ID: 999240537

View in Genome Browser
Species Human (GRCh38)
Location 5:150124902-150124924
Sequence GGCCGGGGGTAGGGGAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1988
Summary {0: 1, 1: 1, 2: 17, 3: 209, 4: 1760}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999240537_999240557 24 Left 999240537 5:150124902-150124924 CCCCCACTCCCCTACCCCCGGCC 0: 1
1: 1
2: 17
3: 209
4: 1760
Right 999240557 5:150124949-150124971 GGGGAAAGAGCCACTCTCTTAGG 0: 1
1: 0
2: 1
3: 15
4: 178
999240537_999240550 4 Left 999240537 5:150124902-150124924 CCCCCACTCCCCTACCCCCGGCC 0: 1
1: 1
2: 17
3: 209
4: 1760
Right 999240550 5:150124929-150124951 TCACCCTTCCTGCCCAGTGAGGG 0: 1
1: 0
2: 0
3: 25
4: 235
999240537_999240551 5 Left 999240537 5:150124902-150124924 CCCCCACTCCCCTACCCCCGGCC 0: 1
1: 1
2: 17
3: 209
4: 1760
Right 999240551 5:150124930-150124952 CACCCTTCCTGCCCAGTGAGGGG 0: 1
1: 0
2: 2
3: 21
4: 257
999240537_999240549 3 Left 999240537 5:150124902-150124924 CCCCCACTCCCCTACCCCCGGCC 0: 1
1: 1
2: 17
3: 209
4: 1760
Right 999240549 5:150124928-150124950 ATCACCCTTCCTGCCCAGTGAGG 0: 1
1: 0
2: 1
3: 20
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999240537 Original CRISPR GGCCGGGGGTAGGGGAGTGG GGG (reversed) Intronic
900100678 1:960807-960829 GGGCGGGGGTCGGGGCGCGGGGG + Intronic
900113621 1:1019821-1019843 GGGCGGGGAGAGGAGAGTGGGGG - Intergenic
900174119 1:1284306-1284328 GGTGGGGGGTAGGGGTGGGGGGG + Intronic
900206880 1:1435398-1435420 GGCTGGGGGTCGGAGAGGGGTGG + Intronic
900227441 1:1539902-1539924 GGCCGGGGTGAGGGGAGCGTAGG + Intronic
900288426 1:1913304-1913326 GGCTGGGGGGCGGGGGGTGGTGG + Intergenic
900297920 1:1961458-1961480 GGCAGAGGGCAGGAGAGTGGTGG + Intronic
900346395 1:2212512-2212534 GGCCGGGGGTGGGGGTGGGGGGG - Intronic
900402344 1:2477711-2477733 AGCCTGGGGGAGGGGAGGGGAGG + Intronic
900413971 1:2526694-2526716 GGCCGGGGGTGGGGGAGGGAAGG - Intergenic
900511538 1:3063183-3063205 GGCCGGGGGAGGGGGAGCGAGGG + Intergenic
900625805 1:3608020-3608042 GGCGGGGGTGAGGGGAGTTGGGG + Intronic
900701030 1:4048715-4048737 TGCCATGGGGAGGGGAGTGGGGG - Intergenic
900980364 1:6042831-6042853 GGGGGGGGGGTGGGGAGTGGGGG - Intronic
901016757 1:6236161-6236183 GGGCGGGGGCCGGGAAGTGGTGG + Intergenic
901020442 1:6252552-6252574 TGCTGGGGGTGGGGCAGTGGGGG + Intronic
901023939 1:6269334-6269356 GGCCGGGGTGAGGTGAGGGGAGG - Intronic
901163468 1:7198321-7198343 GGTCGGGGGTAGGGGAGTGGGGG - Intronic
901180753 1:7340328-7340350 AGTCGGGGGTAGGCTAGTGGGGG - Intronic
901192684 1:7421961-7421983 CGCCGTGGCTGGGGGAGTGGAGG + Intronic
901417102 1:9124928-9124950 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
901466082 1:9422102-9422124 GGTCGGGGGTAGGGGGAGGGAGG - Intergenic
901497088 1:9628570-9628592 GGCCAGTGGTGGGTGAGTGGAGG + Intergenic
901633192 1:10657784-10657806 GGCAGGCGGTGGGGGGGTGGGGG + Intronic
901641621 1:10695575-10695597 GGCGGGGGGGGGGGGGGTGGCGG - Intronic
901642312 1:10698990-10699012 GGCCATGGGTGGGGGAGCGGTGG - Intronic
901659853 1:10792322-10792344 GGCCGGGGGGGGGGGGGCGGGGG - Intronic
901679971 1:10907339-10907361 AGCCGGGTGTTGGGAAGTGGGGG - Intergenic
901758985 1:11458689-11458711 GCCAGTGGGGAGGGGAGTGGGGG - Intergenic
901789637 1:11647568-11647590 GGCCTGGGGGAGGGGAGGTGGGG - Intergenic
901789682 1:11647719-11647741 GGCCTGGGGTAGGGGATGGGAGG - Intergenic
901843244 1:11966491-11966513 GGGCGGCGGGATGGGAGTGGGGG + Intronic
902092684 1:13916006-13916028 GGTTGGGGGCCGGGGAGTGGGGG + Intergenic
902237872 1:15069164-15069186 GGCCAGGGAGAGGGGAGTAGGGG - Intronic
902333504 1:15742427-15742449 GGCCCAGGGGAGGGGAGGGGAGG - Exonic
902496691 1:16877085-16877107 GGCAGGGGGTGGGGGTGGGGTGG - Intronic
902690479 1:18107703-18107725 GGCGGGGGGGCGGGGAGAGGGGG + Intergenic
902729792 1:18361998-18362020 TGCCGGGGGTGGGGGAGGGCAGG - Intronic
902798651 1:18815870-18815892 GGCTGGGGGTGGGGGACTGGCGG - Intergenic
902960792 1:19961730-19961752 GGGTGGGGGTGAGGGAGTGGGGG - Intergenic
903044009 1:20552672-20552694 GGCCGGGGCTGGGGGTGAGGTGG - Exonic
903115580 1:21176449-21176471 GGCCGGGGGCAGCGGGGGGGCGG + Intronic
903229162 1:21911455-21911477 GGCAGGGAGTGGGGGTGTGGAGG + Intronic
903281213 1:22251030-22251052 GACCGGCGGGAGGGGAGGGGAGG - Intergenic
903374935 1:22859926-22859948 GGCTGGGGATAGGGGAGCAGGGG - Intronic
903446337 1:23424781-23424803 GGCGGGCGGTGGGGGGGTGGGGG - Intergenic
903550321 1:24153430-24153452 GGCGGAGGGTAGGGGAGGAGGGG - Intergenic
903572751 1:24318570-24318592 GGCAGGGGGTGGGGGAGTAAAGG - Intergenic
903646116 1:24897399-24897421 TGCCGTGGGTAGGGGAGGGCAGG - Intergenic
903897854 1:26620601-26620623 GGCCGGGGGGAGGGGTGCGGAGG - Intergenic
903907812 1:26697842-26697864 GGCCGGGGGTGAGGGGGTGAGGG + Intronic
903950730 1:26994471-26994493 GGCCAGGGGTCCGGGCGTGGAGG - Exonic
904381067 1:30111549-30111571 CGCCGTGGGGAGGGGAGTGGCGG + Intergenic
904467814 1:30718581-30718603 GGCCGGGGGGGGGGCAGAGGCGG - Intronic
904530342 1:31164537-31164559 GGCTGGGGGTGGAGGGGTGGGGG - Intergenic
904702596 1:32366745-32366767 GGCCTGGGGTAGGGGATGGGAGG - Intronic
905008562 1:34730961-34730983 GGCCTGGGGTTGGGGAGATGGGG - Intronic
905140770 1:35842313-35842335 GGATGAGGGTAGGGGAGCGGCGG - Intronic
905502850 1:38453227-38453249 GGCAGGGTGAAGGGGAGGGGTGG + Intergenic
905867450 1:41383603-41383625 GGCTAGAGGAAGGGGAGTGGTGG + Intergenic
905888007 1:41502042-41502064 GGCCTGGGGTAGAGGAGGGATGG + Intergenic
905908882 1:41640268-41640290 GGGCGGGGGTTGGGGGGCGGGGG + Intronic
906083134 1:43107505-43107527 GGTGGGGGGTAGGGGGGCGGTGG + Intergenic
906152314 1:43594670-43594692 GCCCAGGGGGAGGGAAGTGGAGG + Intronic
906395238 1:45457312-45457334 GGCTGGGGGTAGAGGTGAGGTGG + Intronic
906688393 1:47777215-47777237 GGCTGGGGTGAGGGGAGAGGAGG + Intronic
906836944 1:49094217-49094239 TGGTGGGGGTAGGGGAGTGGGGG - Intronic
906898185 1:49802644-49802666 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
907257394 1:53190409-53190431 GGACGGGGGTTGGGGGGTGGGGG - Intergenic
907324206 1:53626305-53626327 GACCGGAGGGAGGGGTGTGGTGG - Intronic
907341660 1:53739533-53739555 GCCCGGGGCTAGTGGAGAGGCGG - Intergenic
907491502 1:54811766-54811788 GGGCGGGGGTGGGGGCATGGAGG - Intronic
907566218 1:55436662-55436684 GTCGGGGGGTAGGGGACTAGGGG + Intergenic
907585722 1:55616046-55616068 TGCAGGGGGTAGGGGAGAGAGGG + Intergenic
907604921 1:55806783-55806805 TGCTGGGGCTAGGGGAGAGGTGG - Intergenic
907798297 1:57739466-57739488 GGGCGAGGGGAGGGGAGGGGAGG - Intronic
907864909 1:58390227-58390249 GGCTGGGGGTAGGGGTGGGGTGG - Intronic
908148057 1:61268397-61268419 GGGTGGGGGCAGGGGAGTAGAGG - Intronic
908279866 1:62521098-62521120 GTCAGGGGGTAGGGGGGTAGGGG + Intronic
908397653 1:63740888-63740910 TGCCTGGGGTTGGGGAGGGGTGG + Intergenic
908695254 1:66832525-66832547 AGTTGGGGGTAGGGCAGTGGTGG + Intronic
908929994 1:69306465-69306487 GGGAGGGGGCAGGGGAGTGCTGG - Intergenic
908995412 1:70146719-70146741 GGCAGGGGGTGGAGCAGTGGTGG - Intronic
909318003 1:74247989-74248011 CCACGGGGGTAGGGGGGTGGAGG + Intronic
909393078 1:75136995-75137017 GGCCAGGGGGAAGGGAGGGGAGG + Intronic
909433600 1:75616242-75616264 CACCGGGGGTGGGGGCGTGGGGG - Intergenic
909797463 1:79759616-79759638 GCCAGGTGGTGGGGGAGTGGGGG - Intergenic
910467501 1:87515829-87515851 GGACAGGGGTAGGGGTGTAGTGG + Intergenic
910477650 1:87624022-87624044 GGCCGGGGGGTGGGGAGGGGGGG - Intergenic
910831597 1:91467070-91467092 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
910931515 1:92446973-92446995 GGCGGGGGGCAGTGAAGTGGGGG + Intergenic
911494688 1:98616663-98616685 GGCAGGAGTCAGGGGAGTGGGGG - Intergenic
911995236 1:104758107-104758129 GGCAGGGGGTGGGGGGATGGGGG + Intergenic
912634066 1:111274870-111274892 TGCCAGGAGTTGGGGAGTGGAGG + Intergenic
912811041 1:112794786-112794808 AGCTGGGGGTAGTGGGGTGGAGG - Intergenic
912955027 1:114149355-114149377 GGCTGGGGGGAGGGGAGCAGAGG + Intronic
913287650 1:117241427-117241449 GGAGGGGGGAAGGGGAGTGGGGG - Intergenic
913335184 1:117703240-117703262 GGCAGGGGAAAGGGGAGTGGAGG + Intergenic
913537436 1:119786411-119786433 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
913540766 1:119818696-119818718 GTCAGGAGGTAGGGGATTGGGGG - Intergenic
914005561 1:143729653-143729675 GGCTGGGGGTGGGGGGGGGGGGG - Intergenic
914133791 1:144882693-144882715 GGCGGGGGGGGGGGGAGGGGTGG + Intergenic
914231376 1:145766786-145766808 GGCCGGGGGGGGGGGGGGGGGGG + Intronic
914249913 1:145913139-145913161 TGCCAGGGGTTGGGGAGTGAGGG + Intronic
914443568 1:147728994-147729016 GGGCGGGGGTTGGGGAGTAGGGG - Intergenic
914681059 1:149938622-149938644 ATCGGGGGGTAGGGGTGTGGTGG + Exonic
914827369 1:151145693-151145715 GAGCGGGGGTTGGGGAGCGGAGG + Intronic
915163160 1:153933587-153933609 TGCGGGAGGCAGGGGAGTGGCGG + Exonic
915339309 1:155167555-155167577 GGGAGGGGGGAAGGGAGTGGCGG - Intergenic
915344997 1:155192946-155192968 GGCGGGCGGGCGGGGAGTGGGGG - Intergenic
915458714 1:156056755-156056777 TGCAGGGGGTAGGGGAGAGTAGG - Intronic
915520132 1:156437082-156437104 ATCCGGGGGTTGGGGGGTGGGGG - Intergenic
915570858 1:156744444-156744466 GGGTGGGGGTGGGGGAGAGGCGG - Intronic
915701188 1:157798185-157798207 GCCCTGGGGTAGGTGAGTTGAGG + Exonic
915819857 1:159010824-159010846 GGCAAGGTATAGGGGAGTGGAGG + Intronic
915839486 1:159203021-159203043 GTCCAGGGGTGGGGGGGTGGGGG + Intronic
915912932 1:159925420-159925442 GGTCGGGGGTACGGGGGTCGGGG - Intronic
915953449 1:160205300-160205322 GGGCGGGGGGCGGGGAATGGCGG - Intergenic
916006860 1:160670105-160670127 GGGCGGGGGGCGGGGTGTGGTGG - Intergenic
916124444 1:161556785-161556807 GGACAGGGGTAGGGGGGTGGGGG + Intergenic
916134336 1:161638135-161638157 GGACAGGGGTAGGGGGGTGGGGG + Intronic
916344399 1:163771527-163771549 GGCAGGGGGTGGGGGTGAGGGGG + Intergenic
916455760 1:164969738-164969760 GTCTCGGGGTAGGGGGGTGGGGG - Intergenic
916605965 1:166343034-166343056 GCACGGGGGTGGGGGAATGGGGG + Intergenic
916951039 1:169780690-169780712 GTCGGGGGGTGGGGGACTGGGGG - Intronic
917345268 1:174022442-174022464 GGGCGGGCGGAGGGGAGGGGCGG + Intergenic
917454521 1:175174679-175174701 GGCGGGGGATAGGAGGGTGGAGG - Intronic
917869464 1:179229180-179229202 GGCCGGGGGTGGGGTCGGGGCGG - Intronic
918389826 1:184047717-184047739 GGGCAGGGGTCGGGGAGGGGGGG - Intergenic
919457439 1:197836719-197836741 GTCAAGGGGTAGGGGAGTAGGGG + Intergenic
919741280 1:200982919-200982941 GGCAGCAGGAAGGGGAGTGGAGG + Intronic
919788258 1:201274128-201274150 GGCCAGGGGTTGGGGAGGGTGGG - Intergenic
919925319 1:202189006-202189028 GGGCTGGGGTGGGGGCGTGGGGG + Intergenic
919937813 1:202266191-202266213 GCCTGGAGGTGGGGGAGTGGGGG + Intronic
920072757 1:203314775-203314797 GTCAGGGGGTGGGGGACTGGGGG + Intergenic
920243723 1:204572621-204572643 GGCCGGGGGAGGGGTGGTGGAGG + Intergenic
920333662 1:205229542-205229564 GGGCGGGGGGGGGGGGGTGGTGG + Intronic
920382108 1:205541143-205541165 GGGCTGAGGAAGGGGAGTGGAGG - Intergenic
920556248 1:206907078-206907100 GCCGGGGGGTGGGGGGGTGGGGG + Intronic
920899645 1:210094782-210094804 GGCTTGGGGTTGGGGAGTGGGGG - Intronic
921002124 1:211055193-211055215 TGCTGGGGATAGGGGAGGGGTGG - Intronic
921154841 1:212431692-212431714 GGAAGCGGGTAAGGGAGTGGGGG - Intergenic
921218718 1:212958296-212958318 AGCTGGGGGCAGGGCAGTGGCGG - Intronic
921267196 1:213431008-213431030 GGTTGGGGGTGGGGGAGTGTGGG + Intergenic
921367123 1:214384137-214384159 GGCCGTGGGTAGGGGGGCGGTGG + Exonic
921794445 1:219326300-219326322 GGTGGGGGGTTGGGGGGTGGGGG + Intergenic
921981576 1:221264341-221264363 GGTCTGGGGTAGGGGAAGGGAGG - Intergenic
922048063 1:221966145-221966167 GGGCAGGGGCGGGGGAGTGGGGG - Intergenic
922427690 1:225514774-225514796 GGCCCGGTGGATGGGAGTGGAGG + Exonic
922689820 1:227679500-227679522 AGCAGGGGGTACGTGAGTGGGGG - Intergenic
922820791 1:228484087-228484109 GGCGGGGGGTGGGGGAGAGAAGG - Intergenic
923062521 1:230488915-230488937 GCCAGGGGATATGGGAGTGGGGG - Intergenic
923309820 1:232725284-232725306 GGAGGGGGGGAGGGGAGGGGGGG + Intergenic
923309847 1:232725325-232725347 GGAGGGGGGGAGGGGAGGGGAGG + Intergenic
923309858 1:232725342-232725364 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
923309882 1:232725376-232725398 GGAGGGGGGGAGGGGAGGGGAGG + Intergenic
923309900 1:232725402-232725424 GGAGGGGGGGAGGGGAGGGGAGG + Intergenic
923309917 1:232725429-232725451 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
923602068 1:235412151-235412173 GGAGGGGGGAAGGGGAGGGGAGG - Intronic
923879141 1:238084336-238084358 GGCCAGGGGTGGGGGAGGAGTGG + Intergenic
