ID: 999232332

View in Genome Browser
Species Human (GRCh38)
Location 5:150069145-150069167
Sequence CCCTGGTAGCAGTTGCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999232327_999232332 2 Left 999232327 5:150069120-150069142 CCGCAGGCTCCTGCTTGCAGCTG 0: 1
1: 0
2: 9
3: 58
4: 524
Right 999232332 5:150069145-150069167 CCCTGGTAGCAGTTGCTCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 125
999232326_999232332 11 Left 999232326 5:150069111-150069133 CCAGCGCGGCCGCAGGCTCCTGC 0: 1
1: 0
2: 4
3: 28
4: 360
Right 999232332 5:150069145-150069167 CCCTGGTAGCAGTTGCTCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 125
999232323_999232332 24 Left 999232323 5:150069098-150069120 CCAGCAGTGAGGCCCAGCGCGGC 0: 1
1: 0
2: 0
3: 15
4: 167
Right 999232332 5:150069145-150069167 CCCTGGTAGCAGTTGCTCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 125
999232321_999232332 27 Left 999232321 5:150069095-150069117 CCTCCAGCAGTGAGGCCCAGCGC 0: 1
1: 0
2: 3
3: 24
4: 255
Right 999232332 5:150069145-150069167 CCCTGGTAGCAGTTGCTCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 125
999232325_999232332 12 Left 999232325 5:150069110-150069132 CCCAGCGCGGCCGCAGGCTCCTG 0: 1
1: 0
2: 0
3: 46
4: 1333
Right 999232332 5:150069145-150069167 CCCTGGTAGCAGTTGCTCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 125
999232330_999232332 -7 Left 999232330 5:150069129-150069151 CCTGCTTGCAGCTGGACCCTGGT 0: 1
1: 1
2: 5
3: 22
4: 170
Right 999232332 5:150069145-150069167 CCCTGGTAGCAGTTGCTCCAAGG 0: 1
1: 0
2: 0
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999232332 Original CRISPR CCCTGGTAGCAGTTGCTCCA AGG Intronic
900346412 1:2212534-2212556 CCCAGGCAGCAGTACCTCCAAGG + Intronic
900589006 1:3451248-3451270 CCCTGGTCGCTGTTGGTCCCTGG + Intergenic
900934337 1:5755808-5755830 CCCTGACAGCAGGAGCTCCAGGG + Intergenic
903598483 1:24515708-24515730 CGCTGGTGCCAGTTGCTTCAGGG + Intronic
906684637 1:47755609-47755631 CCCTGGTGGCAGCTGCTGGATGG + Intergenic
910262765 1:85307839-85307861 ACCTGGTAGCAGGTGTTTCAGGG - Intergenic
910851223 1:91651446-91651468 CCCTGGTAACAGTTACTGCCCGG - Intergenic
913248036 1:116887583-116887605 CCCTAGAAGCAGATGCCCCAGGG + Intergenic
915784665 1:158596942-158596964 TCCTGGTAGCACTTGCTTCCTGG - Intergenic
916358860 1:163944616-163944638 AACTGGTAGCAGTAGCTCCAGGG - Intergenic
920648089 1:207817959-207817981 CTCTGGTAGGAGTGGCTCCTGGG - Intergenic
922799471 1:228358429-228358451 ATCTGGAAGCAGTTGCTCCCAGG - Intronic
1064324810 10:14340138-14340160 CCCTGGTAGCTGCTGGTCCCAGG + Intronic
1069825268 10:71251067-71251089 CCATGGTAGTAGTTGTACCAAGG + Intronic
1070608848 10:77919398-77919420 CCCAGGTGGCATTTGGTCCAAGG - Intronic
1071873876 10:89822856-89822878 TCCTGGTGGCAGCTGCTCCCAGG - Intergenic
