ID: 999232699

View in Genome Browser
Species Human (GRCh38)
Location 5:150070901-150070923
Sequence CACTTCAGGGATTTGTAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999232699_999232704 -5 Left 999232699 5:150070901-150070923 CCCTGCTACAAATCCCTGAAGTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 999232704 5:150070919-150070941 AAGTGCCAACCTTGCCAAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 215
999232699_999232710 26 Left 999232699 5:150070901-150070923 CCCTGCTACAAATCCCTGAAGTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 999232710 5:150070950-150070972 AGAGACAAGAGGCAGGATGTAGG 0: 1
1: 0
2: 2
3: 55
4: 565
999232699_999232711 27 Left 999232699 5:150070901-150070923 CCCTGCTACAAATCCCTGAAGTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 999232711 5:150070951-150070973 GAGACAAGAGGCAGGATGTAGGG 0: 1
1: 0
2: 3
3: 50
4: 387
999232699_999232709 19 Left 999232699 5:150070901-150070923 CCCTGCTACAAATCCCTGAAGTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 999232709 5:150070943-150070965 CTGAGAAAGAGACAAGAGGCAGG No data
999232699_999232708 15 Left 999232699 5:150070901-150070923 CCCTGCTACAAATCCCTGAAGTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 999232708 5:150070939-150070961 GGGACTGAGAAAGAGACAAGAGG 0: 1
1: 0
2: 4
3: 55
4: 711
999232699_999232703 -6 Left 999232699 5:150070901-150070923 CCCTGCTACAAATCCCTGAAGTG 0: 1
1: 0
2: 1
3: 10
4: 138
Right 999232703 5:150070918-150070940 GAAGTGCCAACCTTGCCAAGAGG 0: 1
1: 0
2: 1
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999232699 Original CRISPR CACTTCAGGGATTTGTAGCA GGG (reversed) Intronic
901140026 1:7022661-7022683 TGCTTCAGGGATTTGAAGGAGGG + Intronic
901409552 1:9072571-9072593 CACTTGAGGGATATTTAGGATGG + Intronic
905448657 1:38043742-38043764 AACTTCAGGGAGGTGAAGCAGGG + Intergenic
908092280 1:60698830-60698852 CAGTTCAGGGGTTTGTGGAAAGG - Intergenic
909156906 1:72089877-72089899 CACTTCAGGGATTTGTGGTACGG + Intronic
910479539 1:87643269-87643291 AACTTCAGTGTTTTGTAGCTTGG - Intergenic
911291180 1:96058189-96058211 GACTTCAGGTATTTTTATCATGG - Intergenic
911332203 1:96538224-96538246 CCCATGAGGGATATGTAGCAGGG - Intergenic
912210855 1:107555448-107555470 TACTTCTGGGATTTGTGGGAAGG - Intergenic
912527197 1:110292153-110292175 CACTTGGGGGATTTGGAGAAAGG - Intergenic
914445160 1:147744186-147744208 AACTTCATGGATTTGTGACAAGG - Intergenic
916756692 1:167777603-167777625 CACTTCAGAGATTTGGAGCGGGG + Intronic
917309965 1:173668812-173668834 AACTTCAGTTATATGTAGCAAGG - Intronic
919960119 1:202458560-202458582 CAATTGAGGGATTTCCAGCAGGG + Intronic
922793334 1:228322981-228323003 CAGGTGAGGGATTTGAAGCAAGG - Intronic
1063521031 10:6741055-6741077 CACTTTAGGGATTGGTTGAAAGG + Intergenic
1068084064 10:52352639-52352661 GAGTTCAGGGATTGGTAGAAAGG + Intergenic
1068210845 10:53918239-53918261 TATTTCATGGATTTGTTGCAAGG - Intronic
1068282411 10:54891761-54891783 CAAAACAGGTATTTGTAGCAAGG + Intronic
1074342227 10:112643489-112643511 CACTTCAGGGCTTTGTACAATGG - Intronic
