946089278 2:217206556-217206578 ACAACCAGGCAGTGACAGGCTGG - Intergenic
946958687 2:224959916-224959938 AGAAAAAGGCAGAGTCAATATGG + Intronic
947281498 2:228460516-228460538 ACAAACAGGCACAGTCAGGCTGG + Intergenic
947827430 2:233115838-233115860 ACTACGAGGCTGAGCCAAGCAGG + Intronic
1173717614 20:45223255-45223277 ACAAAAAGGCAGATACAAACAGG + Exonic
1175024577 20:55888541-55888563 ATAACAAGGAAGAGTCTAGTTGG + Intergenic
1176039916 20:63059972-63059994 AGAACAAAGCAGAGCCAAGGGGG - Intergenic
1176083776 20:63286694-63286716 ACAGCAGGGCAGAGACAGGCAGG - Intronic
1176334877 21:5587103-5587125 ACAGCAAGCCAGAGTTAGGCTGG + Intergenic
1176392880 21:6233845-6233867 ACAGCAAGCCAGAGTTAGGCTGG - Intergenic
1176468539 21:7082329-7082351 ACAGCAAGCCAGAGTTAGGCTGG + Intronic
1176492100 21:7464107-7464129 ACAGCAAGCCAGAGTTAGGCTGG + Intergenic
1176508542 21:7674276-7674298 ACAGCAAGCCAGAGTTAGGCTGG - Intergenic
1180290156 22:10842338-10842360 ACAACAAGGAAGAGGCAAGTGGG - Intergenic
1180492954 22:15871760-15871782 ACAACAAGGAAGAGGCAAGTGGG - Intergenic
1181553362 22:23653538-23653560 ACACCAAGACAGAGCCAGGCTGG + Intergenic
1183743066 22:39678953-39678975 GCAACAAGGCAGAGTGGGGCAGG + Intronic
1184325034 22:43776483-43776505 ACAATGAGGCAGAGTGCAGCTGG + Intronic
1185184151 22:49382533-49382555 CCCACAAGGCAGGGTCAGGCTGG - Intergenic
1185185499 22:49396965-49396987 ACAACAATGCAATGTCAAGATGG - Intergenic
1185406174 22:50652726-50652748 ACTAAAGGGAAGAGTCAAGCTGG + Intergenic
949663042 3:6303864-6303886 GCACCAAGGCAGAATCTAGCAGG - Intergenic
950981539 3:17312540-17312562 CCAAAAAGGCAAATTCAAGCTGG - Intronic
951937981 3:28043309-28043331 ATTATAAGGCAGAGTCAAGTGGG + Intergenic
954942558 3:54388016-54388038 ACAACAATGCATATTCAAGTGGG + Intronic
955092116 3:55762730-55762752 GCAAAAAAGCAGAGTCAAACTGG + Intronic
955241726 3:57184102-57184124 ACAACAAGCCTTAGTTAAGCAGG - Intergenic
957058061 3:75459382-75459404 AGAACAAGGCAGAGTTTGGCTGG - Intergenic
958443622 3:94187513-94187535 ATAATAATGAAGAGTCAAGCAGG - Intergenic
964624773 3:158748503-158748525 ACAAACAGGCAGAGTCTAGTAGG - Intronic
969574343 4:8027872-8027894 AGAGCAAGTCAGAGTCAACCTGG + Intronic
969667376 4:8567904-8567926 GCTAAAAGGAAGAGTCAAGCTGG - Intronic
971588495 4:28436044-28436066 ACCAGAAGGGAAAGTCAAGCTGG + Intergenic
972812999 4:42611020-42611042 ACAACAAGGCGGAGTTCATCTGG - Intronic
975875971 4:78837489-78837511 AGAACACGAAAGAGTCAAGCTGG - Intronic
975919710 4:79370604-79370626 ACAACAAAGCAGAGTATAGAAGG + Intergenic
976748660 4:88431633-88431655 ACCACCAGGCTGAGCCAAGCTGG - Intronic
977555857 4:98486814-98486836 ACCACAAGGAAGAGCCAAACTGG + Exonic
978867058 4:113525690-113525712 ACAGCAGAGCAGAGTGAAGCAGG - Intronic
