ID: 999233728

View in Genome Browser
Species Human (GRCh38)
Location 5:150078238-150078260
Sequence CCCTGGGATGACTGAGACCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 176}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999233715_999233728 16 Left 999233715 5:150078199-150078221 CCGCACCAGCTCTGCAGGCACCA 0: 1
1: 0
2: 2
3: 41
4: 376
Right 999233728 5:150078238-150078260 CCCTGGGATGACTGAGACCGGGG 0: 1
1: 0
2: 2
3: 17
4: 176
999233710_999233728 29 Left 999233710 5:150078186-150078208 CCTCCCCTCGAATCCGCACCAGC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 999233728 5:150078238-150078260 CCCTGGGATGACTGAGACCGGGG 0: 1
1: 0
2: 2
3: 17
4: 176
999233716_999233728 11 Left 999233716 5:150078204-150078226 CCAGCTCTGCAGGCACCAGTGTC 0: 1
1: 0
2: 0
3: 30
4: 309
Right 999233728 5:150078238-150078260 CCCTGGGATGACTGAGACCGGGG 0: 1
1: 0
2: 2
3: 17
4: 176
999233712_999233728 25 Left 999233712 5:150078190-150078212 CCCTCGAATCCGCACCAGCTCTG 0: 1
1: 0
2: 0
3: 5
4: 58
Right 999233728 5:150078238-150078260 CCCTGGGATGACTGAGACCGGGG 0: 1
1: 0
2: 2
3: 17
4: 176
999233713_999233728 24 Left 999233713 5:150078191-150078213 CCTCGAATCCGCACCAGCTCTGC 0: 1
1: 0
2: 1
3: 13
4: 108
Right 999233728 5:150078238-150078260 CCCTGGGATGACTGAGACCGGGG 0: 1
1: 0
2: 2
3: 17
4: 176
999233722_999233728 -4 Left 999233722 5:150078219-150078241 CCAGTGTCAAGGCTGGGGGCCCT 0: 1
1: 0
2: 0
3: 10
4: 196
Right 999233728 5:150078238-150078260 CCCTGGGATGACTGAGACCGGGG 0: 1
1: 0
2: 2
3: 17
4: 176
999233711_999233728 26 Left 999233711 5:150078189-150078211 CCCCTCGAATCCGCACCAGCTCT 0: 1
1: 0
2: 0
3: 5
4: 56
Right 999233728 5:150078238-150078260 CCCTGGGATGACTGAGACCGGGG 0: 1
1: 0
2: 2
3: 17
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999233728 Original CRISPR CCCTGGGATGACTGAGACCG GGG Exonic
901066136 1:6495498-6495520 CCCTGGTATGACACAGACCTGGG + Intronic
901478289 1:9505860-9505882 CCCTGGGAAGACAGAGGCAGAGG - Intergenic
902614409 1:17616034-17616056 GCCTGGGATGCCTGCTACCGAGG - Intronic
904956397 1:34287621-34287643 GCCTGGGATGACTGTGGCCCTGG + Intergenic
905272377 1:36795425-36795447 CCCAGGGATGACTGTGTCCCAGG - Intergenic
907250385 1:53134224-53134246 CCCTGGGATGAGTGTGACCGTGG - Intronic
909481580 1:76132735-76132757 CCCTGGGATGACAATGAGCGAGG - Intronic
912796045 1:112694247-112694269 CCCTGAGATAAATGAGACCCCGG + Intronic
914344198 1:146784396-146784418 CCCTGAGATGACTCAGATGGAGG - Intergenic
916690603 1:167186520-167186542 GGCTGGGATGTCTGAGACCAGGG + Intergenic
917095132 1:171392329-171392351 CCCTGGGATAACTGGGACAAAGG + Intergenic