1074993248 10:118731134-118731156 TCCAGGTAACAGTTGCTTCACGG + Intronic
1076218517 10:128715047-128715069 CACTGGTGGCAGTTTCTACAGGG + Intergenic
1077253005 11:1568881-1568903 CCCTGGGAGCTGTAGGTCCAGGG - Intronic
1077265835 11:1649200-1649222 TCCAGGTGGCAGGTGCTCCACGG + Intergenic
1082797827 11:57390683-57390705 CCCTGGGGGAAGTTCCTCCAAGG - Intronic
1084493268 11:69489626-69489648 CACCGGTAGCGGGTGCTCCAAGG + Intergenic
1085814999 11:79727978-79728000 CCCTGCGAGCAGGTGCTGCAAGG + Intergenic
1085927354 11:81037997-81038019 CCAGGGTTGCAGTTCCTCCAGGG - Intergenic
1092694231 12:11151063-11151085 CCCTGCTTGAAGCTGCTCCAAGG + Intronic
1100768996 12:97900555-97900577 CACTGGTAGCAGTAACTCGAGGG - Intergenic
1104049772 12:125187203-125187225 CCCAGGTCCCAGTTCCTCCAGGG + Intronic
1104468448 12:129008679-129008701 GCCTGGTAGCATCTGCTCCTGGG - Intergenic
1114522724 14:23349008-23349030 CCCTGATAGCAGTAAGTCCAGGG - Intronic
1114759763 14:25300475-25300497 CTCTGGCTGCAGTTGCTCCATGG + Intergenic
1115549424 14:34491569-34491591 TGCAGGTAGCAGGTGCTCCAGGG - Intergenic
1121544093 14:94750970-94750992 CACTGACAGCAGCTGCTCCATGG - Intergenic
1122477394 14:102020217-102020239 CACTGGTCACAGTTGCCCCAGGG + Intronic
1122864596 14:104597830-104597852 CCCTGGTAGGACTTGCTTGATGG + Intronic
1124830537 15:33144998-33145020 CCCTGATTGCAGTTGCTGGAAGG - Intronic
1127985750 15:64069093-64069115 TTTTGGTAGCAGTTGCTTCATGG + Intronic
1130383570 15:83392539-83392561 CCCTGGCAGCTGCTGCGCCAGGG - Intergenic
1131310754 15:91287917-91287939 CCCAGGTAGCTCTTGCTCCACGG - Intronic
1132992756 16:2805534-2805556 CACTGGGAGCATTTCCTCCATGG - Intergenic
1134190180 16:12114977-12114999 CCCTGCTAGCAGTTGCTATTAGG + Intronic
1135304334 16:21355515-21355537 CCCTGGCAGCAGGTGCCACAGGG - Intergenic
1136301078 16:29334645-29334667 CCCTGGCAGCAGGTGCCACAGGG - Intergenic
1138285871 16:55809904-55809926 CCCTGGCAGCATCTGCTGCAAGG - Intronic
1138757833 16:59510197-59510219 CCCTGGTAACAATTGCTGCGTGG + Intergenic
1140945586 16:79765197-79765219 CCCTGCTACCATTTCCTCCAAGG - Intergenic
1141574536 16:84955557-84955579 CCCAGGTAGCTGGTGCTGCAGGG - Intergenic
1142062780 16:88041382-88041404 CCCTGGCAGCAGGTGCCACAGGG - Intronic
1142212756 16:88816267-88816289 CCCAGGCTGCAGTGGCTCCACGG - Intronic
1142265273 16:89061557-89061579 CCCTGGTCTCAGCTGCCCCAGGG + Intergenic
1142348178 16:89567449-89567471 CCCTGGCAGCAGCTGCGCCCGGG + Intergenic
1142665851 17:1463382-1463404 CCCTGGTAGCTCTGTCTCCAGGG + Intergenic
1144819837 17:18064602-18064624 CCCTGTTGGCAGGTGATCCAGGG - Intronic
1145798548 17:27669507-27669529 CCATGGTACCAGCTGCTCCCTGG + Intergenic
1146056482 17:29583893-29583915 GACTGGTAGCAGTGGCTGCAGGG - Intronic
1147452293 17:40513158-40513180 CCCTGGTACCTGTTACTCTAGGG - Intergenic