924283312 1:242460231-242460253 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
924428925 1:243979646-243979668 GGCCAGGAGTGGGGGGGTGGTGG + Intergenic
924628012 1:245711681-245711703 GCCGGGGAGTAGGGGAGTGAGGG - Intergenic
924740921 1:246793959-246793981 GGACGGGGGGAGGGTAGGGGAGG + Intergenic
1062819278 10:522090-522112 TGCCAGGGGTTGGGGAGGGGAGG - Intronic
1062835580 10:633495-633517 GGCCGGAGGCAGGGGAGGCGTGG - Intronic
1062921835 10:1286068-1286090 GGCGGGTGGTGGGGCAGTGGGGG + Intronic
1063074260 10:2699428-2699450 GGCTGGGGGCAGGGGAGCAGGGG + Intergenic
1063357306 10:5412907-5412929 GGCCGGGGGGAGGGGAGGGCTGG + Intronic
1063357339 10:5412991-5413013 GGCCGCTGGGAGGTGAGTGGGGG + Intronic
1063418284 10:5890436-5890458 GGCCCGGGGTGGGGCAGCGGGGG + Intronic
1063580270 10:7300161-7300183 TGCTGGGGGATGGGGAGTGGAGG + Intronic
1063776176 10:9267842-9267864 GGGCGGGGGTGGGGGAGGCGGGG - Intergenic
1063814000 10:9750175-9750197 GGCGGGGGGTGGGGGAGTGGTGG + Intergenic
1064206751 10:13330980-13331002 TGTCGGGGGTAGGGGGCTGGGGG - Intronic
1064957986 10:20932410-20932432 GGCCTGGGGCTGGGGGGTGGGGG + Intronic
1064975036 10:21105331-21105353 GTCGGGGGGTAGGGGACTGGGGG - Intronic
1064975711 10:21112585-21112607 GTCGGGGGGTGGGGGACTGGGGG + Intronic
1065091924 10:22244085-22244107 AGGAGGGGGTAGGGGAGAGGTGG - Intergenic
1065186265 10:23173615-23173637 GGACGGGGGTGGGGGCGTGTGGG - Intergenic
1065277452 10:24099329-24099351 GCCGTGGGGTAGGGGAATGGGGG - Intronic
1065286759 10:24194323-24194345 GGGGTGGGGTAGGGGAGGGGAGG - Intronic
1065486985 10:26245212-26245234 GGCTGGGGTTGGGGGTGTGGGGG + Intronic
1065679877 10:28218232-28218254 AGTCGGGGGTAGGGCAGCGGTGG + Intronic
1066085404 10:31970048-31970070 GGCCGGGGGGGGGGGGGGGGGGG + Intergenic
1066198957 10:33127945-33127967 GGCGGGGGGGAGGGGAGGGGCGG - Intergenic
1066303519 10:34117450-34117472 GCAGGGGGGTAGCGGAGTGGGGG + Intronic
1066370568 10:34815331-34815353 GGACGGCGGGAGGGGAGGGGAGG + Intergenic
1067078828 10:43202760-43202782 GGTCCGGGTTAGGGGCGTGGTGG - Intronic
1067085778 10:43237442-43237464 GGTGGGGGGGAGGGGAGGGGAGG - Intronic
1067471524 10:46541585-46541607 GGCGAGGGGTGGGGGAGGGGTGG + Intergenic
1067606271 10:47666185-47666207 GGCGGGGGGTGGGGGATGGGGGG - Intergenic
1068246495 10:54378000-54378022 AGCTTGGGGTTGGGGAGTGGAGG - Intronic
1068474204 10:57505220-57505242 GGCTGGGGGTGGGGGAATGAGGG - Intergenic
1068866774 10:61903170-61903192 GGACGGGGGCGGGGGAGGGGAGG + Intronic
1068933892 10:62617724-62617746 GGGCGGGGGTGGGGGTGGGGGGG - Intronic
1069593570 10:69656383-69656405 GGGCCTGGGTAGGGGAGCGGAGG + Intergenic
1069607630 10:69749718-69749740 GGTCGGGGGTCGGGGGGTCGGGG + Intergenic
1069832197 10:71288190-71288212 GTGCGGGGGTAGGGGAGCAGAGG - Intronic
1069834414 10:71299591-71299613 GGCTGAGGGTGGGGGGGTGGAGG - Exonic
1069891841 10:71656912-71656934 GGCGGGGGGTAGGGGATGGAGGG + Intronic
1069984549 10:72274410-72274432 GGCCGGAGGAAGGTGAGCGGTGG + Exonic
1070032583 10:72692067-72692089 GGCCCGGCGTCGGTGAGTGGCGG + Intergenic
1070126446 10:73625887-73625909 GGCCGGGGGTAACGGGGTGCAGG - Intronic
1070312607 10:75284426-75284448 GGTTGGGGGAAGGGGACTGGAGG + Intergenic
1070318997 10:75340154-75340176 GGCCGGGGGGAGGGGGCGGGGGG + Intergenic
1070448435 10:76532171-76532193 GTCGGGGGGTATGGGAGTAGGGG - Intronic
1070450196 10:76550474-76550496 GGCCGGGGGTGGGGGGTTGGGGG - Intronic
1070507452 10:77126712-77126734 GGGGGGGGGTGGGGGGGTGGGGG - Intronic
1070800548 10:79242551-79242573 GGCCGGGGGGAGGGGAGGGGAGG - Intronic
1070959304 10:80487733-80487755 GGGCGGTGGTAGGGGGGAGGTGG + Intronic
1071319893 10:84443988-84444010 GTCGGGGGGTAGGGGGCTGGGGG + Intronic
1071613913 10:87056981-87057003 TGGCGGGGGGAGGGGGGTGGCGG + Intronic
1071819516 10:89265207-89265229 TGCAGGGGGTTGGGGAGTGGGGG + Intronic
1071997356 10:91162157-91162179 GGGTGAGGGTAGGGAAGTGGAGG + Intergenic
1072079277 10:92012228-92012250 GGAGGGGGGGAGGGGAGGGGAGG - Intronic
1072161757 10:92773744-92773766 TGTTGGAGGTAGGGGAGTGGAGG - Intergenic
1072461248 10:95620786-95620808 GTCGGGGGGTGGGGGACTGGGGG + Intronic
1072667305 10:97403101-97403123 GGCCGGGGGGCAGGGAGTAGAGG + Intronic
1072741078 10:97910045-97910067 GGCTAGGGGTAGGGGTGTTGGGG + Intronic
1072775695 10:98190798-98190820 GTCGGGGGGTGGGGGACTGGGGG - Intronic
1072845476 10:98825615-98825637 GGGCGGGGGTGGGGGAGGTGTGG + Intronic
1073015027 10:100391838-100391860 TGGCAGGGGTTGGGGAGTGGGGG - Intergenic
1073049173 10:100656654-100656676 GGCCGGGGGAAGGGGCGGGCCGG + Intergenic
1073189907 10:101643835-101643857 GGCCTGGGGTAGGGAAGTGGGGG + Intronic
1073212660 10:101817875-101817897 CGCCGGGGCTGGGGGAGCGGCGG - Exonic
1073297476 10:102450015-102450037 AGGCGGGGGTAGGGGAGCGGTGG + Exonic
1073325810 10:102643581-102643603 GGGCCGGGGGAGGGGAGGGGAGG + Intergenic
1073348494 10:102802054-102802076 GGCTGGGGGAAGGGTAGGGGAGG - Intronic
1073359273 10:102884402-102884424 GGCTGGGGGTAGGGGGTGGGAGG - Intronic
1073460888 10:103665355-103665377 GGTGGGGGGAAGGGGTGTGGGGG - Intronic
1073514206 10:104062497-104062519 GGCCTGGGGTAGGTAGGTGGGGG - Intronic
1073578247 10:104642177-104642199 GGCCGCCGGGAGGGGAGTGGAGG + Intronic
1073750026 10:106515005-106515027 GGGCGGGGGTGGGGGTGGGGAGG - Intergenic
1074182441 10:111076774-111076796 GGTGGGGGGTAGGGGAGGAGCGG - Intergenic
1074326316 10:112455200-112455222 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
1074938082 10:118206737-118206759 TGAAGGGGGTGGGGGAGTGGTGG - Intergenic
1075031912 10:119029658-119029680 GGCCGGGGGGCGGGGAGGAGTGG + Intergenic
1075199713 10:120392348-120392370 GGCAGAGGGTGGGGAAGTGGAGG + Intergenic
1075402514 10:122171334-122171356 GGGCCGAGGTAGGGGGGTGGAGG + Intronic
1075721462 10:124590013-124590035 GGCGGGGGGCGGTGGAGTGGTGG - Intronic
1075960248 10:126562272-126562294 GGCAGGGGGTAAGGGAGGGCAGG - Intronic
1076015495 10:127024310-127024332 GGCTGGAGGAAGGGGAGGGGAGG + Intronic
1076049498 10:127321254-127321276 GGCCGAGGGGAGGAGAGGGGAGG - Intronic
1076182749 10:128423173-128423195 GGCCAGGGGCTGGGTAGTGGGGG + Intergenic
1076546320 10:131247806-131247828 GGCAGGAGGCAGGGGAGAGGTGG - Intronic
1076618252 10:131770922-131770944 GGCAGGAGGTAGGAGAGGGGCGG + Intergenic
1076732036 10:132444019-132444041 GCCCTGAGGAAGGGGAGTGGGGG - Intergenic
1076802214 10:132835949-132835971 GGAAGTGGGGAGGGGAGTGGGGG - Intronic
1076828784 10:132983723-132983745 GGGCGGGAGAAGGGGAGCGGTGG - Intergenic
1076897182 10:133318485-133318507 GTCCGGGGGGAGGGGGGTGGGGG - Intronic
1076948123 10:133665459-133665481 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076949113 10:133668769-133668791 GGCGGGGGGTGGGGGTGGGGAGG - Intronic
1076950097 10:133672068-133672090 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076951081 10:133675367-133675389 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076952071 10:133678677-133678699 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076953060 10:133681987-133682009 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076954044 10:133685286-133685308 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076955028 10:133741638-133741660 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076956017 10:133744948-133744970 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076957007 10:133748258-133748280 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076957994 10:133751567-133751589 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076958979 10:133754866-133754888 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076959968 10:133758176-133758198 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076960952 10:133761475-133761497 GGCGGGGGGTGGGGGTGGGGAGG - Intergenic
1076999604 11:316011-316033 GGCCGCGGGGAGGTGAGAGGCGG + Intergenic
1077032367 11:474301-474323 GGCCGGGGGCAGGTGGGTGAGGG + Intronic
1077101268 11:823674-823696 GGCCTGGGGTTGGGGAGAGAAGG - Exonic
1077144271 11:1037659-1037681 GGCGGGGGGGAGGGAGGTGGAGG + Intergenic
1077191656 11:1258241-1258263 TGCTGGGGGTGGGGGAGTGCAGG + Intronic
1077201399 11:1309312-1309334 GGCCGGCCGGAGGGGAGCGGCGG - Intronic
1077204668 11:1336709-1336731 GGCGGGGGGGCGGGGCGTGGAGG + Intergenic
1077204680 11:1336731-1336753 GGCGGGGGGGCGGGGCGTGGAGG + Intergenic
1077204691 11:1336752-1336774 GGGCGGGGGGCGGGGCGTGGAGG + Intergenic
1077204731 11:1336826-1336848 GGCGGGGGGGCGGGGCGTGGAGG + Intergenic
1077413216 11:2413093-2413115 GGCAGGGTGGAGGGGACTGGCGG - Intronic
1077413688 11:2414862-2414884 GCGCGGGGGCAGGGGAGGGGCGG - Intronic
1077437425 11:2549619-2549641 GGCCCGGGGTAGGGGCGTGGGGG + Intronic
1077456148 11:2682179-2682201 GGCCTGGGGAAGGGGAGAGAAGG - Intronic
1077484266 11:2831711-2831733 GGCAGCGGGGAGGGGAGGGGAGG - Intronic
1077504759 11:2924803-2924825 GGCAGGGGGTGGGGGACTGGAGG + Intronic
1077601509 11:3578036-3578058 GGCGGGGGGGGGGGGGGTGGAGG - Intergenic
1077923076 11:6655827-6655849 GGGCGGGGGGAGGGGAGGGGAGG - Exonic
1077923147 11:6655968-6655990 GGCCTGGGGCCGGGAAGTGGAGG - Intergenic
1078145268 11:8718108-8718130 GGCTGGGGGTGGGGGGTTGGGGG - Intronic
1078168448 11:8910926-8910948 GGTCGGGGGTCGGGGGCTGGGGG - Exonic
1078168453 11:8910933-8910955 GGCCGGGGGTCGGGGGTCGGGGG - Exonic
1078168466 11:8910954-8910976 GGCCGGGGGTCGGGGGTCGGGGG - Intergenic
1078190433 11:9089591-9089613 GGCTGGGGGAAAGGGAGAGGAGG + Intronic
1078535941 11:12174350-12174372 GGCTGGGGGTGGGGGTGGGGAGG - Intronic
1078665707 11:13323334-13323356 GGCAGTGGGTATGGGAGTTGGGG - Intronic
1079019505 11:16897505-16897527 GGCTGGGAGCAGGGGACTGGTGG + Intronic
1079037793 11:17036071-17036093 TGCCAGGGGTCGGGGAGGGGTGG - Intergenic
1079163198 11:18013062-18013084 TGCCGGGGGTAGGTGAGCGCCGG + Exonic
1079486709 11:20942463-20942485 GGTTGGGAGTAGGGGAGTAGGGG + Intronic
1080475373 11:32585082-32585104 GGGCGGGGGGAGGAGAGAGGGGG - Intronic
1080642916 11:34168154-34168176 GGCATGGGGAAGGTGAGTGGGGG + Intronic
1080768339 11:35317347-35317369 GGCTGGGGGTGGGGTAGTGCAGG + Intronic
1080830742 11:35891178-35891200 GGGTGGGGTTAGGAGAGTGGAGG - Intergenic
1080959020 11:37136105-37136127 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1081460839 11:43271508-43271530 GCCCGGGGCTTGGGGAATGGAGG + Intergenic
1081533918 11:43983737-43983759 GGGGTGGGGTAGGGGGGTGGAGG + Intergenic
1081538251 11:44011238-44011260 GGCTGGGGGTTGGGAGGTGGAGG - Intergenic
1081545193 11:44066610-44066632 AGCCTGGGGTAGGGGGGCGGCGG - Exonic
1081657724 11:44868440-44868462 GGCTGTGGGTATGGGTGTGGAGG + Intronic
1081670382 11:44939062-44939084 TGCTGGCGGTGGGGGAGTGGGGG - Intronic
1081678414 11:44984822-44984844 GGCGGAGGGTAGGGCATTGGAGG + Intergenic
1081809209 11:45905852-45905874 GGCCCAGGGTAGGGGAGGGTGGG + Exonic
1081891364 11:46545158-46545180 AGCCGGGGGGGGGGGGGTGGTGG + Intronic
1082010751 11:47448409-47448431 GGCTGGGGGTGGGTGGGTGGTGG - Intronic
1082072839 11:47952775-47952797 GGCAGGGGGGTGGGGGGTGGGGG + Intergenic
1082140063 11:48598752-48598774 GGGCGGGGGGAGGGGGGAGGGGG - Intergenic
1082296428 11:50445816-50445838 GGCCTCAGGGAGGGGAGTGGGGG - Intergenic
1082835939 11:57650047-57650069 GGACGGGGCTAGAGGAGTGGGGG + Intronic
1083235196 11:61346581-61346603 GGCCGGGGGAAGGTGAGGGTTGG - Exonic
1083262659 11:61531514-61531536 GGCAGGGAGAAGGGGAGAGGTGG + Intronic
1083299738 11:61734166-61734188 GGGCAGGGGTAGGGGAGGTGAGG + Intronic
1083586457 11:63863444-63863466 GGTGGGGGGTGGGGGGGTGGGGG - Intronic
1083614464 11:64019392-64019414 GGCCGGGAGGAGGGGTGTGTGGG - Intronic
1083679032 11:64342859-64342881 GGGCAGGTGTAGGGGAGTGGGGG + Intronic
1083702306 11:64487460-64487482 GGCAGGGGGTGGGTGAGTGGGGG + Intergenic
1083765950 11:64841780-64841802 GGCCTGGGGTAGGTGGGGGGAGG - Intronic
1083799991 11:65041197-65041219 GGCCGGGGGGTGGGGAGCGGCGG - Exonic
1083890820 11:65595078-65595100 GGCCTCGGGTGGGGGAGTGAGGG - Intronic
1083904655 11:65662124-65662146 TCCCTGGGGTAGGGCAGTGGGGG - Intronic
1083905068 11:65663726-65663748 AGGCGGGGGCAGGGGGGTGGGGG - Intergenic
1084006841 11:66327411-66327433 GGGCTGGGGTGGGTGAGTGGTGG + Intergenic
1084125559 11:67096745-67096767 GGCAGGAGGCAGGTGAGTGGAGG - Intergenic
1084164175 11:67367271-67367293 GGCCAGGGATGGGGAAGTGGGGG + Intronic
1084221364 11:67681977-67681999 GGGCGGGGGTAGGTTAGTGCGGG + Intergenic
1084524230 11:69685983-69686005 GGCCGAGGGTCAGGGAGTGCAGG - Intergenic
1084528934 11:69715341-69715363 GGTGGGGTGCAGGGGAGTGGAGG + Intergenic
1084601752 11:70149920-70149942 GGCAGGGGGTGGGGGATGGGGGG - Intronic