917857790 1:179115659-179115681 CCCTTGGATGCCTGAAACCAAGG - Intronic
919097384 1:193054438-193054460 CCATGGAATGACTGAGACTGGGG - Intronic
919101504 1:193102757-193102779 ACCTTGGATAACTGAAACCGTGG - Intronic
920436147 1:205948275-205948297 CCCTGGGAATGCTGAGACTGGGG + Intergenic
920685451 1:208105706-208105728 CTCTGGGATAACAGAGACCCTGG + Intronic
921527028 1:216230030-216230052 CCCTGGGAAGACTGACAAAGGGG + Intronic
1063110285 10:3029683-3029705 CACTGGGATGAGTGAGACCCCGG - Intergenic
1063138724 10:3238546-3238568 CCCTGGAAGGACAGACACCGAGG - Intergenic
1065380398 10:25084257-25084279 CTCTGGGATGCCCGAGACCCAGG + Intergenic
1067508208 10:46874236-46874258 CCCTGGGATGTCTGAGCCAGAGG - Intergenic
1067654043 10:48177609-48177631 CCCTGGGATGTCTGAGCAAGAGG + Intronic
1068636147 10:59350450-59350472 CCCTGGGATCAGTCAGACCTGGG + Intronic
1070454684 10:76600751-76600773 ACCTGAGATGACTAAGACAGTGG + Intergenic
1072709061 10:97703798-97703820 GCCTGGGATGATTGAGGCAGAGG + Intergenic
1074973300 10:118560800-118560822 CCCTGGGATGACTAAGGCAGAGG - Intergenic
1076768398 10:132650152-132650174 CCCTGGGATGCCTCAGACCCCGG + Intronic
1076920875 10:133454167-133454189 CTCTGGGCTGAGTGAGACCCAGG - Intergenic
1076994418 11:291165-291187 CCCAGGGAGGGCAGAGACCGTGG - Intronic
1077860671 11:6175979-6176001 CCCTGGGATCATTGAGCCTGGGG + Intergenic
1078100528 11:8327917-8327939 CCCTGAGATGACTCAGAATGTGG + Intergenic
1080063231 11:27980213-27980235 CCATGTGATGACAGAGACAGAGG - Intergenic
1080842548 11:35998133-35998155 CCCTGGGATTACTGAGGCTGAGG + Intronic
1081757053 11:45552253-45552275 CCCTGGGATGCCTCAGGCGGAGG - Intergenic
1083292001 11:61695690-61695712 CCCTGGGATGAAAGAGAGAGAGG - Intronic
1083704980 11:64508038-64508060 CCCTGGGGTGACTTAGGCCGGGG - Intergenic
1084171059 11:67401347-67401369 CCCTGGGAGGCTTGAGGCCGCGG - Intronic
1084181447 11:67448554-67448576 CCCAGGGCTGAGTGAGACCGGGG + Intergenic
1088355370 11:108938023-108938045 CCCTGAGATGACTGACAATGAGG - Intronic
1089340032 11:117750971-117750993 GCCTGGGAAGACTGTGACCTGGG - Intronic
1089388081 11:118080818-118080840 ACCTGGGAAGTCTGAGGCCGTGG - Intronic
1090422617 11:126585896-126585918 CCCTGTGCTGCCTGAGACAGAGG + Intronic
1090490258 11:127154521-127154543 ACCTGGTATTACTGAGACAGAGG + Intergenic
1091277512 11:134362503-134362525 CCCTGGGATGACTGGGCCGTGGG + Intronic
1091607051 12:1962202-1962224 CCCTGGGATGATTAAGGCAGAGG + Intronic
1091769853 12:3144438-3144460 CCATGTGATGACAGAGACGGAGG + Intronic
1093059580 12:14589079-14589101 CCCTGTTCTGACTGAGCCCGGGG + Intergenic
1095271500 12:40224770-40224792 GGCTGGGATGACCGTGACCGTGG - Intronic