979140161 4:117162485-117162507 AGAACAAGGCAGAGTTTGGCCGG + Intergenic
980175812 4:129342685-129342707 ACACCAAGGTAGGGTCAAACCGG + Intergenic
980918841 4:139061950-139061972 AGAAAAAGGCATATTCAAGCTGG - Exonic
980975032 4:139602741-139602763 ACAAAGAGGCAGAGTTATGCAGG - Intronic
981104934 4:140869825-140869847 ACTGGAATGCAGAGTCAAGCTGG + Intronic
981813810 4:148806079-148806101 ATCAAAAAGCAGAGTCAAGCAGG - Intergenic
982602165 4:157465905-157465927 GCAGCAAGGCAGGGTCAAGATGG + Intergenic
983291697 4:165815366-165815388 ACAGAGAGACAGAGTCAAGCAGG + Intergenic
983472269 4:168172183-168172205 TGACAAAGGCAGAGTCAAGCTGG - Intronic
984948149 4:184986053-184986075 ATTAGAAGGCAGAGGCAAGCAGG - Intergenic
989183537 5:38601395-38601417 ACAACAAGGGACAGTCAGCCAGG + Intronic
991270022 5:64768585-64768607 AGAACAAGGCACAGTCAAAGCGG + Exonic
991473455 5:66994916-66994938 ACAACATGACAGAGGGAAGCAGG + Intronic
991497616 5:67242797-67242819 AGAACAAGGCAGACTGAAACAGG - Intergenic
992398248 5:76387181-76387203 AAAGCAAGGCAGAGACAGGCAGG + Intergenic
996517049 5:124382422-124382444 ATTCCAAGGCAGATTCAAGCAGG + Intergenic
997474096 5:134132841-134132863 ACAGCCAGGCAGGGCCAAGCAGG - Intronic
998555774 5:143122264-143122286 ACAGCAAGGCAGAAACAAGATGG - Intronic
999231066 5:150062029-150062051 ACAACAAGGCAGAGTCAAGCAGG - Intronic
1000805223 5:165782266-165782288 GCAACAATGGAGAGTCAAGGGGG - Intergenic
1001428940 5:171644594-171644616 ACACCAAGGCAGGTTCAAGATGG - Intergenic
1001941189 5:175740912-175740934 AGAACCACACAGAGTCAAGCTGG + Intergenic
1002205990 5:177562834-177562856 AGATCAAGGCAAAGTCCAGCAGG - Intergenic
1002914034 6:1514753-1514775 AGAAAAAGGCATATTCAAGCTGG - Intergenic
1003595417 6:7470168-7470190 AAAAAAAGGCAGAGTAAACCTGG - Intergenic
1003726298 6:8769068-8769090 TAAACAAGGCAGAGAAAAGCAGG - Intergenic
1006456756 6:34136413-34136435 ACAGCAGGGCAGATTCAGGCTGG + Intronic
1008794720 6:55289016-55289038 AGACCAAGGAAGAGTTAAGCTGG - Intergenic
1009948281 6:70365050-70365072 CCAACATGGCAGTGTTAAGCTGG + Intergenic
1010496613 6:76540140-76540162 GCAATAAGGAAGAGTCAAGAAGG + Intergenic
1010837574 6:80609128-80609150 ACTACAAGCCAGGGTAAAGCAGG - Intergenic
1014173405 6:118304833-118304855 ACAGCAAGGAAGAGGCAAACAGG + Intronic
1016672530 6:146725746-146725768 ACAACAAGAAAAACTCAAGCAGG - Intronic
1019746758 7:2705056-2705078 ATAACAAGGCACAATGAAGCAGG - Intronic
1019937454 7:4265715-4265737 CCAACTAGGAAGGGTCAAGCGGG + Exonic
1020122373 7:5512316-5512338 AAAAAAAAGCAGAGTCCAGCTGG + Intronic
1020871695 7:13638531-13638553 AGAACAAAGCAGAATCAAGAAGG - Intergenic
1021298639 7:18941841-18941863 TCAACAAGGCAGAGCCAAATTGG + Intronic
1026052324 7:66957910-66957932 ACAGAAACGCAGAGTCAATCAGG + Exonic
1027822127 7:83060290-83060312 GCACCAAGGCAGAGCCAAGCAGG - Intronic