1085050062 11:73375810-73375832 TGCGGGGAGTAGGGGAGTGGAGG + Intergenic
1085223378 11:74895614-74895636 GCCTGGGGTTAGGGGAGGGGTGG - Intronic
1085345874 11:75768069-75768091 GCCCTGGGCTGGGGGAGTGGGGG - Intronic
1085517857 11:77121899-77121921 GGCAGGGGAGAGGGGAGTGATGG - Intronic
1085527518 11:77172898-77172920 GGCCTGGGGTTGGCGGGTGGCGG + Intronic
1085753499 11:79184529-79184551 GGCATGGGGTAGGGGTGTGGGGG + Intronic
1086014075 11:82143179-82143201 AGCCGGGGGGAGGGGAGGAGAGG + Intergenic
1086453402 11:86938731-86938753 GGCTGGGGGTAGGGGTGGGGTGG + Intronic
1086494690 11:87389768-87389790 GTCAGGGGGTGGGGGACTGGGGG + Intergenic
1086866329 11:91984250-91984272 GGCAGGGGGAAGGGAATTGGTGG + Intergenic
1087014462 11:93542736-93542758 GCCTGGGGGTCGGGGAGTAGAGG - Intronic
1087116988 11:94535939-94535961 GGGCGGGGGTGGGGGACTGCTGG + Intergenic
1087667298 11:101065685-101065707 TGCAGCGGGCAGGGGAGTGGGGG - Intronic
1087968891 11:104454621-104454643 GGCCTGGGGTGGGGGAGGGAGGG - Intergenic
1088039992 11:105369015-105369037 GCCAGGGGGTAAGGGAGGGGTGG - Intergenic
1088548435 11:110985740-110985762 GGCCTGGGGTAGGGAGGAGGAGG - Intergenic
1088723189 11:112612417-112612439 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
1089171004 11:116511450-116511472 GGGTGGGGGTGGGGGTGTGGGGG + Intergenic
1089255599 11:117192384-117192406 GGCCTGGGGGAGGGGTCTGGGGG + Intronic
1089457719 11:118635059-118635081 GGCCGGGGGAGGGGGGGCGGTGG - Intronic
1089498379 11:118919114-118919136 GGGCGGGGGTTGGGGGGTCGGGG - Intronic
1089728124 11:120500932-120500954 GGACGGGGGTGGGGGGGTGGGGG - Intergenic
1089869198 11:121657200-121657222 GGCAGGGGGAAGGGGTGTGGGGG - Intergenic
1089948471 11:122502653-122502675 TGCCAGGGGCTGGGGAGTGGAGG - Intergenic
1090244620 11:125207023-125207045 GGCGGGGGGTGAGGGGGTGGGGG + Intronic
1090367522 11:126219761-126219783 GGCTGGGGGTAGGGAGGTGCTGG - Intronic
1090394104 11:126407697-126407719 AGCGGGGGGGTGGGGAGTGGGGG - Intronic
1090645683 11:128765047-128765069 GGCCGGGGGAGGGAGAGAGGAGG + Intronic
1091241127 11:134053139-134053161 GGGCGGGGGGGGGGGGGTGGAGG + Intergenic
1091445358 12:541849-541871 GGCCGGGGGGTGGGGGGGGGTGG - Intronic
1091498383 12:991522-991544 GCCCGGGGGGTGGGGAGGGGCGG + Intronic
1091518804 12:1214520-1214542 GGCCGGGAGGCGGGGAGTGGAGG - Intronic
1091792517 12:3280057-3280079 GTCCTGGGATGGGGGAGTGGAGG + Intronic
1091905894 12:4188906-4188928 GGCAGGGGTTGGGGGAGGGGAGG + Intergenic
1092000678 12:5029457-5029479 GGCCTGTTGTGGGGGAGTGGGGG + Intergenic
1092065865 12:5589293-5589315 GGCCTGGGATGGGGGAGGGGAGG + Intronic
1092123447 12:6060089-6060111 GGCCAGGGTTAGGAGAGTGGGGG + Intronic
1092170580 12:6371521-6371543 GGCGGGGGGGCGGGGGGTGGGGG + Intronic
1092192754 12:6532945-6532967 GGGGTGGGGTGGGGGAGTGGAGG - Intergenic
1092343143 12:7693407-7693429 GACGGGGGTCAGGGGAGTGGGGG + Intronic
1092539799 12:9413641-9413663 GGGCGGGGGGCGGGGGGTGGGGG + Intergenic
1093357201 12:18180223-18180245 GGTTGGGGGTGGGGGTGTGGCGG + Intronic
1093360263 12:18217409-18217431 GACCTGGAGTAGGGGAGTGGAGG + Intronic
1093662843 12:21776522-21776544 GGGAGGGGGTACAGGAGTGGTGG - Intergenic
1093894539 12:24562116-24562138 GGCTGGGGGTGGCGGAGAGGTGG - Intergenic
1093931674 12:24960676-24960698 GCCTAGGGTTAGGGGAGTGGTGG - Intergenic
1094536471 12:31325921-31325943 GGACGGGGGGAGGTGGGTGGAGG + Intronic
1094565930 12:31598371-31598393 TGGCGGGGGTGGGGGGGTGGTGG + Intergenic
1094583052 12:31751976-31751998 GGTCGGGGATGGGGAAGTGGTGG + Intergenic
1094692702 12:32785588-32785610 GGCCGGGGGGATGTGAGTGAAGG - Intergenic
1094808241 12:34110906-34110928 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1095054040 12:37579554-37579576 GCCCAGGGTTAGGGGAGTTGGGG + Intergenic
1095349955 12:41198322-41198344 TGCAGGGGTTAGGGGAGTGCTGG - Intronic
1095410532 12:41916044-41916066 GGCCAGTGGTAGGGGAGTTGAGG - Intergenic
1095948466 12:47767185-47767207 GGGCTGGGGTGGGGGGGTGGAGG + Intronic
1095953722 12:47795235-47795257 GCCCGGCGGTGGGGGAGCGGTGG + Exonic
1095960072 12:47828877-47828899 GGCCTGGGGCCGGGGGGTGGGGG + Intronic
1095960077 12:47828885-47828907 GCCGGGGGGTGGGGGGGTGGTGG + Intronic
1095960669 12:47832690-47832712 CACCGTGGGAAGGGGAGTGGTGG - Intronic
1096008932 12:48196753-48196775 GGCCGGGGTTGGGGGGGGGGCGG + Intergenic
1096023045 12:48337987-48338009 GGCAGGGGGTGGAGTAGTGGTGG + Exonic
1096096396 12:48938420-48938442 GGCCGGGGGGAGCGGGGAGGGGG - Exonic
1096336938 12:50764047-50764069 GGGCGGGGGCGGGGGAGGGGAGG - Intronic
1096466496 12:51849554-51849576 GGACGGGGGCAGCGGAGTGTAGG + Intergenic
1096531440 12:52244997-52245019 GGCTGGGGCTGGGGGACTGGGGG + Intronic
1096625490 12:52892882-52892904 GGCAGGGTGGAGGGAAGTGGGGG + Intergenic
1096717386 12:53499617-53499639 GGCTAGGGGTCGGGGGGTGGGGG - Intronic
1096773016 12:53948337-53948359 GGTCGGGGGCAGGGGGGTGGAGG + Intergenic
1096785807 12:54016636-54016658 GGGTGGGGGTAGGGGTGGGGTGG + Intronic
1096795039 12:54071468-54071490 GGTGGGGGGTGGGGGAGTAGGGG + Intergenic
1097050887 12:56222378-56222400 GGCCGCGGGGTGGGGAGTGAGGG + Intronic
1097185543 12:57194506-57194528 GGGCGGGGGCAGGTGTGTGGTGG + Intronic
1097324795 12:58264273-58264295 GGGTGGGGGTCGGGGGGTGGAGG - Intergenic
1097714969 12:62956030-62956052 TGCAGGGGATAGGGGAGTGGTGG + Intergenic
1097863917 12:64543488-64543510 GGGAGGGTGTGGGGGAGTGGGGG - Intergenic
1097889942 12:64767786-64767808 GGCGGGGGGGGGGGGAGGGGGGG + Intergenic
1098396929 12:70029008-70029030 GGAGGGGGGTAGGGAAGTGCTGG - Intergenic
1098452241 12:70632424-70632446 GTCGGGGGGTGGGGGACTGGGGG + Intronic
1098605314 12:72382323-72382345 GGCATGGGGTTGGGGAGGGGGGG + Intronic
1099165953 12:79307612-79307634 GGCTGGGGGTGGGGGTGGGGGGG + Intronic
1099332278 12:81304591-81304613 GGCAGGGAGTAGGGGTATGGTGG + Intronic
1099523161 12:83688943-83688965 GGTCGGGGGTGGGGGGCTGGGGG + Intergenic
1099610153 12:84857681-84857703 GCCTGGGGTTGGGGGAGTGGTGG + Intergenic
1099665250 12:85619966-85619988 GGCCGGGGGGCTGGGGGTGGTGG + Intergenic
1099833552 12:87876843-87876865 GTTGGGGGGTAGGGGAGTAGGGG + Intergenic
1100142374 12:91634216-91634238 GGGTGGGGGTAGGGGAGAAGAGG - Intergenic
1100357227 12:93842810-93842832 GGGCGGGGGTGGGGGAGAGTAGG + Intronic
1100826977 12:98483728-98483750 GGGAGGGGGAAGGGGAGGGGAGG + Intergenic
1100945181 12:99774980-99775002 TGCCAGGGGCTGGGGAGTGGAGG + Intronic
1101238504 12:102814128-102814150 GGCAGGGGGTTGGGGAGGAGAGG - Intergenic
1101570172 12:105946504-105946526 GAGCGGGGGGTGGGGAGTGGGGG - Intergenic
1101673337 12:106896687-106896709 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
1101673627 12:106898494-106898516 GGGTGGGGGAAGGGGAGTGGAGG + Intergenic
1102251026 12:111387792-111387814 GGCCTGGGATGGGGAAGTGGTGG - Intergenic
1102327004 12:111994515-111994537 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1102466225 12:113132357-113132379 GGCCAGGGGTGGGGAAGTGGGGG - Intronic
1102728754 12:115089497-115089519 GGCCAGGGGGAGGGGAGAGATGG - Intergenic
1102789169 12:115629921-115629943 GGCGGGGGGCCGGGGAGGGGAGG - Intergenic
1102819094 12:115892915-115892937 GCCAGGGGCTGGGGGAGTGGGGG - Intergenic
1102896657 12:116603625-116603647 GGGCAGGGGTTGGGGGGTGGGGG + Intergenic
1102963012 12:117105807-117105829 GGCAGGGGGCTGGGGAATGGGGG - Intergenic
1103377636 12:120469328-120469350 GGCCGGGGGGAGGGGAGCCCTGG + Intronic
1103538892 12:121652615-121652637 GGCTTGGGGTCGGGGAGTGGGGG - Intronic
1103553703 12:121753269-121753291 GACGGGGAGTAGGTGAGTGGTGG + Intronic
1103968598 12:124655610-124655632 GGCCTGGGGTCGGGGGGAGGTGG - Intergenic
1104092850 12:125530330-125530352 AGTTGGGGGTCGGGGAGTGGAGG - Intronic
1104140131 12:125979667-125979689 GGCCGGGGGGGGGGGGGTGGGGG + Intergenic
1104513731 12:129404667-129404689 GGCAGGGGGCAGGGGGGTGTAGG + Intronic
1104935297 12:132361152-132361174 GGCCAGGGCTGGGGGGGTGGCGG + Intergenic
1104973262 12:132540976-132540998 GCCTTGGGGTAGGGGTGTGGTGG - Intronic
1104973318 12:132541174-132541196 GCCTCGGGGTAGGGGTGTGGTGG - Intronic
1105589958 13:21783228-21783250 AGCTGGGGGTAAGGGAGTGAGGG + Intergenic
1105829009 13:24147758-24147780 GCCAGGGGCTAGGGGTGTGGAGG - Intronic
1105935653 13:25096096-25096118 AGCCGGAGGGAGGGGAGCGGGGG - Exonic
1105964579 13:25372495-25372517 GGCCGGGGCGAGGTGAGCGGCGG + Intronic
1106027437 13:25968446-25968468 GGCCGAGGCTCGGGAAGTGGTGG - Intronic
1106182442 13:27380943-27380965 GGGGGGGGGTGGGGGAGGGGCGG + Intergenic
1106373259 13:29158329-29158351 GGACGGGGGTTGGGGGGTGGGGG - Intronic
1106386854 13:29295411-29295433 GGTAGGGGGTAGGGGAGTATAGG - Intronic
1106759917 13:32858290-32858312 CACCGGGGGGAGGGGAGAGGTGG + Intergenic
1106790318 13:33149040-33149062 TGCCAGGGGTTGGGGAGAGGAGG + Intronic
1107095294 13:36528924-36528946 GGGCGGGGGTGGGAGAGGGGTGG + Intergenic
1107133556 13:36920481-36920503 GGCTGGGGGTGGGGAAGAGGCGG - Intronic
1107290124 13:38842408-38842430 AACCTGGGGAAGGGGAGTGGAGG + Intronic
1107387955 13:39932882-39932904 GTCCGGGGGTGGGGGAATGGGGG + Intergenic
1108192781 13:47959482-47959504 GGAGGGGGGAAGGGGAGCGGGGG + Intronic
1108320171 13:49281914-49281936 GGGTGGGGGGAGGGGGGTGGGGG - Intronic
1108359047 13:49652621-49652643 GGGGGGGGGCAGGGGGGTGGGGG + Intergenic
1108575874 13:51790161-51790183 AGCTGGGGGTGGGGTAGTGGAGG - Intronic
1108854186 13:54773215-54773237 GGAAGGGGGAAAGGGAGTGGAGG + Intergenic
1109019200 13:57063262-57063284 GGGAGGGGTTAGGGGAGTGCTGG + Intergenic
1109105235 13:58241761-58241783 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1109381078 13:61559751-61559773 GGCCGGGGGGTGGGGAGGGGAGG + Intergenic
1109973409 13:69800028-69800050 GGACAGGGGTCGGAGAGTGGGGG - Intronic
1109973633 13:69802675-69802697 AGCAGGGGGTACGGGACTGGGGG - Intronic
1110278130 13:73661951-73661973 CCCAGCGGGTAGGGGAGTGGTGG - Intergenic
1110318269 13:74134538-74134560 GGGCGGGGGCAGGGGTGGGGCGG - Intergenic
1110781713 13:79473799-79473821 GTCAGGGGGTGGGGGACTGGGGG - Intergenic
1111420951 13:88010611-88010633 CACCGGGGGTGGGGGACTGGAGG - Intergenic
1111639238 13:90946974-90946996 GCCTGGGGTTGGGGGAGTGGTGG - Intergenic
1111702757 13:91711450-91711472 GTCAGGGGGTGGGGGACTGGGGG + Intronic
1111811433 13:93096976-93096998 GGCCGGGGGTAGGGAGAGGGGGG - Intergenic
1111877644 13:93916799-93916821 GGCATGGGGGAGGGGAGGGGTGG + Intronic
1111920963 13:94410762-94410784 GCCCGGGGGTGGGGGGGGGGGGG + Intergenic
1112028057 13:95430488-95430510 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
1112124877 13:96454053-96454075 AGCTAGGGGTGGGGGAGTGGTGG - Intronic
1112441228 13:99426398-99426420 GGCAGGGGAGAAGGGAGTGGAGG - Intergenic
1112537539 13:100274921-100274943 GGACTGGGGTGGGTGAGTGGGGG + Intronic
1112789127 13:102984236-102984258 CCCCGGGGGTAGGGTAGAGGAGG + Intergenic
1112919830 13:104598283-104598305 GGGCTGGGGGAGGGGTGTGGGGG + Intergenic
1113338523 13:109399849-109399871 GACTGGAGGTAGGGGAGTGAGGG + Intergenic
1113539510 13:111095246-111095268 GGGCTGGTGTAGGGGAGTGGGGG + Intergenic
1113614601 13:111671408-111671430 GGGCGGGGGTAGGGGGGTGGCGG + Intronic
1113620068 13:111756322-111756344 GGGCGGGGGTAGGGGGGTGGCGG + Intergenic
1113746086 13:112745921-112745943 GGCCTGGGGGAGGGGAGGTGGGG - Intronic
1113796506 13:113061688-113061710 GGCAAGGGGGAGGGGAGGGGAGG - Intronic
1113852135 13:113423883-113423905 GGTGGGGTGTAGGGGTGTGGGGG - Intronic
1113974471 13:114216240-114216262 AGCCGGGAGGAGGGCAGTGGAGG - Intergenic
1114346994 14:21806879-21806901 TGTCGGGGGAGGGGGAGTGGGGG + Intergenic
1114473438 14:22979251-22979273 GGCCTGGAATTGGGGAGTGGAGG - Intronic
1114494560 14:23123719-23123741 GGGCGGGAGTAAGGGGGTGGTGG - Intergenic
1114559745 14:23581022-23581044 GGCCGGGGGAGGGGGGGAGGAGG - Intergenic
1115121894 14:29947092-29947114 GGCAGGGGGTTGGGGAGACGAGG + Intronic
1115754930 14:36520442-36520464 GGCCGGGGGTGGGGGGGGGGGGG - Intronic
1115850273 14:37584863-37584885 GGCCCGGGGTGGGGTAGTGGGGG + Intergenic
1116045117 14:39733917-39733939 GGGAGGGGTTAGGGGAGTGCTGG + Intergenic
1116235312 14:42272316-42272338 GTCAGGGGGTAGGGGACTAGGGG - Intergenic
1116244959 14:42397928-42397950 GTCAGGGGGTAGGGGACTAGGGG + Intergenic
1116724363 14:48544064-48544086 GGATGGGGGGAGGGGGGTGGGGG - Intergenic
1116754433 14:48928052-48928074 GTCAGGGGGTAGGGGGCTGGGGG + Intergenic
1117046372 14:51817148-51817170 GGCCGGGGGGAGGGGGAGGGGGG - Intergenic
1117145570 14:52833850-52833872 GGCAGGGGGGAGGGGTGGGGGGG - Intergenic
1117351231 14:54883822-54883844 GGCCTGGGGCAGGGGTGGGGTGG + Intronic