1098096023 12:66956927-66956949 CCCTGTGTTGACTGAGTCAGAGG - Intergenic
1098256946 12:68626501-68626523 CAAAGGGATGACTGAGACTGGGG - Intronic
1099056194 12:77844151-77844173 GCCTGGGATGTCTAAGATCGAGG + Intronic
1099631085 12:85146302-85146324 CCATGGGATGACTGAGGATGGGG + Intronic
1100338975 12:93660029-93660051 CCCTGGGAGGACTGAGAGAGAGG - Intergenic
1101200119 12:102427005-102427027 CCCTGGAATGACTGAAAACCAGG + Intronic
1104015705 12:124960271-124960293 CACTGGGGTGGCTGAGAGCGGGG + Intronic
1104698550 12:130883271-130883293 CCCTGTGATGACGGAGGCAGAGG - Intergenic
1104755785 12:131268665-131268687 GCCTGGGATGGCTGAGAGCATGG - Intergenic
1107860041 13:44651795-44651817 CCCTGGGATGTGTGGGACCTGGG + Intergenic
1108866162 13:54925237-54925259 CCCTGGGATGATTAAGGCAGAGG - Intergenic
1108957306 13:56175815-56175837 CCCTGGGATGATTAAGGCAGAGG + Intergenic
1111213220 13:85108424-85108446 CCCAGGGCTGACTGAGGCCCAGG - Intergenic
1111922534 13:94427377-94427399 CCCTGGGATAACTGGTACCCTGG + Intergenic
1114165000 14:20212051-20212073 CCCTGGGGAGAGGGAGACCGTGG - Intergenic
1115790195 14:36869508-36869530 CCCTGGGATGCCTCAGGCCTCGG + Intronic
1117844777 14:59899764-59899786 CCCGGAGAAGACTGAGAGCGCGG + Intergenic
1118176238 14:63442768-63442790 CCCAGGGATGCCTGAAACTGTGG - Intronic
1119183480 14:72619950-72619972 TTCTGCGATGACTGTGACCGAGG - Intronic
1119776621 14:77253145-77253167 GCCTGGCAAGACTGAGACCCAGG - Intronic
1120393598 14:83939646-83939668 CCATGGGATTACTGAGATCTGGG + Intergenic
1121330029 14:93044049-93044071 CCCTGGGAAGACAGAGCCAGAGG + Intronic
1122577367 14:102750812-102750834 CCCTGGGGGGACTGAGCCCTGGG - Intergenic
1122900479 14:104780311-104780333 GCCTGGGATGCCTGAGTCCCAGG + Intronic
1127220410 15:56874406-56874428 CCAGTGGATGCCTGAGACCGTGG + Intronic
1128079388 15:64847181-64847203 CCCTGCCATGACAGAGACCAGGG + Intronic
1128313123 15:66644135-66644157 CTCTGGGATGACAGAAACCAGGG + Intronic
1132829455 16:1920216-1920238 CGTGGGGATGGCTGAGACCGTGG - Intergenic
1132829475 16:1920288-1920310 CGTGGGGATGGCTGAGACCGTGG - Intergenic
1132829506 16:1920411-1920433 CGTGGGGATGGCTGAGACCGTGG - Intergenic
1134630404 16:15752184-15752206 TCCTGGGATGACACAGACCCAGG + Intronic
1137460388 16:48655892-48655914 CCCTGGGATGATTAAGTCAGAGG + Intergenic
1138128789 16:54460849-54460871 CCCCAGGATGACAGAGACTGAGG - Intergenic
1138368266 16:56501402-56501424 CCCCAGGCTGACTGAGAGCGTGG + Exonic
1139989798 16:70930953-70930975 CCCTGAGATGACTCAGATGGAGG + Intronic
1142140649 16:88471330-88471352 CTCTGAGATGACTGTGTCCGTGG + Intronic