1149042067 17:52202185-52202207 CCCTGGCAGCAATGCCTCCAAGG - Intergenic
1152920335 17:83063379-83063401 CCCTGTTAGCACATGCCCCAGGG + Intergenic
1158234055 18:55293284-55293306 CCTTGTTATCAGTTGCTACATGG + Intronic
1159006283 18:63015790-63015812 CCCTGGGAGGTCTTGCTCCATGG - Intergenic
1160154248 18:76421367-76421389 CTGTGCTGGCAGTTGCTCCAGGG + Intronic
1161454066 19:4361509-4361531 CCCTGGCAGCAGGGGCTCCGTGG + Exonic
1161998530 19:7729490-7729512 CCCTGGTTCCAGTGGCTACAGGG + Exonic
1165606686 19:37111881-37111903 CCCTGGTTGGAGATGCCCCATGG + Intronic
928377370 2:30786709-30786731 CCCTGTTAGAATTTGCTCAAAGG - Intronic
928406174 2:31016664-31016686 CACTGGCACCAGTTGCTCCCTGG - Intronic
928978933 2:37118360-37118382 CTCTGGCTGCAGTTGCTCAAGGG - Intronic
933809889 2:86026719-86026741 GGCTGGGAGCAGTCGCTCCAGGG - Exonic
938109697 2:128555581-128555603 TCCAGGGAGCAGTTCCTCCAGGG + Intergenic
945790078 2:214293783-214293805 CTCTGGTAGCAGTGGCCCCAGGG + Intronic
946179175 2:217939768-217939790 CCCTGGAGGCGGTAGCTCCAAGG + Intronic
946670141 2:222094313-222094335 ACCTGGCAGCATTTGCTTCATGG + Intergenic
948329113 2:237151191-237151213 CCCTGGCAGCTGCTGCTGCATGG - Intergenic
948542613 2:238701337-238701359 CCCTGGGAGCAGTTTCTCTGTGG + Intergenic
948760128 2:240185140-240185162 CCCGGGGAGCAACTGCTCCATGG + Intergenic
1171373669 20:24677352-24677374 CCCTGTTAGCAGAGCCTCCAAGG + Intergenic
1172697158 20:36830844-36830866 GACTGGTAGCTGCTGCTCCAAGG + Intronic
1174079295 20:47959670-47959692 TCCTGGGAGCAGTTGCTCTGTGG + Intergenic
1179100096 21:38348813-38348835 CCCTGGCAGCAGCTGCTCACAGG + Intergenic
1179527952 21:41996069-41996091 CCCTAGCAGAAGTTTCTCCATGG - Intronic
1180248662 21:46564959-46564981 CCCTTGTGGCAGATGCTCAAGGG + Intronic
1180954307 22:19734752-19734774 TCCTGTTAGCAGTGGCTCCTTGG - Intergenic
1181541594 22:23575898-23575920 CCCTGGCATCTGTTTCTCCATGG + Intronic
1181796793 22:25317408-25317430 CCCTGGCATCTGTTTCTCCATGG - Intergenic
1184510383 22:44929939-44929961 GCCTGGTTGCAGGTGCTGCAGGG - Intronic
1185322718 22:50209309-50209331 CCCTGGCTGCAGCTGCTCCAGGG - Intronic
950115488 3:10448068-10448090 CCCTGGCAGCATTTCCTGCAGGG - Intronic
950938395 3:16866884-16866906 CACTGGCAGCTGTTGATCCAAGG + Intronic
952538993 3:34346259-34346281 TCCTGAGGGCAGTTGCTCCATGG - Intergenic
953368226 3:42365487-42365509 CTCAGGTAGGAGTTGGTCCAAGG - Intergenic
953798978 3:46006996-46007018 CCCTGGTTGCAGTTGCTTCCAGG + Intergenic
960131899 3:114065693-114065715 CCCTGGGAGCAGTGGCGACATGG - Intronic
965844563 3:172946569-172946591 CCTGGGTAGCAGTGGCCCCAGGG + Intronic
967037483 3:185658612-185658634 CCCTGGTTGCAGTAGCTCTCTGG + Intronic
968547189 4:1205365-1205387 CCCTGGGTGCAGCTGCTCCGAGG - Intronic
972299680 4:37773117-37773139 CACTGGGAGAAGTTCCTCCAGGG - Intergenic
