ID: 999232209

View in Genome Browser
Species Human (GRCh38)
Location 5:150068370-150068392
Sequence CCTGACCTCAGGGGGCTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999232209_999232219 4 Left 999232209 5:150068370-150068392 CCTCCGAGCCCCCTGAGGTCAGG 0: 1
1: 0
2: 1
3: 28
4: 276
Right 999232219 5:150068397-150068419 CACACTGCCTGGAACACAGTGGG 0: 2
1: 6
2: 116
3: 716
4: 2696
999232209_999232216 -7 Left 999232209 5:150068370-150068392 CCTCCGAGCCCCCTGAGGTCAGG 0: 1
1: 0
2: 1
3: 28
4: 276
Right 999232216 5:150068386-150068408 GGTCAGGCCTGCACACTGCCTGG 0: 1
1: 0
2: 2
3: 19
4: 295
999232209_999232218 3 Left 999232209 5:150068370-150068392 CCTCCGAGCCCCCTGAGGTCAGG 0: 1
1: 0
2: 1
3: 28
4: 276
Right 999232218 5:150068396-150068418 GCACACTGCCTGGAACACAGTGG 0: 1
1: 3
2: 41
3: 191
4: 929

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999232209 Original CRISPR CCTGACCTCAGGGGGCTCGG AGG (reversed) Intronic