1117494537 14:56289604-56289626 GGGCGGGGGTTGGGGGGTGGTGG - Intronic
1117531528 14:56664879-56664901 GGGCTGGGGTGGGGTAGTGGTGG - Intronic
1118303960 14:64639067-64639089 TGCAGGGGGTGGGGGAATGGAGG + Intergenic
1118317976 14:64737299-64737321 GGCGAGGGGCAGGGGAGGGGAGG - Intronic
1118562076 14:67096697-67096719 GGGTGGGGGGTGGGGAGTGGAGG - Intronic
1118871392 14:69745780-69745802 GGCTGGGGGTGGGGGGGTGCGGG + Intronic
1119142484 14:72280105-72280127 GGCCTGGGGTGGGGGCGTGGCGG - Intronic
1119265350 14:73260840-73260862 GGCCTGGGGGAGGGGAGCAGGGG + Intronic
1119439528 14:74619020-74619042 GGCTGGGGGTGGAGGGGTGGAGG + Intergenic
1119519990 14:75278406-75278428 GGCCGCGGCTGGGGGAGGGGAGG - Intergenic
1119601864 14:75982047-75982069 GGCCTGGGGTGGGGGAGGGAGGG + Intronic
1119608663 14:76043259-76043281 GGCCGGGGCCAGGTGAGTAGAGG + Intronic
1119635410 14:76269352-76269374 GGGCGGAGGTAGGGGTGTGAGGG + Intergenic
1119716686 14:76864425-76864447 GGCGGGGGGAAGGGGGGTGGCGG + Intronic
1119724360 14:76913335-76913357 TCCCCGGGGTGGGGGAGTGGGGG + Intergenic
1119729917 14:76944698-76944720 GGCTGGGGGCAGGGGCGAGGGGG - Intergenic
1119759594 14:77141308-77141330 GACAGGGGCTAGGGGAGTGAGGG + Intronic
1119857992 14:77915329-77915351 GGCTGGGGGTAGGGGGGAGGGGG - Intronic
1120208943 14:81615526-81615548 GGGTGGGGGCAGGGGAGCGGGGG - Intergenic
1120546987 14:85824192-85824214 TGCCTGGGGCTGGGGAGTGGGGG + Intergenic
1120747483 14:88165383-88165405 GGCTGGGGGGAGGGGAGTGCTGG + Intergenic
1120815395 14:88851694-88851716 GGCTGGGGGCAGGGTGGTGGGGG + Intronic
1120987073 14:90343743-90343765 GGCGGTGTGGAGGGGAGTGGGGG + Intergenic
1121328263 14:93034264-93034286 GACAGGGGGTGGGGGAGTGTTGG - Intronic
1121413282 14:93762413-93762435 GGCCTGGGATTGGGGGGTGGGGG - Intronic
1121612724 14:95292665-95292687 GGCTGGTGGTAGGGGAGGGTGGG + Intronic
1121627990 14:95400638-95400660 GGCCGGGTGTGGGGGGGTGGGGG + Intergenic
1121674202 14:95739350-95739372 GGCCAGGGGTAGGGGATGGTGGG - Intergenic
1122081044 14:99268270-99268292 GGCGGTGGGGAGGGGAGAGGGGG - Intronic
1122113517 14:99516833-99516855 GGCCTGGGGTCGGGGAGGGCAGG - Intronic
1122156432 14:99753170-99753192 GGGTGCGGGTAGGGGGGTGGGGG - Intronic
1122314562 14:100818074-100818096 ACCCGGGGGTGGGGGGGTGGGGG + Intergenic
1122328573 14:100897754-100897776 GGGGGGGGGTGGGGGGGTGGGGG + Intergenic
1122378689 14:101286332-101286354 GGCCGAGGGCAGGGGAGTGGCGG + Intergenic
1122444762 14:101760929-101760951 GGCCGAGGGAAGAGGAGGGGAGG + Intergenic
1122444778 14:101760961-101760983 GGTCGAGGGGAGGGGAGGGGAGG + Intergenic
1122444812 14:101761044-101761066 GACGGAGGGGAGGGGAGTGGAGG + Intergenic
1122505126 14:102227283-102227305 ACCTGTGGGTAGGGGAGTGGTGG - Intronic
1122742555 14:103880677-103880699 GGCCCGGGCTAGGAGGGTGGGGG - Intergenic
1122819325 14:104333328-104333350 TGCTGGAGGTAGGGGTGTGGAGG - Intergenic
1122822545 14:104354805-104354827 GGCTGGGGGCAGGGGGCTGGGGG + Intergenic
1122822557 14:104354826-104354848 GGCTGGGGGCAGGGGGCTGGGGG + Intergenic
1122822573 14:104354854-104354876 GGCTGGGGGCAGGGGGCTGGGGG + Intergenic
1122822607 14:104354917-104354939 GGCCGGGGGCAGGGGGCTGGGGG + Intergenic
1122822632 14:104354959-104354981 GGCCGGGGGCAGGGGGCTGGGGG + Intergenic
1122893627 14:104744444-104744466 GGCAGGTGGCAGGGGTGTGGCGG + Intronic
1122957398 14:105077122-105077144 GGCCCGCGGCAGGGCAGTGGAGG + Intergenic
1122959348 14:105087460-105087482 GGCTGGGGGTTGGGGAGGCGCGG - Intergenic
1123020389 14:105395308-105395330 GGCAGGGGCTGGGGAAGTGGGGG - Exonic
1202851477 14_GL000225v1_random:23110-23132 GGCCTGCGGCCGGGGAGTGGTGG - Intergenic
1123587456 15:21772709-21772731 GGTCGGGGAGAGAGGAGTGGGGG + Intergenic
1123624094 15:22215274-22215296 GGTCGGGGAGAGAGGAGTGGGGG + Intergenic
1123781056 15:23628838-23628860 GGGTGGGGGTAGGGGCGGGGAGG + Intronic
1123998498 15:25735005-25735027 GGGGGGGGGTGGGGGGGTGGGGG + Intronic
1124103813 15:26718984-26719006 GGCCTGGTGAAGGGCAGTGGAGG - Intronic
1124452761 15:29811425-29811447 GGGTGGGGGTGGGGGGGTGGTGG + Intronic
1124646511 15:31440965-31440987 GGCTGGGGGTGGGAGGGTGGGGG + Intergenic
1124647000 15:31444285-31444307 GTCGGGGGGTCGGGGGGTGGGGG + Intergenic
1124908110 15:33891377-33891399 GTCAGGGGGTGGGGGACTGGGGG - Intronic
1124949142 15:34300456-34300478 GGCTAGGGGTAGGGGAGTAGGGG - Intronic
1124971974 15:34496565-34496587 GCGGGGGGGTAGGGGTGTGGGGG + Intergenic
1125520828 15:40347020-40347042 CGCAGGAGGCAGGGGAGTGGCGG + Intergenic
1126348411 15:47719149-47719171 TGGCGGGGGTGGGGGTGTGGAGG + Intronic
1126517741 15:49554655-49554677 TGCTGGGGGTTGGGGAGGGGTGG + Intronic
1126821484 15:52508616-52508638 GGCAGGGGGTGGGGGTGAGGCGG - Intronic
1126849268 15:52787627-52787649 GGTGGGGGGTGGGGGAGTGGGGG + Intronic
1126887575 15:53167095-53167117 GGCCTGGGGTCAGGGAGAGGAGG + Intergenic
1127222883 15:56899004-56899026 AGTCGGGGGTAGGGGAGCGGGGG + Intronic
1128128877 15:65212292-65212314 GGCCAGGGGGCCGGGAGTGGGGG - Intergenic
1128311139 15:66632315-66632337 GGCTGGGGGTGGGAGACTGGGGG + Intronic
1128989864 15:72250815-72250837 GGCTGGGGGCTGGGCAGTGGGGG - Intronic
1129068669 15:72932770-72932792 GGCAGGGGGTGGGGGATTTGAGG - Intergenic
1129253320 15:74320396-74320418 GGCCAGGGGTAGGGTTGGGGAGG - Intronic
1129274089 15:74434017-74434039 GGGCGGGGGGAGGGGCGGGGTGG - Exonic
1129674304 15:77624273-77624295 AGCTGGGGGCCGGGGAGTGGGGG - Intronic
1129753759 15:78083551-78083573 GGGCAGGGGTAGGGTGGTGGGGG + Intronic
1130010841 15:80152480-80152502 GGGCGGGGCCAGGGGAGGGGCGG + Intronic
1130010901 15:80152630-80152652 GGGCGGGGCGAGGGGAGGGGCGG + Intronic
1130010928 15:80152699-80152721 GGTCGGGGCAAGGGGAGGGGCGG + Intronic
1130152907 15:81324645-81324667 GGCAGGGGTGCGGGGAGTGGGGG + Intergenic
1130302844 15:82693189-82693211 GGGCGGGGGCGGGGGGGTGGGGG - Intronic
1130720576 15:86382151-86382173 GATGGGGGGCAGGGGAGTGGGGG + Intronic
1130797798 15:87229025-87229047 GGGCTGGGGCAGGGGAATGGCGG + Intergenic
1131020124 15:89090470-89090492 GGTGGGGGGAAGGGGACTGGGGG - Intronic
1131167063 15:90149917-90149939 GGCCGGAGTCAGGGAAGTGGTGG - Intergenic
1131272888 15:90957492-90957514 GGGCGGGGGCAGGTGAGCGGAGG + Exonic
1131396040 15:92087148-92087170 GGGCGGAGGGAGGGGGGTGGTGG - Intronic
1131570101 15:93525941-93525963 GTCAGGGGGTAGGGGAGAGGAGG - Intergenic
1131990490 15:98088628-98088650 GGCCGGGGAGCGGGGAATGGGGG - Intergenic
1132064483 15:98719337-98719359 GGCCAGGGGTAAGGCAGGGGTGG - Intronic
1132273082 15:100544003-100544025 AGCCGGGGGAAAGGGGGTGGTGG + Intronic
1132403146 15:101526218-101526240 GGCTGGGAGTGGGGGAGCGGGGG - Intergenic
1132453674 16:10738-10760 GGCCTGGGGGCGGGGGGTGGGGG + Intergenic
1132522403 16:397654-397676 GGGTGGGGGTGGGGGTGTGGGGG + Intronic
1132522424 16:397692-397714 GGGTGGGGGTGGGGGTGTGGGGG + Intronic
1132600404 16:770406-770428 GGCCTGGAGGAGGGAAGTGGGGG + Intronic
1132607276 16:798834-798856 GGCGGGTGGCAGGTGAGTGGTGG + Intronic
1132652141 16:1026128-1026150 TGGCGGGGGCTGGGGAGTGGTGG + Intergenic
1132682252 16:1147521-1147543 GGCTGGGGGAGGGGGGGTGGGGG - Intergenic
1132697256 16:1207491-1207513 GGTCGAGGGGAGGGGTGTGGGGG + Intronic
1132725054 16:1334794-1334816 GGCCTGGTGAAGGGGAGTCGGGG + Intronic
1132779414 16:1614452-1614474 GGCCGGGGGCGGCGGCGTGGGGG + Intronic
1132843632 16:1990266-1990288 GGCAGGGGGTAGGGGGCAGGGGG - Intronic
1132851246 16:2026001-2026023 GGCTGTGGGCAGGGGAGGGGAGG + Intronic
1132931645 16:2461822-2461844 GGACGGGGGTAGGGGAGAACCGG + Intronic
1133013139 16:2925737-2925759 GGCCGGGGCTGGGGGAGGTGTGG + Intronic
1133026002 16:2989250-2989272 GTCTGGGGCTAGGGCAGTGGAGG - Intergenic
1133032530 16:3018083-3018105 GGCCGGGTGCAGGGTGGTGGCGG - Intronic
1133060392 16:3171058-3171080 GGAGGGGGGTGAGGGAGTGGAGG - Intergenic
1133069367 16:3235521-3235543 GGCGGGGGGTGGGGCGGTGGGGG - Intronic
1133292964 16:4734758-4734780 GGCTGGGGGTGGGTGAGAGGAGG + Intronic
1133448581 16:5884459-5884481 GGGCGGGGGTAGGGGGGTGGTGG - Intergenic
1133786746 16:8979832-8979854 TGGCGGGGGCAGGGGGGTGGTGG - Intergenic
1133918942 16:10134473-10134495 GTCAGGGGGTAGGGGGCTGGGGG + Intronic
1133961791 16:10501206-10501228 GGGAGGGGTTAGGGGAGTGCTGG + Intergenic
1133984109 16:10654931-10654953 GGGGGGGGGTGGGGGAGGGGAGG - Intronic
1134063316 16:11211738-11211760 GTGCAGCGGTAGGGGAGTGGAGG - Intergenic
1134087374 16:11367196-11367218 GGGCGGGGGGAGGGGTGCGGAGG - Intronic
1134088778 16:11378266-11378288 TGCCGGGGGGAGGGGGGAGGTGG + Intronic
1134332802 16:13265553-13265575 GGGTGAAGGTAGGGGAGTGGAGG - Intergenic
1134371892 16:13633604-13633626 GGCCTGTGGTAGGAAAGTGGTGG - Intergenic
1134429866 16:14193411-14193433 GGCCAGGGGCTGGGGAGGGGAGG - Intronic
1134660049 16:15977102-15977124 GGTCGGGGGAGAGGGAGTGGTGG + Intronic
1134690988 16:16190924-16190946 GCTGGGGGGTAGGGGGGTGGCGG + Intronic
1134757984 16:16686084-16686106 GTCGGGGGGTGGGGGACTGGGGG - Intergenic
1134825672 16:17282265-17282287 GCCAGGGGGTAGGGAAGTCGGGG - Intronic
1134916187 16:18072974-18072996 GGCCGGGGGTGAAGGATTGGGGG + Intergenic
1134977979 16:18585930-18585952 GCCCGGGGGTAAGTGGGTGGAGG + Intergenic
1134988087 16:18673096-18673118 GTCGGGGGGTGGGGGACTGGGGG + Intergenic
1135290142 16:21229410-21229432 AGCGGGGGGTGGGGAAGTGGGGG - Intergenic
1135382787 16:22008264-22008286 GTCCGGGGCTCGGGGGGTGGGGG + Exonic
1135751964 16:25065404-25065426 GGGCGGGGGCAGGAGCGTGGGGG + Intergenic
1136111084 16:28063831-28063853 GGGCGGGGGCCTGGGAGTGGAGG + Intergenic
1136174250 16:28506594-28506616 GGCCTGGGGCAGTGGGGTGGTGG - Intronic
1136181315 16:28554277-28554299 GGCCGGGGCTCGGGGAGGGCGGG + Intronic
1136234271 16:28904634-28904656 GGCTGGGGGCAGGGGAGGGCTGG + Exonic
1136336314 16:29613064-29613086 GGCCGGGGGTTGGGAGGTCGTGG - Intergenic
1136418314 16:30116846-30116868 GGCTGGGGGCAGGGGAGCAGGGG - Intronic
1136578061 16:31135769-31135791 GGGCGGGGCCAGGGGAGGGGCGG - Intergenic
1136713402 16:32258295-32258317 GGTGGGGGGGAGGGGAGTGGGGG + Intergenic
1136754509 16:32671136-32671158 GGTGGGGGGGAGGGGAGTGGGGG - Intergenic
1136813604 16:33199229-33199251 GTGGGGGGGGAGGGGAGTGGGGG + Intronic
1136820080 16:33309309-33309331 GTGGGGGGGGAGGGGAGTGGGGG + Intergenic
1136826643 16:33365848-33365870 GGTGGGGGGGAGGGGAGTGGGGG + Intergenic
1136831709 16:33464619-33464641 GGTGGGGGGGAGGGGAGTGGGGG + Intergenic
1136912298 16:34154292-34154314 GGCGGGGGGTAGGGGGTTTGTGG - Intergenic
1136913089 16:34159899-34159921 GGGCGGTGGGAGGGGGGTGGTGG - Intergenic
1137401349 16:48156415-48156437 GGGCAGGGGTAGGGGAGGGCAGG + Intergenic
1137401357 16:48156431-48156453 GGGCAGGGGTAGGGGAGGGCAGG + Intergenic
1137545566 16:49400721-49400743 GGCGTGGGGTAGGGGAGGGTGGG - Intergenic
1137666795 16:50254804-50254826 GGCAGGGGGTGGGGGTGGGGGGG - Intronic
1137693132 16:50442857-50442879 GGGGGGGGGTGGGGGGGTGGGGG + Intergenic
1137785261 16:51133235-51133257 GACCGGGGGTGGGGGTGGGGGGG + Intergenic
1137943144 16:52708616-52708638 GGGTGGGGGGAAGGGAGTGGAGG + Intergenic
1137990629 16:53151200-53151222 GGAGGGGGGGAGGGGAGGGGAGG - Intronic
1138023440 16:53503966-53503988 GGCCGGGGGCTGGGGGGAGGGGG + Intronic
1138449764 16:57086676-57086698 GGCGGGGGGTAGGGGTGGGGTGG + Intergenic
1138453325 16:57106430-57106452 GGGCGGGGGTAGGGTAGTGATGG + Intronic
1138542197 16:57695227-57695249 TGGTGGGGGTGGGGGAGTGGTGG - Intronic
1138660365 16:58512886-58512908 GGACGGGGGAAGGGTTGTGGCGG + Exonic
1138667778 16:58586416-58586438 GGCAGGGAGGAGGGGAGGGGAGG + Intronic
1139285895 16:65813840-65813862 GGGCGGGGGTAGGTCAGTGAGGG - Intergenic
1139361731 16:66403716-66403738 GGAGAGGGGTTGGGGAGTGGTGG - Exonic
1139372733 16:66478964-66478986 GGGCAGGGGAAGGGGAGAGGAGG - Intronic
1139426222 16:66881286-66881308 GGCAGGGGGTGGGGGAGTGAAGG + Intronic
1139432081 16:66916242-66916264 GGCCAGGTGTAGGGGAGAGCAGG - Intronic
1139476257 16:67203929-67203951 GGCAGTGGGTAGAGGAGTGCAGG + Exonic
1139491521 16:67288571-67288593 GGCCCTGGGTAGGGGCCTGGAGG + Exonic
1139551172 16:67673968-67673990 GGCGGGGGGTGGGGGCGGGGGGG - Intergenic
1139576789 16:67847081-67847103 CGCCGGGGGGGGGGGAGGGGAGG - Intronic
1139597415 16:67966571-67966593 GGCAGGGGGTAGGGAGGTGCTGG - Intronic
1139672213 16:68499634-68499656 GGCAGGGGGCAGGGGGCTGGGGG - Intergenic
1140087404 16:71809203-71809225 GTGAGGGGGTAGGGGGGTGGGGG + Intergenic
1140087414 16:71809218-71809240 GGTGGGGGGTAGGGGGGTGGGGG + Intergenic
1140200618 16:72891778-72891800 GGCTGGGGGTTGGGGACAGGTGG - Intronic
1140389734 16:74575003-74575025 GGCCGGGGGGGGGGGGGGGGCGG + Intronic
