ID: 999238773

View in Genome Browser
Species Human (GRCh38)
Location 5:150115496-150115518
Sequence GGGAAAACTGAGTTCCCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999238769_999238773 -10 Left 999238769 5:150115483-150115505 CCATTTTACATATGGGAAAACTG 0: 4
1: 94
2: 1061
3: 4545
4: 11187
Right 999238773 5:150115496-150115518 GGGAAAACTGAGTTCCCTGGGGG 0: 1
1: 0
2: 0
3: 38
4: 337
999238764_999238773 21 Left 999238764 5:150115452-150115474 CCTAGATTCTGGGTCATCAAGCC 0: 1
1: 0
2: 1
3: 13
4: 114
Right 999238773 5:150115496-150115518 GGGAAAACTGAGTTCCCTGGGGG 0: 1
1: 0
2: 0
3: 38
4: 337
999238768_999238773 -9 Left 999238768 5:150115482-150115504 CCCATTTTACATATGGGAAAACT 0: 5
1: 96
2: 851
3: 3980
4: 10110
Right 999238773 5:150115496-150115518 GGGAAAACTGAGTTCCCTGGGGG 0: 1
1: 0
2: 0
3: 38
4: 337
999238765_999238773 0 Left 999238765 5:150115473-150115495 CCTAACTTTCCCATTTTACATAT 0: 1
1: 0
2: 10
3: 75
4: 607
Right 999238773 5:150115496-150115518 GGGAAAACTGAGTTCCCTGGGGG 0: 1
1: 0
2: 0
3: 38
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999238773 Original CRISPR GGGAAAACTGAGTTCCCTGG GGG Exonic