1142805228 17:2367904-2367926 TCCTGGGAAGACTGAGCCCTGGG - Intronic
1144298237 17:13899558-13899580 CCCTGGGATGATTAGGACAGGGG - Intergenic
1146208221 17:30922489-30922511 GGCTGGGATGTCTGAGTCCGAGG - Intronic
1147769320 17:42856717-42856739 CCCTGTGATGCCTGACACAGGGG + Exonic
1147772058 17:42874536-42874558 CCCTGTGATGCCTGACACAGGGG + Intergenic
1147775567 17:42898380-42898402 CCCTGGCATGACCCAGACAGTGG + Intergenic
1151827130 17:76529805-76529827 CCCTGGCCTGCCTGAGACCTGGG - Intronic
1152287562 17:79421718-79421740 CCCTGGCAAGCCTGAGGCCGGGG + Intronic
1154264981 18:12873273-12873295 CCGTGGGGAGACGGAGACCGTGG - Intronic
1156789604 18:40954911-40954933 CCCTGGGAATACTGAGAATGTGG + Intergenic
1157279786 18:46338856-46338878 CCCTGGGCTGACTGACTCCCCGG + Intronic
1159878428 18:73835034-73835056 CACTGGGATGACGGAGACAAGGG - Intergenic
1160414615 18:78699626-78699648 ACCTGGGATGAGTGGGAACGGGG - Intergenic
1160890698 19:1377345-1377367 CGCGCCGATGACTGAGACCGCGG - Exonic
1160928107 19:1556537-1556559 CACTGGGATGCCCGAGAACGTGG - Exonic
1161106085 19:2444767-2444789 TCCTGGGATGGCTGGGACCCAGG - Intronic
1162208845 19:9075839-9075861 CCCAGAGATGACTAAGACCTAGG - Intergenic
1162656881 19:12138005-12138027 CTCTGGGAGGACTGACACAGGGG + Intronic
1165198950 19:34129799-34129821 CTCTGGGATTACAGAGACTGAGG - Intergenic
1166921628 19:46232557-46232579 GCCTCGGATGACTGAGGCCCAGG - Intergenic
1166968859 19:46548614-46548636 CCCAGGGAAGACTGAGGCTGAGG - Intronic
1167528533 19:50000614-50000636 CCCTGGGATGATGGAGAACTGGG + Intronic
928193180 2:29193176-29193198 CCTTGGGATCCCTAAGACCGTGG - Exonic
928390180 2:30903624-30903646 CCTTGAGATGACTGTGACCCTGG + Intergenic
932385457 2:71328214-71328236 CCCTGGGATGACTAAGGCAGAGG + Intronic
932489856 2:72113780-72113802 GCCTGGAAGGACTGAGACTGTGG - Intergenic
933148717 2:78889169-78889191 CCCTGGGATGATTAAGGCAGAGG - Intergenic
933461420 2:82591866-82591888 CCCTGGGATGATTAAGACAGAGG + Intergenic
938263825 2:129912540-129912562 GGCTGGGGTGACTGAGCCCGGGG - Intergenic
940533782 2:154912395-154912417 CCCTGGGATGATTAAGGCAGAGG - Intergenic
941400388 2:165022939-165022961 CCCTGGGATGATCAAGACAGGGG + Intergenic
941736479 2:168982196-168982218 CCCTGGGAAGACAGAGTCAGAGG + Intronic
942310206 2:174649458-174649480 CCCTGGGATGACCAAGGCAGAGG - Intronic
942351429 2:175057313-175057335 CCCTGGGATGACTAAGGCAGAGG - Intergenic
945919959 2:215745889-215745911 CCTTGAGATGACTGTGACCCTGG - Intergenic
947918528 2:233850153-233850175 CCCAGGGATGACAGGGACTGGGG + Intronic
1169131490 20:3168250-3168272 CCCAGGGCTGGCTGAGGCCGGGG + Intronic