984131315 4:175878697-175878719 CCCTGGGAGCATTTTCCCCATGG + Intronic
985702295 5:1380854-1380876 CCCGGGTAGAAGAGGCTCCAGGG + Intergenic
986496876 5:8351403-8351425 CCCAGGAGCCAGTTGCTCCATGG + Intergenic
986974718 5:13381721-13381743 CCCTGATAGCAGCTGCAGCAGGG + Intergenic
992136282 5:73749405-73749427 CCCTGGTAGCTGGGGCTACAAGG - Intronic
996332184 5:122342319-122342341 CCCTGGGAGCAGTGACTCCATGG - Intronic
999232332 5:150069145-150069167 CCCTGGTAGCAGTTGCTCCAAGG + Intronic
999430360 5:151520522-151520544 CCGTGGTAGCAGTTGCTATAGGG - Intronic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1003128842 6:3377973-3377995 TCCTGGGAGCAATTCCTCCAGGG + Intronic
1004610462 6:17234831-17234853 CCCTATTACCAGTTTCTCCAGGG + Intergenic
1005992950 6:30914615-30914637 CCCTGATATCCGTGGCTCCATGG + Intronic
1016702162 6:147066124-147066146 TCCAGGTGGCAGTTTCTCCATGG + Intergenic
1018075333 6:160207363-160207385 TCCAGGTAGAAGTTGCTACAGGG - Intronic
1023936644 7:44745253-44745275 CCCAGGTAGCTGTGGCTACAGGG + Intergenic
1024675341 7:51633098-51633120 CACTGTTAGCAGATGCTTCAAGG + Intergenic
1028861610 7:95658309-95658331 CCCTTTTAGAAGCTGCTCCATGG + Intergenic
1029633440 7:101767911-101767933 CCCTGGTTTCAGCTGCTGCAGGG - Intergenic
1032486361 7:132290383-132290405 CCCTGGTAGGGGTCACTCCAGGG + Intronic
1033514674 7:142094289-142094311 CTCTGGGAGCAGATGCTCTATGG + Intronic
1034166179 7:149026882-149026904 CCTGGGAAGCAGTTGCTCCTAGG - Intronic
1036289063 8:7471316-7471338 TCCTGGTAGCAGTTACACAATGG - Intronic
1036332412 8:7840211-7840233 TCCTGGTAGCAGTTACACAATGG + Intronic
1036533976 8:9627168-9627190 TCCTGGCAGCTGGTGCTCCAGGG + Intronic
1037643215 8:20767634-20767656 CCCTGGTAACTGTTGGTCAATGG - Intergenic
1038537079 8:28361005-28361027 CCCTTCTAGCAGTGGCTCCGAGG + Exonic
1038906699 8:31912414-31912436 CCCTGGAAGCAGCTGCTCTCAGG + Intronic
1043517060 8:81004733-81004755 GCCTGGCAGCAGAGGCTCCATGG + Intronic
1046214582 8:111126932-111126954 CCCTGGTAGCTGGGGCTACAGGG - Intergenic
1047187539 8:122647388-122647410 TCCTGGTAGCACTTGCTATAAGG - Intergenic
1047727237 8:127694484-127694506 CCCTGATAGCAAGTGCTCCATGG - Intergenic
1049663940 8:143834834-143834856 CCCAGGGAGCAGCTGCCCCAGGG + Exonic
1057581834 9:96294013-96294035 CCCTGCTAACTGCTGCTCCAAGG - Intronic
1060545170 9:124455038-124455060 CCCTGGGAGCAGCTGAGCCAAGG + Exonic
1060968275 9:127723680-127723702 CCCTGGCAGGAGTGACTCCAGGG + Intronic
1062090642 9:134677007-134677029 GACTGGCAGCAGGTGCTCCAAGG - Intronic
1189653120 X:43211308-43211330 CCCTGCAAGCAGGTGCTGCAAGG - Intergenic
1193179917 X:78442405-78442427 TCCTGCTAGCAGTTCCTTCAGGG + Intergenic
1199259656 X:145756793-145756815 CCCTGGGAACAGTTACACCATGG - Intergenic
1201065384 Y:10090843-10090865 CCCTTTTTGCAGATGCTCCAGGG + Intergenic