1074780188 10:116796917-116796939 CACTTCAAAGATGTATAGCAGGG + Intergenic
1075903852 10:126064100-126064122 CACTTCAGGGGCTTGTTGGAGGG + Intronic
1076248456 10:128966104-128966126 CACTTAAGGGTTTTGCATCAAGG + Intergenic
1076451351 10:130559162-130559184 CAATTGTGGGATTTGTAGCTGGG + Intergenic
1080988509 11:37501662-37501684 CACTTCATGTAGTTGTAGCGAGG - Intergenic
1081367177 11:42249548-42249570 CATGTTAGGGCTTTGTAGCATGG + Intergenic
1085048918 11:73369555-73369577 CACTTCAGAGGGTTGGAGCAGGG - Intergenic
1087098632 11:94344380-94344402 CAATTCAGGTAATTCTAGCATGG - Intergenic
1088014290 11:105039531-105039553 CACTGGGAGGATTTGTAGCATGG + Intergenic
1088014954 11:105047157-105047179 CGCTGGAAGGATTTGTAGCATGG + Intronic
1089557852 11:119324774-119324796 CACTGCATGGATTTGGTGCAAGG - Intergenic
1090839874 11:130478364-130478386 CTCTTCTGGGATTTGTTGCTGGG - Intergenic
1092970626 12:13691269-13691291 CACTTCAGGCATTATTTGCATGG - Intronic
1093851406 12:24043946-24043968 CACTTCAGAGATTTGGGGTAAGG + Intergenic
1095381460 12:41598787-41598809 CATTTCATTGATTTATAGCATGG - Intergenic
1098382669 12:69885183-69885205 CACTTCCTGTATTTGTAGCTGGG + Intronic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1102616170 12:114156219-114156241 CACTTCAGGGATGTGTAAAGAGG + Intergenic
1107058745 13:36132538-36132560 CACTTGTGGAATATGTAGCATGG - Intergenic
1107604357 13:42042981-42043003 CCTTTCAGGCATTTGGAGCAAGG + Intronic
1107672561 13:42761154-42761176 CAGTTCAGGAATTTTTGGCAAGG + Intergenic
1111661335 13:91216199-91216221 CACTTCTGGGATTTGAAACGAGG - Intergenic
1116233110 14:42243147-42243169 TAGTTCAGAGATTTGTAGCCAGG + Intergenic
1118466851 14:66038884-66038906 CAATGCAGTGATTTGCAGCATGG + Intergenic
1120470070 14:84911876-84911898 AACTTCAGGGACTTGTACCTTGG - Intergenic
1123837440 15:24210528-24210550 CAATTAAGGGATTTGTTTCAAGG + Intergenic
1123846656 15:24310284-24310306 CAATTAAGGGATTTGTTTCAAGG + Intergenic
1123865662 15:24517333-24517355 CAATTAAGGGATTTGTTTCAAGG + Intergenic
1124790343 15:32720038-32720060 TATTTCAGGGATTTTTAGCAGGG + Intronic
1125473299 15:40025364-40025386 ATCTGCAGGGATGTGTAGCATGG + Intronic
1126323355 15:47448373-47448395 GGCTTCAGTGATTTGTGGCACGG + Intronic
1126924755 15:53571715-53571737 CACTGCTGGGATTAGTACCAAGG - Intronic
1129036027 15:72648761-72648783 CACTTCAGGGATAGGAAGGAGGG + Intergenic
1129213858 15:74088455-74088477 CACTTCAGGGATAGGAAGGAGGG - Intergenic
1129400154 15:75276908-75276930 CACTTCAGGGATAGGAAGGAGGG + Intronic
1130307210 15:82721328-82721350 CACTTCATGGACGTGTAGTAAGG + Intergenic
1131475570 15:92735816-92735838 CACTGCAGGTATTAGGAGCATGG - Intronic
1136093137 16:27935031-27935053 CATTTCGGGGATTTGCAGGAGGG + Intronic
1137930936 16:52586949-52586971 CATTTCAGGTTTTTATAGCAAGG - Intergenic
1138782159 16:59801895-59801917 CACTTCAGGGGCTTGCAGTATGG + Intergenic
1139874871 16:70137697-70137719 CTCTTGAGTGATTTGTAGAATGG + Intronic
1140360915 16:74343445-74343467 CTCTTGAGTGATTTGTAGAATGG - Intergenic
1140424079 16:74845871-74845893 ACCTTCAGGGGTTTGCAGCAGGG - Intergenic