1169325705 20:4673791-4673813 CCCTGGGATGATTAAGGCAGAGG + Intergenic
1170571909 20:17637357-17637379 CTCTGGGATGACACAGACCATGG - Intronic
1172640532 20:36437712-36437734 GCCTGGGAAGACTGAGACAGAGG + Intronic
1172898950 20:38320309-38320331 CCCTGGAGTGTCTGAGACAGAGG - Intronic
1175170588 20:57077512-57077534 CCCTGGGAAGACTAAAACCGAGG + Intergenic
1175585651 20:60137434-60137456 CCCGAGGATGGCTGAGACCAGGG + Intergenic
1179711277 21:43264635-43264657 CCCTGGGATGATTTAGAGCAGGG + Intergenic
1181050953 22:20237999-20238021 CCCTAGGCTGACTGACACAGTGG + Intergenic
1184744113 22:46446166-46446188 CCCTGGGAGGAGGGAGACAGTGG - Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
950193337 3:10992749-10992771 CCCTCGGAAGACCGAGACAGCGG + Exonic
951727483 3:25776195-25776217 CACTGGTTTGCCTGAGACCGAGG + Intronic
953100337 3:39819492-39819514 CCCTAGGATGGGTGAGACAGGGG - Intronic
953450892 3:43005071-43005093 CCATGTGATGACTGAAACAGAGG - Intronic
954407559 3:50353921-50353943 CTCTGGGATGACAGAGAAAGGGG - Exonic
955346954 3:58168370-58168392 TCCTGGGAGCACTGAGGCCGTGG - Intronic
955849358 3:63203513-63203535 CCCAGCGTTGACTGCGACCGGGG - Intergenic
956405547 3:68925137-68925159 TCCTGGGAGGACTGAGCCCATGG + Intronic
961591076 3:127982406-127982428 CCCTGGGATGACTGAGGCAGAGG - Intronic
963704183 3:148665369-148665391 CCCTGGGAAGACAGGGAACGAGG - Intergenic
964181602 3:153894233-153894255 GCCTGGGATGTCTAAGACTGAGG - Intergenic
965006379 3:163031437-163031459 CCAGTGGATGACTGAAACCGTGG + Intergenic
966752001 3:183331120-183331142 CCCTGGGATGACTTAGGGCAAGG - Intronic
968507891 4:980174-980196 CCCTGGGGTGACTGAGGGCAGGG + Intronic
969624779 4:8296876-8296898 CTCTGTGATGTCTGAGACCAGGG - Intronic
972238209 4:37158511-37158533 CCCTGGGATGATTAAGGCAGAGG + Intergenic
976011316 4:80492857-80492879 CCCTGGGGTGATGGAGACTGTGG + Intronic
984597224 4:181683786-181683808 CCCTGTGCTGTCTGAGACAGGGG + Intergenic
985062972 4:186096535-186096557 CCTTGGGATGACTGTTAGCGAGG + Intergenic
986077851 5:4356739-4356761 CCCTGTTGTGACTGTGACCGCGG - Intergenic
990598203 5:57331922-57331944 CCCTGGGATGATTAAGGCAGAGG - Intergenic
990981079 5:61602857-61602879 CCCTGGGAGGTCTGAGGCTGAGG + Intergenic
992363843 5:76071051-76071073 CCGTGGGATGAATGAGAAGGAGG + Intergenic
995374089 5:111453888-111453910 CCCTGGGATGACTAAGGCAGAGG + Intronic
996760556 5:126982426-126982448 CCCCGGGATGACTGACAGTGAGG + Intronic
999233728 5:150078238-150078260 CCCTGGGATGACTGAGACCGGGG + Exonic
1000378142 5:160603162-160603184 CCCTGGGATTACTCAGAACAAGG + Intronic
1002330051 5:178434890-178434912 CCCTGCAAGGGCTGAGACCGAGG - Intronic