1140442281 16:74997626-74997648 GGCTGGGGGTGGGGGGGTGGGGG - Intronic
1140455578 16:75103508-75103530 GGCGGGGGGAAGGGGAGTGGTGG + Intronic
1140796808 16:78445880-78445902 GGCGGGGGGCAGGGCAGGGGAGG + Intronic
1140855428 16:78973795-78973817 GGGCAGGGGTTCGGGAGTGGGGG + Intronic
1140870509 16:79102044-79102066 GGCAGGGAGTAGGGGGGAGGGGG + Intronic
1140921868 16:79545739-79545761 AGCCAGGGGATGGGGAGTGGGGG + Intergenic
1141614884 16:85204809-85204831 GGCTGGGTGTGGGGGACTGGGGG - Intergenic
1141828635 16:86497619-86497641 GGCCGGGGGCGGGGGCGGGGCGG - Intergenic
1141900350 16:86986892-86986914 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
1141943415 16:87293781-87293803 GGGCAGGGGCAGAGGAGTGGAGG - Intronic
1141973091 16:87495821-87495843 AGATGGGGGTAGGGGAGGGGTGG - Intergenic
1142098799 16:88260551-88260573 GGCTGGGTTTAGGAGAGTGGAGG + Intergenic
1142161377 16:88559328-88559350 GGCTGGGGGGAGGGGAGGAGAGG + Intergenic
1142185629 16:88693532-88693554 GGCCGGGGGTGGGGAGGGGGTGG - Intergenic
1142205394 16:88780382-88780404 GGGTGGGGGTAGGGGAAGGGGGG + Intronic
1142264841 16:89058874-89058896 GGCCGGCGGCGGGGCAGTGGGGG + Intergenic
1142278923 16:89137703-89137725 GGATGGGGAGAGGGGAGTGGGGG + Intronic
1142315956 16:89345246-89345268 TGCCGGGGGGTGGGGAGGGGGGG - Intronic
1202992180 16_KI270728v1_random:22203-22225 GGTGGGGGGGAGGGGAGTGGGGG + Intergenic
1203056656 16_KI270728v1_random:931467-931489 GGTGGGGGGGAGGGGAGTGGGGG - Intergenic
1203120216 16_KI270728v1_random:1529634-1529656 GGCCGGGGGTGGGGGGGGGGGGG + Intergenic
1142586780 17:979183-979205 GGGCAGGGGTCGGGGGGTGGAGG + Intronic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1142688853 17:1592841-1592863 GGCTGGGGGTTGGGGAGCAGGGG + Intronic
1142708541 17:1710782-1710804 GGACGCGGGGAGGGAAGTGGGGG - Intergenic
1142744210 17:1947698-1947720 GGCAGAGGGTAGGGGAGCTGGGG - Intronic
1142753470 17:2001923-2001945 GCCCTGGGGGAGGGGAGGGGAGG + Intronic
1142811783 17:2399002-2399024 GGGCGGGGGTGGGGGAAGGGGGG - Intronic
1142836850 17:2593848-2593870 GGCCCGGGGAGGGGGAGGGGAGG - Exonic
1143432292 17:6895793-6895815 GTCCTGGGGTTGGGGAGAGGAGG + Intronic
1143434667 17:6914720-6914742 GGGGGGGGGGAGGGGCGTGGTGG - Intronic
1143447251 17:7016809-7016831 GGCAGAGGGGAGGGGAGAGGAGG + Intronic
1143590702 17:7884766-7884788 GGCGGTGGGTGGGGGGGTGGTGG + Intronic
1143598717 17:7930499-7930521 GGCAGGGGGTGGGGGTGCGGGGG + Exonic
1143677695 17:8447979-8448001 GGGCGGGGGGGGGGCAGTGGGGG + Intronic
1143737611 17:8924042-8924064 GGAGGGGGGGAGGGGAGGGGAGG - Intronic
1143807997 17:9445507-9445529 GGGAGGGGGTTGGGGGGTGGGGG + Intronic
1144286852 17:13785369-13785391 GGCCTGGGGCTGGGGGGTGGGGG + Intergenic
1144665443 17:17098964-17098986 AGCAGGGGGTAGTGGGGTGGGGG + Intronic
1144762117 17:17712979-17713001 GGCTGGGGGTGGGGAAATGGGGG + Intronic
1144806181 17:17969421-17969443 GTGCGGGGGTGGGGGATTGGTGG - Intronic
1144851558 17:18246544-18246566 GGCCAGGCGGAGGGGTGTGGTGG - Intronic
1145286578 17:21510865-21510887 GGCCGGGGGAAGGGCAGGAGGGG - Intergenic
1145371340 17:22308800-22308822 GCCCAGGGTTAGGGGAGTTGGGG + Intergenic
1145374577 17:22335612-22335634 GCCCAGGGTTAGGGGAGTTGTGG + Intergenic
1145825354 17:27872926-27872948 GGCTGGGGGTAGGGGTGGGGAGG - Intronic
1145970125 17:28951314-28951336 GGCTGGGGGTATCGGAGGGGGGG + Exonic
1146113184 17:30110585-30110607 GGCTGGGGGTAGGGGAAAGTGGG - Intergenic
1146176364 17:30668372-30668394 GGCCGGGGGGTTGGGAGTGGGGG + Intergenic
1146349824 17:32084486-32084508 GGCCGGGGGGTTGGGAGTGGGGG + Intergenic
1146429057 17:32773531-32773553 GGGCCGGGGTCGGGGGGTGGGGG - Intronic
1146445296 17:32928092-32928114 GGCCGGGGGCCGGGGCGCGGGGG + Exonic
1146554803 17:33814097-33814119 GCCCAGGGGTAGGAGAGTAGTGG + Intronic
1146955062 17:36932660-36932682 GGCATGGGGCAGGGGCGTGGGGG - Intergenic
1147120044 17:38330493-38330515 GAGCTGGGGCAGGGGAGTGGTGG + Exonic
1147178478 17:38671165-38671187 GGGCGGGGGTGGGGGAGTGAGGG + Intergenic
1147183993 17:38704082-38704104 GGCCGGGGGACTGGGGGTGGAGG - Intergenic
1147317484 17:39627709-39627731 GGCTGGGGGTGCGGGGGTGGGGG + Intronic
1147387888 17:40092376-40092398 GGCTGGGGGGAGGGGGGTTGTGG + Intronic
1147392985 17:40121834-40121856 GGCCGGGGGCCGGCGAGGGGAGG - Intergenic
1147507319 17:41032326-41032348 TACCGGGGGTAGGGTGGTGGTGG + Intergenic
1147966269 17:44195937-44195959 GCCCGGGGATAGGGGAATTGAGG - Intronic
1147967275 17:44199977-44199999 GGCGGGGTGTTGGGGAGGGGCGG - Intronic
1147970844 17:44218731-44218753 GGCCGGGGGGAGGCGGGAGGAGG - Intronic
1148018503 17:44538917-44538939 GGGTGGGGGTAGGGGAGGGGAGG - Intergenic
1148048707 17:44759061-44759083 GGGCGGGGGTCGCGGAGAGGTGG - Exonic
1148063805 17:44854237-44854259 GGACTGGGGTGGGGGAGTGCTGG + Intronic
1148193520 17:45697078-45697100 GGAGGGGGGGAGGGGAGGGGAGG + Intergenic
1148330708 17:46812323-46812345 GGGCGGGGGTAGGGGGGTGGAGG - Intronic
1148356566 17:46979291-46979313 GGCCGTTGCTAGGGGAGGGGCGG - Intronic
1148427346 17:47610667-47610689 AGCCGGGGGTCTGGGTGTGGTGG - Intronic
1148506462 17:48131218-48131240 GGCGGGGGATGGAGGAGTGGGGG + Intergenic
1148578789 17:48729080-48729102 GTCCGGGGGGAGGGGAGGCGTGG + Exonic
1148602065 17:48901762-48901784 GGGCGGGGGTGGGGGGGCGGGGG - Intergenic
1148830297 17:50426506-50426528 GGCGGGGGGCGGGGGAGGGGCGG - Intronic
1148857527 17:50586875-50586897 GCCGGAGGGGAGGGGAGTGGAGG + Intronic
1149315181 17:55431958-55431980 GGGAAGGGGAAGGGGAGTGGAGG + Intergenic
1149325969 17:55530241-55530263 GGTCGAGGGTAGGAGAGAGGAGG + Intergenic
1149347353 17:55751609-55751631 GGGCTGGGGTGGGGGAGGGGCGG + Intronic
1149516198 17:57282807-57282829 GGGCTGGGGTTGGGGGGTGGGGG + Intronic
1149993544 17:61395827-61395849 GGGCGGCGGTGGGGGAGTGGGGG - Intergenic
1150096271 17:62378762-62378784 GTTGGGGGGTAGGGGGGTGGGGG + Intronic
1150216959 17:63476552-63476574 TGCCGGGGGTAGGGGTGTGGCGG - Intergenic
1150580584 17:66470287-66470309 GGGTGGGGGTTGGGGAGGGGGGG - Intronic
1150644280 17:66968501-66968523 GGAGGAGGGTAGGGGAGAGGAGG - Intronic
1151104511 17:71596981-71597003 GGCTGGGAGTGGGTGAGTGGAGG - Intergenic
1151116471 17:71740968-71740990 AGCTGGGGGAAGGGGAGAGGGGG - Intergenic
1151155538 17:72121364-72121386 GGCCCGGGGCAGGGGGCTGGTGG - Exonic
1151199061 17:72454399-72454421 GGTTGGGGGTGAGGGAGTGGGGG - Intergenic
1151314063 17:73311238-73311260 GGGCGGGAGTAGGGGAAAGGAGG + Intronic
1151451341 17:74200135-74200157 GGCAGGGGGTCGGGGAGAAGAGG - Intergenic
1151484368 17:74389324-74389346 GGCCTGGGTGAGGGGAGAGGAGG + Intergenic
1151525975 17:74668398-74668420 GGGCGGGGGGGGGGGTGTGGGGG - Intergenic
1151554609 17:74840427-74840449 GGCCGGGGGGGGGGGGGGGGGGG - Intergenic
1151558304 17:74858347-74858369 GGTTGGGGGTCGGGGGGTGGGGG + Intronic
1151558305 17:74858355-74858377 GTCGGGGGGTGGGGGAGTTGAGG + Intronic
1151719558 17:75847534-75847556 GGCCCAGGGTAGGGCGGTGGTGG + Exonic
1151788216 17:76287008-76287030 GGCAGGGGGTGGGGGGGCGGTGG - Intronic
1151843165 17:76632155-76632177 GGCTGGGGGTTGGGAAGTGGAGG - Intronic
1151933508 17:77247626-77247648 CGCCGGGGGTCGGGGTGGGGAGG + Intergenic
1151936399 17:77264485-77264507 GGCGGGAGGTATGGGGGTGGTGG + Intergenic
1152024562 17:77800298-77800320 GGGCGGGGGGTGGGGGGTGGTGG + Intergenic
1152132549 17:78485755-78485777 GGCCTGGGGCAGGGGAGGGAAGG + Exonic
1152185634 17:78854918-78854940 GGGCGGGGGGGGGGGGGTGGGGG + Exonic
1152193839 17:78904580-78904602 GGGCGGGGGTAGGGGGGTGGTGG - Intronic
1152252715 17:79220076-79220098 GGCACGGGGTGGGGGGGTGGGGG + Intronic
1152335197 17:79696697-79696719 GGCCCGGGATGGGGGCGTGGCGG - Intergenic
1152427273 17:80225165-80225187 GGCGGGGGGTTGGGGGGTGGGGG - Intronic
1152473235 17:80501848-80501870 GGCCTGGGGGAGGGCAGCGGGGG - Intergenic
1152636132 17:81431211-81431233 GGCCGAGGGTATGGGAGGGCTGG - Intronic
1152657370 17:81526217-81526239 GGCTGGGCGTTGGGGTGTGGAGG + Intergenic
1152720849 17:81923263-81923285 GGCCGGGGGCGGGGGGGGGGGGG - Intronic
1152728802 17:81960181-81960203 GGTCGGGGGTCGGGGAGCGGCGG - Intronic
1152749557 17:82056400-82056422 CGCCTGGGGTAGGGGTGAGGTGG + Intronic
1152793241 17:82293261-82293283 GGGCGCGGGCAGGGGAGTGGAGG + Intergenic
1152965720 18:112060-112082 GGCGGGGGGTGGGGGTGGGGAGG + Intergenic
1153285394 18:3450981-3451003 GGCTGGGAGTAGGGGGGCGGCGG - Intronic
1153301285 18:3594327-3594349 GGAGGGGGGTGTGGGAGTGGTGG - Intronic
1153688284 18:7567489-7567511 GGGCAGGGGAAGGGGAGAGGCGG + Exonic
1153701805 18:7701847-7701869 GTCAGGGGGTTGGGGAGTAGGGG - Intronic
1153871944 18:9329932-9329954 TGGCGGGGGTGGGGGGGTGGGGG + Intergenic
1154370824 18:13761838-13761860 GGCCGGGGGGAGGGGGGTGTAGG - Exonic
1154501621 18:15000363-15000385 CGGGTGGGGTAGGGGAGTGGGGG + Intergenic
1155215493 18:23639897-23639919 GGCTGGGGGAAGGGGAGTATGGG + Intronic
1155243493 18:23885325-23885347 GGGTGGGGGTGGGGGGGTGGGGG - Intronic
1155506131 18:26535097-26535119 GGCCTGGGGTTGGGGGGTGGGGG + Intronic
1155507912 18:26549475-26549497 GGCCGGTGGGAGGGGAGACGAGG + Intronic
1155509488 18:26562424-26562446 GGTGGGGGGTGGGGGGGTGGGGG + Intronic
1155707656 18:28837127-28837149 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
1156075648 18:33275657-33275679 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
1156149872 18:34228437-34228459 GGGTGGGGGCAGGGGGGTGGAGG - Intergenic
1156938459 18:42738372-42738394 GACCGGGTGTAGGGGGGAGGTGG - Intergenic
1157127518 18:44971014-44971036 GGGTGGGGGAAGGGGAGAGGGGG - Intronic
1157261005 18:46175113-46175135 GGACGGGGGTCGGGGCGGGGGGG - Intronic
1157304421 18:46506879-46506901 GGCTTGGGATAGGGGAGTGTAGG + Intronic
1157363751 18:47044317-47044339 GGCTGGGGGCAGGGGAGATGTGG + Intronic
1157390909 18:47302813-47302835 GGGCGGGGGTAGGGGGTGGGGGG - Intergenic
1157748363 18:50157103-50157125 GGCTGGGGGTGGGGAGGTGGGGG + Intronic
1157846309 18:51007010-51007032 GGCGGGGGGGGGGGGGGTGGCGG - Intronic
1158258983 18:55587717-55587739 GGTTGGGGGGAGCGGAGTGGAGG + Intronic
1158823275 18:61185594-61185616 GGCCAGGGGTGGGAGAGTTGGGG - Intergenic
1159118760 18:64145356-64145378 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1159798189 18:72868064-72868086 GGCCGGGGGGCGGGGAAGGGAGG + Intronic
1159813715 18:73047270-73047292 GGCCGGGGGTCGGGGGGGGGTGG + Intergenic
1159901613 18:74052715-74052737 GACAGGGGTCAGGGGAGTGGTGG - Intergenic
1160519079 18:79494231-79494253 GGCCGGGGGAAGGCGAGAGCGGG + Intronic
1160519111 18:79494327-79494349 GGCCGGGGGAAGGCGAGAGCGGG + Intronic
1160519175 18:79494519-79494541 GGCCGGGGGAAGGCGAGAGCGGG + Intronic
1160519287 18:79494855-79494877 GGCCGGGGGAAGGCGAGAGCGGG + Intronic
1160519318 18:79494951-79494973 GGCCGGGGGAAGGCGAGAGCGGG + Intronic
1160668422 19:344488-344510 GGGCCGGGGTGGGGGAGGGGAGG - Intronic
1160745099 19:707756-707778 GGGTGGGGGCAGGGGGGTGGGGG + Intergenic
1160768718 19:821188-821210 GGCTGGGGGTCGGGGGCTGGGGG - Intronic
1160790666 19:921840-921862 GGCCGGCGGGAGGGGAGGGGGGG - Intergenic
1160791575 19:925959-925981 GTCTGGGGGTGGGGGAGGGGCGG + Intronic
1160897017 19:1407848-1407870 GGCCGGGCGGCGGGGAGCGGCGG - Intronic
1161171316 19:2813730-2813752 GGCGGGGGGTGGGGGAGTAAAGG + Exonic
1161215818 19:3094595-3094617 GGCCGGGGGCCGGGGGGCGGCGG + Exonic
1161221522 19:3120248-3120270 GTCCCTGGGCAGGGGAGTGGCGG + Intronic
1161285232 19:3464932-3464954 GGGTGGGGGTCGTGGAGTGGGGG + Intronic
1161388178 19:4007915-4007937 GACCGGGGGTCGGGGTCTGGGGG - Intronic
1161495481 19:4583909-4583931 GGGTGGGGGTAGGGGTGTGCGGG + Intergenic
1161560209 19:4968983-4969005 GGCCCGGCGGAGGGGAGGGGCGG + Intergenic
1161608827 19:5229687-5229709 GGCGGGCGGGAGGGGAGGGGAGG + Intronic
1161744703 19:6048861-6048883 GGGCGGGGGCCGGGGAGCGGTGG - Intronic
1161821832 19:6534467-6534489 GGCCGGGGGGCGGGGAATGGCGG - Intronic
1161928341 19:7318169-7318191 TGCCAGGGGCTGGGGAGTGGGGG - Intergenic
1162030102 19:7913574-7913596 GGCCAGGTGTGGGTGAGTGGAGG - Exonic
1162050315 19:8028791-8028813 GGCCTGGGGTTGGGGGGTGTGGG + Intronic
1162110580 19:8397692-8397714 GGCCAGGGGAAGGGCAGAGGAGG + Intronic
1162134080 19:8544547-8544569 GGGAGGGGGTGGAGGAGTGGAGG + Intronic
1162288988 19:9764540-9764562 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
1162396459 19:10420451-10420473 GGGCGGGGGGCGGGGAGGGGCGG + Intronic
1162560975 19:11418238-11418260 GGGCGGGGGCGGGGGGGTGGGGG - Intronic
1162578538 19:11513608-11513630 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
1162718231 19:12647200-12647222 GGTCAGGGGTAGGGAAGGGGTGG - Intronic