1140431466 16:74907654-74907676 GCCTTCAGGGGTTTGCAGCAGGG + Intronic
1140891508 16:79289173-79289195 CACTGTAGGGATTTCAAGCAGGG + Intergenic
1143309915 17:5979560-5979582 CACATCAGGGATGGGAAGCACGG - Intronic
1147771631 17:42872224-42872246 CAGTCCAGGGATTTGGAGGAGGG - Intergenic
1152226452 17:79095056-79095078 CACTTCAGGGAGATGGAGCCGGG + Intronic
1159269129 18:66126304-66126326 CTCCTCAGGGATTTGTGGAATGG - Intergenic
1161059919 19:2209781-2209803 CACTGCCTGGATTTGTAGCCAGG + Intronic
1163124166 19:15235614-15235636 CACTTTAGACATTTGTAGAAGGG - Exonic
1165810274 19:38607793-38607815 CACATCAGGGGATTGTAGGAAGG + Intronic
1168588665 19:57614909-57614931 CACTTCTGGAGTTTGTTGCAGGG - Intronic
925721834 2:6837088-6837110 GACTTAATGGATCTGTAGCAGGG + Intergenic
926944306 2:18170402-18170424 CACTTCAGGAATTTTTTGCTTGG + Intronic
927413012 2:22847960-22847982 CCATTGAGGGTTTTGTAGCAAGG - Intergenic
928223937 2:29431439-29431461 CACTTCAGGGATTTTTATTTGGG - Intronic
929117330 2:38455618-38455640 CCCTTCAGGAATTTATAACAGGG - Intergenic
929242608 2:39666966-39666988 CACTTCAGGGGTATGAAGGAAGG - Intronic
930594839 2:53374659-53374681 AAAGTCAGAGATTTGTAGCAGGG - Intergenic
931002340 2:57801093-57801115 TATTTCAGTCATTTGTAGCAAGG - Intergenic
932626070 2:73296876-73296898 CACTCCAGGGAATTCTTGCAGGG - Intergenic
936307747 2:111357312-111357334 CAGTTCTGGGATGTGTAGCTGGG - Intergenic
940221518 2:151356919-151356941 CACTTCAAGAATTTGTGGCCTGG + Intergenic
942276278 2:174326309-174326331 AACGTCAGGGATTCGCAGCAGGG - Intergenic
947225286 2:227834028-227834050 CAATTCAGGGAATTGTAATATGG - Intergenic
1174937671 20:54889449-54889471 CAATTTAGGGAATTCTAGCAAGG + Intergenic
1181881904 22:25987964-25987986 CTCTTTAGAGATTTGAAGCATGG - Intronic
1182162504 22:28137172-28137194 CACATCAGGGAATTGTGCCATGG - Intronic
1184938072 22:47739750-47739772 CCCTGCAGGGCTTTGTAACAAGG - Intergenic
952133701 3:30393614-30393636 CACTTAAGGATTTTTTAGCAGGG + Intergenic
952945421 3:38475544-38475566 CACTTCAGGGAGTTGCAGAAAGG + Intronic
953562460 3:44002804-44002826 CACTGCAGAGCCTTGTAGCATGG + Intergenic
954636890 3:52075822-52075844 CAGGCCAGGGATTTGTACCATGG - Exonic
956563028 3:70603343-70603365 AACTTCTGGGTTTTGCAGCAGGG - Intergenic
959913279 3:111789105-111789127 CACTGCAGGTATTTTTATCAAGG + Intronic
962361918 3:134749970-134749992 TACTGCAGGGGCTTGTAGCAAGG - Intronic
963163358 3:142175304-142175326 CACTTCAGGGAATGGCAGAAAGG - Intronic
964326373 3:155551099-155551121 CACATCAGGGAGTTTTAACAAGG + Intronic
974712683 4:65621153-65621175 CACTGCAGGGATACTTAGCAAGG + Intronic
979560218 4:122093813-122093835 CACCTCAGAGATTTGCAGCAGGG - Intergenic
980820584 4:138010925-138010947 TTCTTCAGGGAATTGTAACAGGG - Intergenic
981558812 4:146024675-146024697 TTCTTCAGTGATTTGTACCATGG + Intergenic
987592048 5:19942516-19942538 CCCTCCAGGGATTTGTAGAATGG - Intronic
990325376 5:54670491-54670513 CACTGCAGGGAGCTGTAGCAGGG - Intergenic
993429296 5:87812111-87812133 CACTTTAGGGATTTTTAAAAAGG - Intergenic
993631597 5:90292898-90292920 CAATTCAGGAATTTGTAGAAGGG - Intergenic