1002536861 5:179880513-179880535 CCCTGGGTGGAGTGGGACCGTGG - Intronic
1006931662 6:37692500-37692522 GCCTGGGAGGAGTGAGACAGAGG - Intronic
1007340991 6:41191559-41191581 CCCTGGGGTGGCTGAGACCTTGG - Exonic
1007822455 6:44570683-44570705 CCCAGGGATGTCTCAGACCAGGG - Intergenic
1011763374 6:90592515-90592537 TCCTGGGATGCCAGAGACCTAGG - Intergenic
1012260371 6:97081316-97081338 CCCTGGGATGATGGGGACAGAGG + Intronic
1012343478 6:98157004-98157026 GCCTGGGATGACTGAGGTTGTGG - Intergenic
1012938778 6:105395949-105395971 CACTGGGCTGACTGAGACAGAGG - Intronic
1018227749 6:161645865-161645887 CGCTGGCATGGCTGAGACAGCGG - Intronic
1018242526 6:161792089-161792111 CCCTAGGATGACTGAAGCCCTGG + Intronic
1018962795 6:168459847-168459869 CCCTGGGCTGGGTGAGCCCGGGG + Intronic
1019966103 7:4499937-4499959 CCATGGGATGATTGACACCTGGG + Intergenic
1019981637 7:4625807-4625829 CCATGGGAGAACAGAGACCGGGG + Intergenic
1020033067 7:4946601-4946623 CCCTGGGATGAGAGATACTGAGG - Intronic
1026306118 7:69143389-69143411 CCCTGGAATGACAGAGAAAGAGG - Intergenic
1029736664 7:102469138-102469160 CCCTGGGATGGCTGTGAGCTCGG + Intronic
1032409033 7:131679875-131679897 TCCTGAGATGAATGAGACTGAGG + Intergenic
1034542226 7:151765568-151765590 CCCAGTGATGACGGAGACCCAGG - Intronic
1038688954 8:29743675-29743697 CCCTGAGATGACCGAGACTCAGG - Intergenic
1041429697 8:57765572-57765594 CCCTGGGATCACCCCGACCGGGG - Intergenic
1043785289 8:84390759-84390781 CTGTGGGATGACTGAGCCCATGG + Intronic
1043849912 8:85204817-85204839 CCCTGGGATGATTAAGGCAGAGG - Intronic
1045013122 8:97975849-97975871 CACTGGGAACACTGAGATCGAGG - Intronic
1047513766 8:125535871-125535893 CCCTGGGAGGCCAGAGACTGAGG + Intergenic
1048160595 8:132017386-132017408 CCAGTGGATGCCTGAGACCGTGG + Intergenic
1048991811 8:139764964-139764986 CCCTGGGATGATGGAGACGATGG - Intronic
1056089109 9:83187016-83187038 CCCTGGGATGATTTAGGCAGAGG - Intergenic
1056549523 9:87640482-87640504 CTCTGGGCTGGCTGAGGCCGTGG - Intronic
1056761144 9:89415757-89415779 GCCTGAGCTGACTGAGACAGTGG + Intronic
1056853954 9:90108967-90108989 CCCTGGGATGACTAGGGCAGAGG + Intergenic
1057054922 9:91952862-91952884 TCCTGGGATATCTGAGACCTGGG + Intergenic
1062577439 9:137215236-137215258 CCCTGGGAAAGCTGGGACCGGGG + Intronic
1190939101 X:55023833-55023855 CCTTAGGCTGACTGAGACCAGGG + Exonic
1192785978 X:74335906-74335928 CCCTGGGTTGACTAAGAGCAGGG + Intergenic
1195264999 X:103171604-103171626 CCCTGGGATGATTAAGGCAGAGG - Intergenic
1199691131 X:150309764-150309786 GCCTGAGCTGACTGAGACAGAGG - Intergenic
1199799026 X:151231066-151231088 CCCTGAGATGATTAAGGCCGAGG + Intergenic