1162727062 19:12696142-12696164 GGCCGGGGGCCGGGGACCGGGGG - Intronic
1162782721 19:13014862-13014884 GGCTGGTGGTAGGGGGCTGGTGG + Intronic
1162849625 19:13420885-13420907 GGTGGGGGATGGGGGAGTGGTGG - Intronic
1162876822 19:13626676-13626698 GGAAGGGGGGAGGGGAGGGGAGG + Intergenic
1162914175 19:13865458-13865480 GGCCGGGGGCACGGGCGGGGCGG + Intronic
1162952598 19:14080877-14080899 GGGCGGGGGGAGGGGAGGGGAGG + Intergenic
1162954619 19:14091069-14091091 TGCCGGGGGGAGTGGAGAGGGGG + Intergenic
1162982461 19:14248525-14248547 GGCCGGGGGGTTGGGAGTGGGGG - Intergenic
1163243122 19:16076426-16076448 GCCCGGGGGGCGGGGAGAGGCGG + Intronic
1163265015 19:16215197-16215219 GGGCGGGGGGGGGGGAGAGGGGG + Intronic
1163294199 19:16401706-16401728 GGCCTGGGGCAGGGGACTGTCGG - Intronic
1163335959 19:16671820-16671842 GGACCGAGGTTGGGGAGTGGGGG - Intronic
1163463888 19:17455239-17455261 GGATGGGGGTGGGGGGGTGGGGG - Intronic
1163684715 19:18704907-18704929 GGGTGGGGGTTGGGGATTGGGGG - Intronic
1163725869 19:18922756-18922778 GGGCGGTGGGAGGGGAGAGGCGG - Intronic
1163726783 19:18927728-18927750 AGCCGGGGGTGGGGGTGGGGAGG - Intronic
1163729639 19:18941408-18941430 GGGCGGTGGAGGGGGAGTGGGGG + Intergenic
1163831557 19:19549546-19549568 AGACGGGGCTAGGGAAGTGGTGG - Intergenic
1163860660 19:19741074-19741096 GGCCGAGGTGAGGGGTGTGGGGG - Intergenic
1164476445 19:28579373-28579395 GGCTGGGGTTGGGGGAGAGGGGG - Intergenic
1164650403 19:29887141-29887163 GGCGGGTGGGAGGGGAGGGGTGG - Intergenic
1165096951 19:33414583-33414605 GGTCGGGGGTGGGCGGGTGGGGG - Intronic
1165426158 19:35746549-35746571 GGCCAGTGGCAGGGGAGAGGGGG + Intronic
1165430068 19:35767358-35767380 GGCCGGGGGTTCGAGGGTGGAGG - Intronic
1165566804 19:36736683-36736705 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
1165573422 19:36794314-36794336 GCCCAGGGTTAGGGGAGTTGGGG - Intergenic
1165632670 19:37315040-37315062 GCCCGGGGTTAGGGGAGTTGGGG - Intronic
1165742093 19:38210697-38210719 GGCCGGGGGAAGGGAAGGGCTGG - Intergenic
1165786434 19:38464618-38464640 TCCTGGGGGTGGGGGAGTGGAGG - Exonic
1165827983 19:38716484-38716506 TGGCGGGGGCATGGGAGTGGAGG + Intronic
1165832461 19:38736415-38736437 GTCCGGGGGCAGGGGAGGCGTGG - Intronic
1165914149 19:39247713-39247735 GGCCGCGGGGAGGGATGTGGCGG - Intergenic
1166013431 19:39961068-39961090 GGCAGGGAGTGGGGGATTGGGGG - Intergenic
1166020657 19:40025519-40025541 GGGAGTGGGGAGGGGAGTGGGGG + Intergenic
1166301940 19:41915927-41915949 GGCGGGGGGGAGGGGGGTGGGGG - Intronic
1166394373 19:42427929-42427951 GGCCCGGGGGCGGGGGGTGGGGG - Intergenic
1166627998 19:44378186-44378208 GGGCGGGGGGAGGGGGGAGGGGG + Intronic
1166661098 19:44647730-44647752 GGGTGGGGGGAGGTGAGTGGGGG + Intronic
1166678965 19:44756211-44756233 GCCTGGGGGTGGGGGAGTGAAGG - Exonic
1166688561 19:44809857-44809879 GGCCGGGGGCTGGGGGGTGGGGG + Intronic
1166734235 19:45075311-45075333 GCCGGGGGGAGGGGGAGTGGAGG - Intronic
1166750187 19:45160887-45160909 GGACTGGGGGTGGGGAGTGGTGG - Intronic
1166863319 19:45821916-45821938 GGCCTGGGGGAGTGGAGGGGAGG + Intronic
1166888107 19:45973567-45973589 GGGCGGGGGAGGGGGAGGGGAGG + Intergenic
1166914299 19:46184414-46184436 TGTCGGGGGTGGGGGACTGGGGG - Intergenic
1166931420 19:46303790-46303812 GGCCGGGGCTCGTGGAGTGCTGG - Intronic
1166948046 19:46409159-46409181 GGGAGAGGGGAGGGGAGTGGAGG + Intergenic
1166948057 19:46409188-46409210 GGGAGAGGGGAGGGGAGTGGAGG + Intergenic
1166975697 19:46603945-46603967 GGCTGGGGGTGGGGGCGAGGAGG - Intronic
1167157185 19:47745874-47745896 GGTCGGGGGTCGGGGGTTGGGGG + Intronic
1167208615 19:48119089-48119111 GGCAGGGGGGAGAGGGGTGGAGG + Intronic
1167230397 19:48279446-48279468 GGGCGGGGGTGGGGGGATGGGGG + Intronic
1167287010 19:48603910-48603932 AGCTGGGGGTCGGGGAGTAGGGG + Exonic
1167323979 19:48812883-48812905 GGCCTGGGGTTGGGGGGCGGGGG + Intergenic
1167344130 19:48934896-48934918 GGCCAGGGGAAGGGGAGACGTGG - Intronic
1167449022 19:49556285-49556307 TGCTGGGGGAAGGGGAGGGGTGG + Intronic
1167468569 19:49663087-49663109 GGCTGGAGGCAGGGGAGTGGGGG + Intronic
1167562412 19:50233797-50233819 GGTCGGGGGGAGGGGGGAGGGGG - Intronic
1167605818 19:50480863-50480885 GGCTGGGGCAAGGGGAGAGGAGG - Exonic
1167648884 19:50719268-50719290 GGCTGGGGGTACGGGTGAGGTGG - Intronic
1167684817 19:50949786-50949808 GGGTGGGGGTGGGGAAGTGGGGG - Intronic
1167738673 19:51311699-51311721 GGGCGGGGGGAGGGGGCTGGGGG - Intergenic
1168056783 19:53868845-53868867 CGCCGAGGGGAGGGGAGGGGAGG - Intronic
1168076538 19:53983174-53983196 GGGCGGGGGGAGGGGAGGGAGGG + Exonic
1168089327 19:54071745-54071767 GGCCTGGGGTTGGGGGGTGGAGG + Intronic
1168100344 19:54138108-54138130 GGCAGGGGGCAGGCGAGGGGAGG - Intronic
1168105240 19:54162307-54162329 GGCCGGAGTCAGGGGAGTGGCGG + Intronic
1168106082 19:54166462-54166484 GGCCGGGGCCAGGGCAGTGAAGG - Intronic
1168146889 19:54424595-54424617 GGGCGAGGGCAGGGAAGTGGTGG + Intronic
1168251745 19:55145985-55146007 GGCCGGGGGCGGGGGGGCGGTGG - Intronic
1168260008 19:55188005-55188027 GGCCAGGGGGTGGGGGGTGGGGG + Intronic
1168296626 19:55380274-55380296 GGAAGGGGGGAGGGGAGGGGAGG - Intronic
1168309350 19:55452701-55452723 AGCCGGGGGTGGCGGCGTGGGGG + Intergenic
1168312535 19:55468138-55468160 GGGCTGGGATAGGGGAGAGGAGG - Intergenic
1168350700 19:55674223-55674245 GGGCGGGGGTTGGGGGGTTGGGG + Exonic
1168602012 19:57726077-57726099 GGGTGGGGGCGGGGGAGTGGGGG - Intronic
1168721233 19:58556001-58556023 GGCCATGGGTAGGGGTTTGGGGG - Exonic
1202706367 1_KI270713v1_random:27179-27201 GGCAGGGGGTGGGGGTGGGGTGG + Intergenic
925332369 2:3068528-3068550 GGAGGGGGGGAGGGGAGGGGAGG + Intergenic
925418439 2:3690372-3690394 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
925418450 2:3690389-3690411 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
925420212 2:3704508-3704530 GGGAGGGGGGAGGGGCGTGGGGG + Intronic
925420301 2:3704706-3704728 GGGAGGGGGGAGGGGCGTGGGGG + Intronic
925607558 2:5673800-5673822 GGCCGGGGGTGGGGGACAGAGGG + Intergenic
925755388 2:7128080-7128102 GGGAGGGGGAAGGGGAGGGGAGG - Intergenic
925869121 2:8253953-8253975 GGCCTGGGGGTGGGGGGTGGAGG - Intergenic
925918762 2:8625283-8625305 GGCAGGTGGTTGGGGAGGGGAGG + Intergenic
925927638 2:8681784-8681806 GGGCGGGGGGCGGGGAGCGGCGG - Intronic
926096569 2:10084974-10084996 GACCGGGGGGCGGGGGGTGGTGG + Intronic
926109107 2:10170796-10170818 GGCTGGGGGCGGGGGCGTGGGGG - Intronic
926360175 2:12079503-12079525 GGCCGCGGGTAGGGAAGTCAGGG - Intergenic
926451759 2:13012463-13012485 GGTCGGGGGTGGGGGTGCGGAGG + Intergenic
926720540 2:15957147-15957169 GGGTGGGGGTAGGGGGTTGGAGG - Intergenic
926794984 2:16611767-16611789 GGGCGGAGGTGGGGGGGTGGTGG + Intronic
927168726 2:20350832-20350854 GGCGGGGGGGAGGGGAGGGCAGG - Intronic
927232127 2:20834586-20834608 GGAAGGGGGAAGGGGAGGGGAGG - Intergenic
927259147 2:21069501-21069523 GCCATGGGGTAGGGGGGTGGGGG - Intergenic
927503641 2:23598903-23598925 GGCTGGGGGTAGAGCAGTGTGGG + Intronic
927663819 2:25015485-25015507 GGCTTGAGGGAGGGGAGTGGTGG + Intergenic
927698485 2:25252618-25252640 GGCCGGGGGGCCGGGAGGGGAGG + Intronic
927803005 2:26118435-26118457 GGCCGGGGGTGGGGTGGGGGTGG + Intronic
927845898 2:26472843-26472865 GGCCGGTGGGAGGGAGGTGGCGG + Intronic
927921986 2:26979715-26979737 GGCCGTGGGAAGGGGTGTGGTGG + Intronic
928016949 2:27666365-27666387 GGCCGGGGGGCGGGGTGGGGGGG - Intronic
928127310 2:28625653-28625675 GGTCGGGGGAAGGAGACTGGAGG - Intronic
928408895 2:31038556-31038578 GGCCGGGGGAGGGGGAGGGTAGG + Intronic
928858450 2:35827926-35827948 GGCGGGGGTTGGGGGGGTGGGGG + Intergenic
928938344 2:36703342-36703364 GGCTGGGTGTAGGGGGGTGGGGG - Intronic
929215064 2:39403779-39403801 AGCTGGGGTTAGGGGAGGGGTGG - Intronic
929604095 2:43224221-43224243 TGCTGGGGGCACGGGAGTGGGGG - Exonic
929857725 2:45650755-45650777 AGCCGGGGATGGGGGAGTGGAGG - Intergenic
929879081 2:45821047-45821069 AGCCTGGGGTAGGGAGGTGGAGG + Intronic
929941165 2:46335100-46335122 GGATGGGGGTAGGAGAGTGAGGG + Intronic
930639518 2:53840587-53840609 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
930867605 2:56137291-56137313 GGCCTGTTGTAGGGGGGTGGGGG - Intergenic
931348892 2:61470964-61470986 GGACGGGGGGAGGGGAGAGGGGG + Intergenic
931434989 2:62238344-62238366 GGGCGGGGGTGGGGGAGAGGAGG - Intergenic
931438190 2:62267009-62267031 GGACGGGGGTGGGGGGTTGGGGG + Intergenic
931444321 2:62314082-62314104 ACCAGGGTGTAGGGGAGTGGTGG + Intergenic
931572202 2:63680731-63680753 TGCCTGGGGTTGGGGAGAGGTGG - Intronic
931602602 2:64019249-64019271 GGCCGGGGATGTGGGAGAGGCGG - Intergenic
931681219 2:64751205-64751227 GGGCGGGGGCAGTGGAGTGGGGG + Intergenic
931867973 2:66432474-66432496 GGCGTGGGGTGGGGGGGTGGGGG + Intergenic
932183726 2:69673494-69673516 GGTTGGGGGTTGGGGATTGGGGG + Intronic
932215578 2:69963901-69963923 CGCCGGGGGCAGGGGTCTGGTGG + Intergenic
932231860 2:70089582-70089604 AGCCTGGGGAAGGGGTGTGGGGG + Intergenic
932440655 2:71732509-71732531 GGGCGGGGGTAGGGGAGGGAGGG + Intergenic
932480011 2:72033463-72033485 GGCGGGGGGGGGGGGGGTGGTGG - Intergenic
932495921 2:72145695-72145717 GGCGGGGGGTGGGGGCGAGGCGG - Intronic
932496450 2:72147977-72147999 GGCCAAGGGAAAGGGAGTGGAGG + Exonic
932573023 2:72947833-72947855 GGCAGGGTGGAGGGGACTGGGGG - Intronic
932599449 2:73113357-73113379 GCCCGGGGTCAGGGGAGCGGCGG - Intronic
932751626 2:74375003-74375025 GGCTGTGGGTAGGTGGGTGGCGG - Intronic
932764109 2:74459326-74459348 GGATGGGGGTAGGGGGGTTGGGG + Intronic
932773515 2:74514400-74514422 GGCTGGGGGTAGGGCAGGGGCGG - Intronic
932812010 2:74833918-74833940 GGCGGGGGGCGGGGGAGGGGCGG - Intergenic
932858851 2:75267342-75267364 GCCTGGGGTTTGGGGAGTGGTGG + Intergenic
933774829 2:85765686-85765708 GTGCGGGGGTAGGGCAGTGAGGG - Intronic
933783067 2:85815097-85815119 GGCTGCGGGTTGGGGAGGGGAGG - Intergenic
934033038 2:88065207-88065229 GGAGGGGGGGAGGGGAGGGGAGG - Intergenic
934033050 2:88065225-88065247 GGGAGGGGGGAGGGGAGGGGAGG - Intergenic
934033061 2:88065242-88065264 GGAGGGGGGGAGGGGAGGGGAGG - Intergenic
934033073 2:88065260-88065282 GGGGGGGGGGAGGGGAGGGGAGG - Intergenic
934299560 2:91769022-91769044 GGCCTGGGGGAGGGGCGGGGGGG - Intergenic
934555818 2:95286599-95286621 GGCCTGGGGGAGGGGAGACGTGG + Intronic
934777853 2:96950315-96950337 GGCCTTGGGTGGGGGATTGGGGG + Intronic
934978896 2:98824282-98824304 GGTTGGGGGCAGGGGGGTGGGGG - Intronic
935145310 2:100391339-100391361 GTCAGGGGACAGGGGAGTGGGGG + Intergenic
935165052 2:100562964-100562986 GGCTGGGGGAAGAGGCGTGGCGG + Exonic
935196486 2:100819793-100819815 CGCCGGGGCTGGGGGAGGGGGGG - Intergenic
935248298 2:101238493-101238515 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
935248959 2:101244887-101244909 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
935342272 2:102068777-102068799 GGCAGTGGGTAGGGGAGGGAGGG - Intronic
935353877 2:102180004-102180026 GGAGGAGGGGAGGGGAGTGGAGG + Intergenic
935513683 2:104007325-104007347 GGCGGGGAGTGGGGGGGTGGGGG - Intergenic
935971026 2:108531255-108531277 AGCAGGGGGTACGTGAGTGGAGG - Intergenic
936523953 2:113230259-113230281 GGCAGGGGGAAGGGGAGTGCGGG - Intronic
936728135 2:115347627-115347649 GTCAGGGGGTAGGGGACTAGGGG - Intronic
937045794 2:118850803-118850825 GGCCGAAGGTAGGGAAGTGTGGG + Intergenic
937130662 2:119510130-119510152 GTCAGGGGGTAGGGGGCTGGGGG - Intronic
937274537 2:120675394-120675416 CGGCGGGTGCAGGGGAGTGGAGG + Intergenic
937278922 2:120704117-120704139 GGCCGGGGGTGGGGCAGGGCAGG - Intergenic
937283391 2:120735727-120735749 GGGCGGGGGGAGGGGAAAGGGGG - Intronic
937291835 2:120786454-120786476 GGCGGGGGGTTGGAGGGTGGGGG - Intronic
937439836 2:121906322-121906344 GGCGGGGAGTGGGGGAGCGGGGG - Intergenic
937440484 2:121911218-121911240 GGTGGGGGGCAGGGGAGTGAGGG - Intergenic
937552599 2:123112912-123112934 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
937853292 2:126655295-126655317 GGCAGAAGGTAGGGGAGAGGTGG + Intergenic
937955529 2:127420019-127420041 GTCCCGGGGTAGGGGTGGGGTGG - Intronic
937963599 2:127483574-127483596 GGCGGGGGGTGGTGGGGTGGGGG + Intronic
938015457 2:127863495-127863517 GGAATGGGGAAGGGGAGTGGGGG - Exonic
938042849 2:128090440-128090462 GTCGGGGGGTTGGGGGGTGGGGG + Intergenic
938218558 2:129545364-129545386 GGCAGGGAGTTGGGGCGTGGGGG - Intergenic
938329125 2:130436818-130436840 GTGGGGGGCTAGGGGAGTGGGGG - Intergenic
938360820 2:130684675-130684697 GTGGGGGGCTAGGGGAGTGGGGG + Intergenic
938500800 2:131830530-131830552 CGGGTGGGGTAGGGGAGTGGGGG + Intergenic