1028264635 7:88707237-88707259 ACAGCAAGGCATAGTGATGCTGG + Intergenic
1028694516 7:93693270-93693292 ACAAAAGGGCAGAATCAGGCTGG - Intronic
1029915352 7:104203342-104203364 ACAATACAGTAGAGTCAAGCAGG + Intronic
1031970423 7:128061078-128061100 AGAACAGGGCAGAATCAGGCTGG + Intronic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034740340 7:153467550-153467572 GCCACAAAGCAGAGTCATGCAGG - Intergenic
1038917861 8:32046717-32046739 TCAACAAGGCAGAGTTATGGTGG + Intronic
1039389169 8:37163227-37163249 TCAACACGGAAGAGGCAAGCAGG - Intergenic
1039960755 8:42245533-42245555 ACAGCCAGGCAGAGTAACGCAGG + Intergenic
1040956948 8:52989254-52989276 ACAACAAGGCAGACTGGAGGAGG + Intergenic
1042030461 8:64470428-64470450 AGAAAAAGGCAGAGGCAAGGAGG + Intergenic
1044693375 8:94900137-94900159 ACAGCCTGGCAGAGACAAGCAGG - Intronic
1045645440 8:104292794-104292816 ACTAAAGGGAAGAGTCAAGCTGG + Intergenic
1046194938 8:110850185-110850207 ACAACATGACAGAGTAAAGTTGG - Intergenic
1047184671 8:122622000-122622022 ACAAAAAGGCAGAGGAAGGCTGG + Intergenic
1048342706 8:133553165-133553187 ACAGCAAAGCAGAGTGGAGCAGG - Intronic
1052241038 9:26273878-26273900 GCAGCATGGCAGAGTCAAGAAGG + Intergenic
1052363804 9:27589290-27589312 AGAACAGGGAAGAGTGAAGCTGG + Intergenic
1052744478 9:32426689-32426711 ACAAAAAGCCACAGACAAGCTGG - Intronic
1052933170 9:34072345-34072367 AAAACAAGGAAGAGAGAAGCTGG + Intergenic
1186695168 X:12022788-12022810 AAAACAAACCAGAGTCAAGAAGG + Intergenic
1187190450 X:17029943-17029965 AGAATAAGGCAGAGACAAGATGG - Intronic
1187270433 X:17775622-17775644 ACCCCAAGGCAGAGGAAAGCTGG + Intergenic
1187320077 X:18230103-18230125 ACCCCAAGGCAGAGGAAAGCTGG - Intergenic
1190152402 X:47959014-47959036 ACAACAGGGGAGGGTCAAGAAGG - Intronic
1190160246 X:48026979-48027001 ACAACAGGGGAGGGTCAAGAAGG + Intronic
1191141035 X:57117164-57117186 TGAACAAGGCAGAGAAAAGCAGG - Intergenic
1191194222 X:57704138-57704160 AAAACAGGGCAGAATTAAGCTGG - Intergenic
1191876112 X:65798361-65798383 TAAACAAGGCAGTGTGAAGCAGG - Intergenic
1192099141 X:68245615-68245637 ACACAAAGTCAGAGTCAGGCTGG - Intronic
1193821506 X:86171092-86171114 ACTAAAAGGAAAAGTCAAGCTGG - Intronic
1194323582 X:92481552-92481574 GCAAAGAGGCAGAGTCAGGCTGG + Intronic
1196385993 X:115151850-115151872 AAACTAAGGCAGAGTCTAGCAGG + Intronic
1196753598 X:119138900-119138922 ACAACGGGGCAGTGTCCAGCTGG - Intronic
1198205001 X:134457561-134457583 ACTGCAAGCCAGAGGCAAGCTGG + Intergenic
1198250225 X:134872621-134872643 ACAACAAGGCACAGATTAGCAGG - Intergenic
1200631683 Y:5594714-5594736 GCAAAGAGGCAGAGTCAGGCTGG + Intronic
1201783404 Y:17746582-17746604 ACAACCAGGCAGAGAGAATCTGG + Intergenic
1201818149 Y:18159405-18159427 ACAACCAGGCAGAGAGAATCTGG - Intergenic