994363119 5:98878372-98878394 CCCTTCGGGGAATGGTAGCAGGG + Intronic
995227465 5:109717669-109717691 GACTTCAGGGATTTGGAGCTAGG + Intronic
999232699 5:150070901-150070923 CACTTCAGGGATTTGTAGCAGGG - Intronic
1002617378 5:180464236-180464258 CAATGCTGGGATTTGTAGCTGGG - Intergenic
1003400410 6:5785968-5785990 CTGTTAAGGGATTTGTAGCCTGG + Intergenic
1007191906 6:40026567-40026589 CATTTTAGGTATTTGTTGCAGGG - Intergenic
1008678410 6:53845573-53845595 CGCCTCAGTGGTTTGTAGCAGGG + Intronic
1009034858 6:58104980-58105002 CATTTCAGGGACTTCTAGCTAGG - Intergenic
1009210374 6:60855703-60855725 CATTTCAGGGACTTCTAGCCAGG - Intergenic
1012746359 6:103094444-103094466 CACTTCAGGTATTAGGAACATGG - Intergenic
1013164004 6:107573489-107573511 CATTTCAGAAATTTGTTGCAAGG - Intronic
1018213285 6:161502955-161502977 TACTTCATGCATTTGTGGCAAGG + Intronic
1021295978 7:18906541-18906563 TATTTCATGCATTTGTAGCAGGG - Intronic
1032414257 7:131724273-131724295 TGCTTCAGGAATTTGGAGCAGGG - Intergenic
1033896982 7:146084243-146084265 CACTTCATAGAGTTATAGCATGG + Intergenic
1034427824 7:151023881-151023903 CCCTTCAGGGACATGAAGCAGGG + Exonic
1038446504 8:27608131-27608153 CACTTCAGGGATTGCTGGCCTGG - Intronic
1038562146 8:28589821-28589843 CCCGTCGGGGATTTGAAGCAGGG - Intergenic
1038683977 8:29698447-29698469 GCCTTCAGGGATTTTTATCAAGG + Intergenic
1041031241 8:53737448-53737470 CATTTCTGGGATATTTAGCAAGG + Intronic
1041047532 8:53901488-53901510 CACTTCAGGGCTTAGAAGTAAGG + Intronic
1045207743 8:100060170-100060192 AACTTGAGGGACTTGAAGCAAGG - Intronic
1046348256 8:112966525-112966547 CCTTTCAGGGATTTGAAACATGG + Intronic
1047027213 8:120836938-120836960 CACTTCAGGGTTTTGTGGGTAGG + Intergenic
1048024009 8:130567489-130567511 CACTTCAGGCACTTATAGAAAGG + Intergenic
1050348433 9:4716475-4716497 CAAATAAGGGATTTGTGGCATGG + Intronic
1050522331 9:6514088-6514110 CACTTCATGGATACGTAGGATGG - Intergenic
1051156790 9:14156936-14156958 CAGTTCAGAGATGTGAAGCATGG + Intronic
1052272769 9:26643768-26643790 AACTTCATGGAGTTGTTGCAAGG + Intergenic
1053612792 9:39732202-39732224 CACTTCTGGAACTTGTTGCAGGG - Intergenic
1053870834 9:42490164-42490186 CACTTCTGGAACTTGTTGCAGGG - Intergenic
1054085462 9:60738953-60738975 CACTTCTGGAACTTGTTGCAGGG + Intergenic
1054240723 9:62610188-62610210 CACTTCTGGAACTTGTTGCAGGG + Intergenic
1054554857 9:66644712-66644734 CACTTCTGGAACTTGTTGCAGGG + Intergenic
1056706247 9:88954749-88954771 CACTTCAGGGATGTTTGGGAAGG + Intergenic
1060161146 9:121366019-121366041 CACTTAAGAGATTTGTATGAAGG - Intronic
1187245127 X:17547055-17547077 CCCTTCAGGCATTTGCTGCAGGG + Intronic
1190053451 X:47168977-47168999 CACTTCAGAGATGTGGAGCAGGG + Intronic
1195533211 X:105981804-105981826 AACTTCAGGGACTAGTATCAGGG + Intergenic
1196028799 X:111073018-111073040 CCCCTCAGGGATGTGTAGCTGGG + Intronic
1202073374 Y:21015398-21015420 CTCATCTGGGATTTGTAGAATGG - Intergenic
1202078074 Y:21057252-21057274 CTCATCTGGGATTTGTAGAATGG - Intergenic
1202575598 Y:26321381-26321403 CAATTGAGGGATTTCCAGCAGGG - Intergenic