938538776 2:132268342-132268364 GGCGGGGGGTGGGGGTTTGGGGG + Intergenic
938539773 2:132276189-132276211 GGCTGGGGGTGGGGGTGGGGGGG + Intergenic
938619120 2:133031231-133031253 TGCTGGGGGTAGGGGAGGGATGG - Intronic
938639887 2:133266946-133266968 GGCCCGGCGGAGGGGAGGGGAGG - Intronic
938639967 2:133267284-133267306 GGCTGGGGGTGGGGGCGTGAAGG - Intronic
938783219 2:134603833-134603855 GGGTGGGGGAAGGGGAGGGGAGG + Intronic
938866102 2:135422487-135422509 GGCGGGGGGCAGGGGGGCGGCGG + Intronic
939268938 2:139912833-139912855 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
939528633 2:143328580-143328602 GTCAGGGGGTAGGGGAGTAGGGG + Intronic
939708042 2:145479246-145479268 GCCAGGGGATAGGGGAGGGGTGG + Intergenic
940145675 2:150542498-150542520 GGCGGGGGGCCGGGGAGAGGCGG + Intergenic
940145686 2:150542516-150542538 GGCGGGGGGGCGGGGAGAGGCGG + Intergenic
940145696 2:150542534-150542556 GGCGGGGGGGCGGGGAGAGGCGG + Intergenic
940145706 2:150542552-150542574 GGCGGGGGGGCGGGGAGAGGCGG + Intergenic
940145716 2:150542570-150542592 GGCGGGGGGGCGGGGAGAGGCGG + Intergenic
940145726 2:150542588-150542610 GGCGGGGGGGCGGGGAGAGGCGG + Intergenic
940145736 2:150542606-150542628 GGCGGGGGGGCGGGGAGAGGCGG + Intergenic
940145746 2:150542624-150542646 GGCGGGGGGGCGGGGAGAGGCGG + Intergenic
940145758 2:150542642-150542664 GGCGGGGGGGCGGGGAGGGGCGG + Intergenic
940272780 2:151909565-151909587 TGCTGGGGGTTGGGGAGTGAGGG - Intronic
940954498 2:159712715-159712737 GGCCGCGAGTGGGGGAGGGGAGG + Intronic
941058290 2:160813989-160814011 GGGTGGGGGTGGGGGGGTGGGGG - Intergenic
942178343 2:173355671-173355693 GGCTGGGGGGTGGGGGGTGGGGG - Intronic
942240986 2:173964273-173964295 GGGCGGGGGGAGGGGAGTGGAGG + Intronic
942247816 2:174023896-174023918 GGCCGGGTGGAGAGGAGTGGAGG - Intergenic
942446478 2:176081883-176081905 GGCCGTGGGTATGGGCGAGGGGG + Intronic
942451153 2:176108479-176108501 GGCGGGGGGTGGGGAAGTGGGGG + Intronic
942493190 2:176510556-176510578 GGCCAGGGGAGGGGGATTGGAGG + Intergenic
942807295 2:179946467-179946489 GGGGGGGGGAAGGGGAGGGGAGG + Intronic
943105757 2:183544035-183544057 GGTGGGGGGTGGGGGGGTGGTGG + Intergenic
943232766 2:185276432-185276454 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
943314965 2:186375820-186375842 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
943464892 2:188217522-188217544 GGGAGGGGGGAGGGGAGGGGAGG - Intergenic
943669825 2:190648964-190648986 AGCGCGGGGTGGGGGAGTGGAGG + Intronic
943821186 2:192323653-192323675 GGGATGGGGTTGGGGAGTGGCGG + Intergenic
943908316 2:193529598-193529620 GTCAGGGGGTAGGGGGCTGGGGG - Intergenic
944842225 2:203635281-203635303 GAATGGGGGTCGGGGAGTGGAGG + Intergenic
944916817 2:204369562-204369584 GGCGGGGGTTAGAGGAGTGGAGG - Intergenic
945181896 2:207100590-207100612 GGGCGGGAGTTGGGGAGCGGGGG - Intronic
945198209 2:207257023-207257045 GGCAGGGGGAAGGGGAGAGCAGG + Intergenic
945444020 2:209914549-209914571 GGCTGGGGGATGGGGAGAGGGGG - Intronic
945815778 2:214603395-214603417 GGCAGGTGGCAGGGGAGGGGAGG + Intergenic
945862582 2:215140553-215140575 AGCCGGGGGTGGGGGTGTGGTGG - Intergenic
946029233 2:216691932-216691954 TGGCGGGGGTGGGGGAGAGGAGG + Intronic
946125711 2:217560883-217560905 GGTGGGGGGTGGGGGGGTGGGGG - Intronic
946248471 2:218399990-218400012 CGCGGGGGGGAGGGGAGGGGTGG - Exonic
946304404 2:218847546-218847568 TTCTGGGGATAGGGGAGTGGGGG - Intergenic
946310201 2:218879071-218879093 GGGTGGGGGTGGGGCAGTGGGGG - Intergenic
946409593 2:219509507-219509529 GGGCTGGGGAAGGGGAGCGGGGG - Intergenic
946416430 2:219542231-219542253 GGCGGGGGGTGGGGGGGAGGTGG + Intronic
946420198 2:219560601-219560623 GGCCAGGGTTGGGGGGGTGGGGG + Intronic
946537373 2:220646511-220646533 GGCCTGCTGGAGGGGAGTGGGGG + Intergenic
946750451 2:222890249-222890271 GGGGGTGGGAAGGGGAGTGGAGG + Intronic
946830837 2:223726636-223726658 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
947239945 2:227983827-227983849 AGCCTGGAGTAGGAGAGTGGTGG + Intronic
947516237 2:230807411-230807433 GGCCTGGGGTGGGGGGTTGGGGG - Intronic
947542105 2:230986570-230986592 GGAAGGGGGCAGGGGTGTGGGGG - Intergenic
947701747 2:232240176-232240198 GTCCTGGGGCAGGGGAGAGGAGG - Intronic
947842952 2:233220256-233220278 GGCCAGGGGTGGTGGGGTGGGGG + Intronic
947877964 2:233480351-233480373 GTCCGTGAGTCGGGGAGTGGGGG + Intronic
947885446 2:233566158-233566180 GGAGGGGGGAAGGGGAGCGGAGG + Intronic
948428953 2:237906402-237906424 GGGCGGGGGTAGAGGGGTGCTGG + Intronic
948467351 2:238158824-238158846 GGGCGGGGGAGGGGGAGTGGGGG - Intergenic
948501616 2:238398269-238398291 GGTAGGGGATAGCGGAGTGGGGG + Intronic
948538827 2:238670476-238670498 GGCTGGGGGCAGGGGAATGGGGG - Intergenic
948550056 2:238765262-238765284 GGCCCAGGGTATGGGAGTGAGGG - Intergenic
948607721 2:239146719-239146741 GGCCTGTGGAAGGGGAGAGGAGG - Intronic
948726001 2:239934361-239934383 GGCTGGGGGTGGGGGTGGGGAGG - Intronic
948747450 2:240106901-240106923 GGCCTGGGGTGGGCGAGAGGGGG + Intergenic
948887690 2:240892336-240892358 GGCAGGGGGCAGGGGGGAGGAGG - Intronic
948916228 2:241036094-241036116 GGGTGGGGGTTGGGGAGTAGAGG + Intronic
948938659 2:241184999-241185021 GTCCGGGGGTCGGGGAGGGGTGG + Intergenic
948968637 2:241406153-241406175 AGCCGGGTGTAGGGGCATGGTGG + Intronic
949027186 2:241771844-241771866 GTCCTGGGGGAGGGGAGGGGCGG - Intergenic
949058287 2:241941815-241941837 GGCCGGGCTTAGGGGTGGGGTGG + Intergenic
1168771801 20:420678-420700 GGCTGGGGGATGGGGGGTGGGGG - Intronic
1168838823 20:895548-895570 GGCAGGGGCTGGGGGAGAGGGGG + Intronic
1168878088 20:1185071-1185093 GGGCCGGGGGCGGGGAGTGGCGG - Intronic
1169064394 20:2686171-2686193 GGAGGAGGGTGGGGGAGTGGGGG - Intergenic
1169131520 20:3168342-3168364 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
1169164125 20:3407700-3407722 GGGCGGGGGCGGGGGCGTGGAGG + Intergenic
1169204435 20:3732249-3732271 GGTCTGGGGCAGGGAAGTGGAGG + Intergenic
1169327305 20:4686539-4686561 GGGCGGGGGCAGGGGAGCCGCGG + Intronic
1169345288 20:4823778-4823800 GGCTGGGGGTGGGGAGGTGGGGG + Intergenic
1169348055 20:4844853-4844875 GGGAGGGGGGAGGGGAGGGGGGG + Intergenic
1169559868 20:6787967-6787989 AGCTGGGGGTGGGGTAGTGGGGG + Intergenic
1169832436 20:9839073-9839095 GGCCGGGGGTGGAGGTGAGGGGG + Intergenic
1170160719 20:13307564-13307586 GGACGGGGGCATGGGAGTGCTGG - Intergenic
1170307485 20:14955693-14955715 GGCTGGGGGTGGGGGAGCGCTGG - Intronic
1170326236 20:15157355-15157377 GGCCGGGGGGGGGGGAGGTGGGG - Intronic
1170700065 20:18695591-18695613 GGAAGGGGGGAGGGGAGGGGAGG - Intronic
1171115546 20:22522075-22522097 AGCCCGGGGGCGGGGAGTGGGGG - Intergenic
1171246640 20:23615495-23615517 GTCAGGGGGTGGGGGACTGGGGG - Intergenic
1171460072 20:25293127-25293149 CGGGGGGGGTGGGGGAGTGGGGG + Intronic
1171848215 20:30290601-30290623 GGCCTGGGGGAGGGGAGGCGGGG + Intergenic
1172015510 20:31870493-31870515 GGCCGGGGGTCGGCGGGCGGTGG - Exonic
1172037003 20:32018176-32018198 GGGCGGGGGCGGGGGAGGGGCGG + Intronic
1172037018 20:32018199-32018221 GGGCGGGGGCGGGGGAGGGGCGG + Intronic
1172100939 20:32483658-32483680 GGCGGGGGGGAGGGGAGCGCAGG + Intronic
1172245880 20:33444435-33444457 GGGCGGGGGATGGGGGGTGGGGG + Intergenic
1172409452 20:34710610-34710632 GGCCAGAGGTAGAGGACTGGAGG - Exonic
1172600085 20:36177428-36177450 GGCTGTGGGGAAGGGAGTGGTGG + Intronic
1172637771 20:36421557-36421579 GGCCTGGGGCAGGGCTGTGGAGG + Intronic
1172846934 20:37935219-37935241 GGCTGGGGGTGGGGGGCTGGGGG - Intronic
1172962156 20:38806706-38806728 GGGCCGGGGTGGGGGAGCGGAGG - Intronic
1173182646 20:40816358-40816380 AGCTGGGGGTGAGGGAGTGGGGG - Intergenic
1173200532 20:40951510-40951532 GGGTGGGGGTAGGGGAATGTGGG + Intergenic
1173352471 20:42257638-42257660 GGGCGGGGGGGGGGGGGTGGGGG - Intronic
1173421572 20:42905913-42905935 GTCGGGGGGTAGGGGGCTGGGGG + Intronic
1173429268 20:42971683-42971705 ATCCGTGGGTAGGGGAGTTGGGG - Intronic
1173681773 20:44886694-44886716 GGTCGGGGGGTGGGGAGCGGAGG + Intronic
1173741472 20:45405666-45405688 GGGTGCGGGGAGGGGAGTGGGGG - Intronic
1173839972 20:46150923-46150945 GGGTGGGGGTATGGGAGTGGAGG + Intergenic
1173849268 20:46207536-46207558 GCCCGGGTGGAAGGGAGTGGAGG + Intronic
1173857832 20:46262225-46262247 GGTGGGGGGTGGTGGAGTGGGGG + Intronic
1173867563 20:46322386-46322408 GCCAGGGGGCAGGTGAGTGGAGG - Intergenic
1174022397 20:47541400-47541422 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
1174032210 20:47638822-47638844 GGCAGGGGGGCGGGGGGTGGCGG + Intronic
1174137548 20:48391018-48391040 AGGAGGGGGTAGGGGAGAGGAGG + Intergenic
1174177174 20:48652484-48652506 GGCTGGGAGGAGGGGAGGGGAGG + Intronic
1174467615 20:50730288-50730310 GGAAGGGGGCAGGGGAATGGAGG - Intergenic
1174504623 20:51009324-51009346 GGCAAGGGGGAGGGCAGTGGTGG + Intronic
1174693402 20:52532186-52532208 GTCAGGGGGTAGGGGGTTGGGGG + Intergenic
1174764066 20:53235134-53235156 GGGCGGGGGGGGGGGAATGGGGG + Intronic
1174897992 20:54471032-54471054 GGCTGGGACTAGGGTAGTGGGGG - Intergenic
1175112492 20:56658330-56658352 GGGTGGGGGTTGGGGGGTGGGGG + Intergenic
1175224880 20:57439231-57439253 GTCAGGGGGTAGGAGGGTGGGGG - Intergenic
1175224939 20:57439364-57439386 GGTCGGGGGTGGGAGGGTGGGGG - Intergenic
1175249101 20:57598178-57598200 GGCCGGGGGTGGGGAAAGGGGGG - Intergenic
1175439291 20:58979619-58979641 GGGCGGGGGAAGGGGGGGGGCGG + Intergenic
1175658890 20:60795152-60795174 GGCCGGGTGGAGGTGGGTGGGGG + Intergenic
1175669424 20:60889437-60889459 GTCCGAGGGGAGGGGAGTCGTGG - Intergenic
1175736088 20:61388271-61388293 GGGTGGGGGTAGGGGGGTGTGGG + Intronic
1175816407 20:61885293-61885315 AGCTGGGGGTAAGGGAGTCGAGG - Intronic
1175822192 20:61916187-61916209 GGGGAGGGGTTGGGGAGTGGCGG + Intronic
1175831098 20:61965877-61965899 GGCCGGGGGCAGGGCCGAGGCGG - Intronic
1175889388 20:62309622-62309644 GGCAGGGGGTGGAGGGGTGGGGG + Intronic
1175891633 20:62318357-62318379 GGACGAGGGGAGGGGAGGGGAGG + Intronic
1176018936 20:62952894-62952916 GGCGGGGGTGAGGGGAGGGGGGG + Intronic
1176035401 20:63033889-63033911 GGCTGGGGGTGGGGGTGGGGTGG + Intergenic
1176077383 20:63254565-63254587 GGCCGGGGGTTGCGGGGAGGAGG - Intronic
1176085592 20:63294153-63294175 GTGCGGGGGGAGGGGAGTGCGGG + Intronic
1176127924 20:63484238-63484260 AGGTGGGGGTAGGGGGGTGGGGG - Intergenic
1176848033 21:13891540-13891562 GGCTGGGGGTTGGGGAGGGTTGG - Intergenic
1177348115 21:19900091-19900113 GGCGGGGGGAAGGGGGGCGGTGG - Intergenic
1177667614 21:24181417-24181439 GGTAGAGGGTAGGGGGGTGGGGG - Intergenic
1177770046 21:25504047-25504069 GGCAGGAGGCATGGGAGTGGTGG - Intergenic
1178015881 21:28345755-28345777 GGCCGGGGGTGGGGGTGCGGGGG - Intergenic
1178098022 21:29236412-29236434 GGCTGGGGGTAGGGAACTGGAGG - Intronic
1178319028 21:31590841-31590863 GGCGGGGGGGAGGGGGGGGGTGG + Intergenic
1178434608 21:32547236-32547258 GGCCGGGGGTGGGGTGGGGGAGG - Intergenic
1178448186 21:32664546-32664568 AGCAGGGGGTATGGGACTGGGGG - Intronic
1178480742 21:32977617-32977639 GGGCGGGGGTAGGGTTGTGGGGG - Intergenic
1178621488 21:34180836-34180858 GGGCGGGGGTGGGGGTGGGGAGG + Intergenic
1178809085 21:35864911-35864933 GTCGGGGGGTAGGGGGCTGGGGG - Intronic
1178824684 21:36005063-36005085 GGCCGGGGGAAGGGGTGCGGGGG + Intergenic
1178826736 21:36023805-36023827 AGATGGGGGTAGGGGGGTGGGGG - Intergenic
1178951983 21:36992803-36992825 TGCCAGGGGAGGGGGAGTGGAGG - Intergenic
1178992324 21:37366516-37366538 CGCCCGGGGGAGGGGAGAGGAGG - Intronic
1179150635 21:38805836-38805858 GGCCGAGTGGAGGGGAGGGGAGG - Intronic
1179161856 21:38905718-38905740 GGGGGGGGGTAGGGGAGATGGGG - Intergenic
1179295725 21:40060563-40060585 GGCCCGGGGTGGGGTAGGGGTGG + Intronic
1179437159 21:41369816-41369838 GGCGGGGGGCAGGGGTGCGGCGG - Intronic
1179965447 21:44802107-44802129 GGACGGGGGTTGTGGAGGGGAGG + Intergenic
1180048245 21:45319601-45319623 GGCTGCGGGAAGGGAAGTGGAGG - Intergenic
1180190646 21:46161000-46161022 GGCCCGGGGGAGGGGAAGGGGGG + Intergenic
1180564159 22:16649022-16649044 GGCATGGGGGAGGGGAGGGGAGG + Intergenic
1180876774 22:19178471-19178493 GGCCGTGGGCTGGGGAGTCGTGG - Intronic
1180958246 22:19750753-19750775 GGCTGGGGAGAGGGGAGGGGTGG - Intergenic
1180986658 22:19908229-19908251 GGCCAGGGGTATGGGAGGAGAGG + Intronic
1181035512 22:20168133-20168155 GGCTGGGGGTAGCGGCGTGGGGG - Intergenic
1181079057 22:20401665-20401687 AGCCGGGGGTGTGGGATTGGGGG + Intronic
1181181572 22:21072377-21072399 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1181270951 22:21658104-21658126 GGCCGGGGATGGGGGTGGGGTGG + Intronic
1181280591 22:21717128-21717150 GGCCGGGGCTGGGGGGGCGGGGG + Intronic
1181544212 22:23591922-23591944 GGGCTGGGGGAGGGGTGTGGAGG + Intergenic
1181561094 22:23700972-23700994 GGCGGGGGGTTGGGGAGTCCGGG + Intergenic
1181589793 22:23876976-23876998 GGCTGGGTGTCGTGGAGTGGGGG + Intronic
1181600608 22:23949761-23949783 GGCTGGGGGTAGGTGAGGGTTGG - Intergenic
1181607903 22:23991561-23991583 GGCTGGGGGTAGGTGAGGGATGG + Intergenic
1181635954 22:24174935-24174957 GGCCAGGGGTAGCGGAGTAGGGG + Intronic
1181645790 22:24231330-24231352 GGCCGGGGGTGCGGGGGAGGGGG + Intronic
1181646374 22:24233457-24233479 GGCCTGGGGGGTGGGAGTGGGGG + Intronic
1182030766 22:27157682-27157704 GGCCGGCGGTTGGGGGGTGGGGG - Intergenic
1182103322 22:27672137-27672159 GGGGAGGGGGAGGGGAGTGGGGG + Intergenic
1182152854 22:28042577-28042599 GTCAGGGGGTGGGGGACTGGAGG + Intronic
1182323140 22:29491322-29491344 GGCTGGGGGCAGGGCAGGGGAGG + Exonic
1182459161 22:30471965-30471987 GGCTGGGGCTTGAGGAGTGGTGG + Exonic
1182569371 22:31225118-31225140 GGCTGGGGGTTGGGGGGCGGGGG - Intronic
1182604044 22:31489730-31489752 GGCAGCGGGGAGGGGAGCGGCGG - Intronic
1182664001 22:31944422-31944444 GGCCGGGCGGCGGGGAGCGGCGG - Intronic
1182679828 22:32070215-32070237 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
1182680519 22:32075755-32075777 GGCAGGGGGTAGGGTAGGGAGGG + Intronic
1182737508 22:32541536-32541558 GGCAGGGGCTGGGGGAGTGTGGG - Intronic
1182766069 22:32759640-32759662 GGCTGGGGGTGGGTGAGTGCTGG - Intronic
1183172585 22:36198973-36198995 GGCCAGGAGTAGCGGAGGGGTGG - Intronic
1183173241 22:36203325-36203347 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1183290590 22:36999561-36999583 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
1183301578 22:37061491-37061513 GGCCGGGAGGAGAGGAGGGGGGG - Intronic
1183314366 22:37128862-37128884 GGCCAGGGGTGGGTGAGTGGGGG + Intronic
1183456562 22:37926098-37926120 GGCCTGGGGAGGGGGTGTGGTGG + Intronic
1183543162 22:38441437-38441459 GGCTGGGGGTGGGGGTGAGGTGG + Intronic
1183584748 22:38746430-38746452 GGCAGGTGGCAGGGGAGCGGGGG + Intronic
1183642624 22:39101565-39101587 GGCTGGGGGTTGGGGGTTGGGGG + Intronic
1183642685 22:39101693-39101715 GGCAGGGGGTGGGGGGGTGGCGG + Intronic
1183815151 22:40293621-40293643 GGAGGGGGGTAGGGGAATGGTGG + Intronic
1183821480 22:40349655-40349677 GGCCAGGGGTAGTGGGGTCGAGG - Intronic
1183960764 22:41410565-41410587 GGCAGGGGGTAGGGCAGAGAGGG + Intergenic
1184089381 22:42284196-42284218 GGAGGGGGGCAGGGGAGGGGCGG + Intronic
1184127503 22:42498474-42498496 GGTCGGGGGTAGGTTAGTGAGGG + Intergenic
1184210867 22:43034915-43034937 GGGAGGGGGGAGGGGAGGGGTGG + Intergenic
1184287370 22:43479120-43479142 GGCCGGCGCCAGGGGAGTGGAGG - Intronic
1184593931 22:45503057-45503079 GGCCGGAGGTAGGGGCGTCCCGG + Exonic
1184711040 22:46249754-46249776 AGCGGGGGGTTGGGGAGCGGGGG + Intronic
1184850163 22:47115345-47115367 AGCCGGGGGTGGGGTGGTGGGGG - Intronic
1185037000 22:48484679-48484701 GGGGGAGGGGAGGGGAGTGGGGG - Intergenic
1185305530 22:50113361-50113383 AGCAGGAGGTAGGGGAGTGCTGG + Intronic
1185384744 22:50526545-50526567 GACGGGGTGTAGGGGAGCGGAGG - Intronic
1185388958 22:50548730-50548752 GCCCGGGGGTTGGGGGGTGGTGG + Exonic
949090896 3:27803-27825 TGCCGGGGGTGGGAGGGTGGTGG - Intergenic
949131411 3:506288-506310 CAGCGGGGGTAGGGGGGTGGTGG - Intergenic
949511219 3:4768771-4768793 GCCTGGGGGTGGGGGCGTGGAGG + Intronic
949534706 3:4986873-4986895 GGCAGGAGGCAGGGGAGCGGAGG + Intergenic
949663315 3:6307126-6307148 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
949930804 3:9077107-9077129 GGGAGGGGGTGGGGGACTGGGGG - Intronic
949980692 3:9500319-9500341 GGCCTGGGGTAGGGGCGCTGCGG - Exonic
950035512 3:9882464-9882486 GGCTGGGAGTAGGGGATGGGAGG + Intergenic
950041318 3:9920989-9921011 GGCCGGGGGTAGGGAGGGGCAGG + Intronic
950125087 3:10505773-10505795 GGCACGGGGGAGGAGAGTGGGGG + Intronic
950473915 3:13204014-13204036 GGCGGGGGGAAGGGGAGCTGGGG - Intergenic
950499250 3:13353422-13353444 AGGCTGGGGTGGGGGAGTGGTGG + Intronic
950625733 3:14245341-14245363 GGACGGGGGTGGAGGAGGGGTGG - Intergenic
950732197 3:14970261-14970283 GGCCGGGGGTGGGGGGTGGGGGG + Intronic
950815981 3:15702818-15702840 GGCCAGGGGTGGGGTGGTGGGGG - Intronic
951139753 3:19147061-19147083 GGCCTGGGGGCGGGGAGAGGGGG + Intergenic
951294892 3:20921619-20921641 GGGTGGGGGTAGGTTAGTGGGGG + Intergenic
951542844 3:23798569-23798591 TGCTGGGGGTTGGGGGGTGGCGG + Intergenic
951558605 3:23945178-23945200 GGCGGGAGGGAGGGGAGCGGCGG + Intronic
951640432 3:24829563-24829585 GGCCGGGGGCTGGGGGTTGGGGG + Intergenic
951640608 3:24830496-24830518 GGCGGGGCGGAGGGGTGTGGAGG - Intergenic
951898351 3:27632779-27632801 GCCCGGGGGGCGGGGAGAGGCGG + Intergenic
951982109 3:28576573-28576595 GGAAGGGGGTTGGGGAGCGGAGG - Intergenic
952167236 3:30763505-30763527 GGCGGGGGGTGGGGGTGGGGGGG + Intronic
952608083 3:35173740-35173762 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
952764959 3:36945490-36945512 GGCTGGGGGTCCGGGAGTGAAGG + Intergenic
952767752 3:36969690-36969712 GGGCGGGGGGGGGGGGGTGGAGG + Intergenic
952838914 3:37627951-37627973 GGCTGGGTGTCGGGGAGGGGTGG + Intronic
952970761 3:38649221-38649243 GGCCGGGGGAGGGGGAGCTGCGG - Intronic
953024116 3:39135006-39135028 GGCGGGGGGTATGGGGGTGATGG - Intronic
953329815 3:42043491-42043513 GGCTGGGGGTAGGGGTGGAGGGG - Intronic
953388744 3:42522522-42522544 TGCAGGTGGTAGGGGAGGGGAGG - Intronic
953410497 3:42688089-42688111 GGCTGAGGCTGGGGGAGTGGGGG + Intronic
953464258 3:43105579-43105601 GGTCGGGGGCCGGGGATTGGGGG - Intronic
953552218 3:43912414-43912436 GGGCGGGAGTTGGGGAGTTGGGG - Intergenic
953724865 3:45388944-45388966 GATCTGGGGTAGGGGAGTAGTGG - Intronic
953816517 3:46162880-46162902 GGCTGGGGGTAGGGGGTTGAGGG - Intergenic
953877391 3:46674092-46674114 GGCTGAGAGTAGGGGAGAGGAGG - Intronic
953929500 3:46998905-46998927 GGCTTGGGTGAGGGGAGTGGGGG + Intronic
953934306 3:47026802-47026824 GTCAGGGGGTAGGGGACTAGGGG + Intronic
954333248 3:49901939-49901961 TGGCGGGGGTGGGGGAGGGGAGG + Intronic
954397551 3:50300944-50300966 GGGTGGGGGTGGGGGAGGGGTGG - Intronic
954411867 3:50374360-50374382 GGGGAGGGGAAGGGGAGTGGAGG + Intronic
954424942 3:50438314-50438336 GCCCTGGGGGAGGGGAGAGGTGG - Intronic
954427350 3:50450343-50450365 GGGCGGGGGCAGGGTAGGGGAGG - Intronic
954469171 3:50676709-50676731 TGGCGGGGGTGGGGGCGTGGGGG + Intronic
954632494 3:52055142-52055164 GGCGGGCGGGAGGGGAGGGGAGG - Intronic
955003829 3:54951460-54951482 GCCCGGGGGCAGTGGGGTGGGGG + Intronic
955046706 3:55367856-55367878 CCCGGGGGCTAGGGGAGTGGAGG - Intergenic
955225491 3:57056949-57056971 GGCAGGGGGCAGGGGTGTGTGGG - Intronic
955359943 3:58265029-58265051 AGCTGGGGGTAGGGGAGAAGTGG - Intronic
955361120 3:58275788-58275810 GGCAGGGGGTAGGGGGCTGGGGG - Intronic
955531686 3:59879914-59879936 GGGCGGGGGGGGGGGGGTGGGGG - Intronic
955687809 3:61563051-61563073 GGCCGGGGCTAGGGGAGACACGG - Intronic
955712775 3:61797586-61797608 GGCGGGAGGTGGGGGGGTGGGGG - Intronic
955780895 3:62483314-62483336 GTAGGGGAGTAGGGGAGTGGGGG + Intronic
955996928 3:64687684-64687706 GGCAGGAGGGAGGGGGGTGGGGG - Exonic
956420906 3:69085499-69085521 GGGCGGGGGCAGGGGGGTGGGGG - Intronic
956472347 3:69580339-69580361 GGAAGGAGGTAGGGGAGAGGAGG + Intergenic
956476862 3:69631513-69631535 GTCAGGGGGTAGGGCACTGGGGG - Intergenic
956959535 3:74382517-74382539 GGCTGGTGGTGGGGGAGTTGGGG - Intronic
957031215 3:75244017-75244039 GTGCGGGGGTTGGGGGGTGGTGG - Intergenic
958026672 3:88058452-88058474 GGGCGGGGGCGGGGGAGAGGCGG + Intronic
958136737 3:89503646-89503668 GGAGGGTGGTAGGGGAGAGGAGG + Intergenic
958617492 3:96514599-96514621 AGCTGGGGATAGGGGAGTGGTGG - Intergenic
958833573 3:99117915-99117937 TGTGGGGGGTAGGGGGGTGGGGG - Intergenic
959051369 3:101527917-101527939 GGGCGGGGGTGGGGGGGTGAGGG - Intergenic
959105896 3:102063858-102063880 GGCCGGGGCTAGGAAGGTGGGGG - Intergenic
959261751 3:104090870-104090892 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
959416139 3:106078049-106078071 GGGCAGGGGTAGGGGGTTGGGGG + Intergenic
959591723 3:108089999-108090021 GGGTGGGGGTGGGGGGGTGGAGG + Intronic
959849666 3:111071770-111071792 TGCCGAGGGGAGGGGAGTGGCGG + Exonic
959946085 3:112126659-112126681 AGCCTGGGATAGGGGAGGGGTGG - Intronic
960364049 3:116749163-116749185 GGCAGGGTGCAGAGGAGTGGTGG + Intronic
960628264 3:119702691-119702713 GGCTGGGGGGAGGGGCGGGGAGG + Intergenic
960789023 3:121406162-121406184 GGCAGAGGCTAGGGGAGTAGAGG - Intronic
960796304 3:121492017-121492039 AGGTGGGGGTAGGGGGGTGGTGG - Intronic
960847906 3:122021922-122021944 GGCCGCGGGCAGGGCAGTGGAGG - Intronic
960887275 3:122409009-122409031 GGCGGGGGGTGGGGGAGCGGGGG - Intronic
961000662 3:123371893-123371915 GGCAGGGGAGAGGGGAGTGAGGG + Intronic
961327774 3:126119526-126119548 GCCTGGAGGCAGGGGAGTGGTGG - Intronic
961532481 3:127547853-127547875 GGCGGAGGGGAGGGGAGGGGAGG - Intergenic
961533156 3:127552331-127552353 GGCTGGGGGTGGTGGAGTAGGGG - Intergenic
961538829 3:127586853-127586875 GGCAGGGAGTAGGAGAGTGGGGG + Intronic
961594565 3:128006518-128006540 GGGCGGGGGGAAGGGGGTGGTGG - Intergenic
961666833 3:128497933-128497955 GGGCCGGGGCAGGGGAGGGGCGG - Intergenic
961791868 3:129382121-129382143 GGGAAGGGGTAGGGGAGTGGAGG - Intergenic
961805891 3:129489080-129489102 GGGAAGGGGTAGGGGAGTGGAGG - Intronic
961940951 3:130636921-130636943 GGGAGGGGGAAGGGGAGGGGAGG - Intronic
962072308 3:132044883-132044905 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
962072344 3:132044949-132044971 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
962151865 3:132902268-132902290 GCCTGGGGTTAGGGGAGGGGTGG - Intergenic
962354387 3:134681176-134681198 AGCTGGGGGTCGGGGGGTGGTGG + Intronic
962575573 3:136752294-136752316 CGCCGGGGGTTCGGGAGCGGGGG + Exonic
962580452 3:136793071-136793093 GGCCTGGGGGTGGGGAGTTGGGG - Intergenic
962605633 3:137030650-137030672 GGCCCAGGGTAGCAGAGTGGAGG + Intergenic
962835544 3:139185527-139185549 GGCAGGGGGTGGGGGAGATGGGG + Intronic
962843565 3:139255992-139256014 GGCCGGGAGTAGCTGAGGGGTGG + Intronic
962973308 3:140424869-140424891 GGCCTGTGGTAGGGGAGGGTGGG + Intronic
963112970 3:141701745-141701767 GGCTGGGGCTGTGGGAGTGGGGG + Intergenic
963320914 3:143808006-143808028 GGCCGGGAGTTGGGGAGAGAAGG + Intronic
963429795 3:145185033-145185055 GGGAGGTTGTAGGGGAGTGGTGG + Intergenic
963603289 3:147394960-147394982 GGGCGGGAGAAGGGGACTGGTGG - Intronic
963956076 3:151255442-151255464 GGCCAGGGGGAGGGGGCTGGGGG + Intronic
964002818 3:151796162-151796184 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
964002840 3:151796200-151796222 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
964253636 3:154749792-154749814 GCCTGGGGTTGGGGGAGTGGTGG - Intergenic
964394798 3:156234139-156234161 GGGCTGGGGTTGGGGAGAGGAGG + Intronic
964530968 3:157667427-157667449 GACGGGGGATGGGGGAGTGGAGG + Intronic
964560951 3:157995426-157995448 GTCAGGGGGTAGGGGGCTGGGGG + Intergenic
964749317 3:160039873-160039895 GGCGGGGGTTGGGGGGGTGGGGG - Intergenic
964871613 3:161319269-161319291 GGGCGGGGGAAGTGGGGTGGGGG + Intergenic
965192404 3:165548683-165548705 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
965602646 3:170470201-170470223 AGCCTGGGGGAGGGGAGAGGAGG - Intronic
965622955 3:170658826-170658848 GGCATGGGGAAGGGGAGAGGGGG + Intronic
965673019 3:171166060-171166082 GGCACAGGGTAGGGGAGTGCTGG + Intronic
965911474 3:173782797-173782819 AGCGGGGGGTAGGGGAATGAAGG - Intronic
966029954 3:175333661-175333683 GGCTGTGGGTAGAGGTGTGGTGG + Intronic
966114256 3:176443174-176443196 GGCAGGGGATGGGGGAGTGCAGG - Intergenic
966141804 3:176766216-176766238 GGTAGGGGATAGGGGAGGGGTGG - Intergenic
966168947 3:177055551-177055573 GGGCGGGGGTGGGGGGGTGGGGG + Intronic
966464197 3:180211823-180211845 GGGCAGGGGTAGGGGGGAGGTGG - Intergenic
966753750 3:183348405-183348427 GGTCGGGGGTCGGGTAGGGGGGG + Intronic
966818118 3:183905608-183905630 AGTCGGGGGTGGGCGAGTGGGGG + Intergenic
966874962 3:184316225-184316247 GGCTGTGGGGAGGGGAGTAGGGG + Intronic
966882708 3:184359203-184359225 GGCTGGGAGAAGAGGAGTGGAGG - Intronic
966883602 3:184362729-184362751 TGCCCGGGGGAGGGGGGTGGCGG + Intronic
966914124 3:184575587-184575609 GCCCCGGGGTAGGGGTGAGGGGG + Intronic
967327003 3:188250996-188251018 GGCGGGGGGGAGGGCAGGGGGGG - Intronic
967478632 3:189949342-189949364 GGCAGGGAGTGGGGGAGGGGAGG - Intergenic
967592372 3:191293860-191293882 AGCCGGGGGTGGGGGAGTCGGGG + Intronic
967684943 3:192408456-192408478 GGCCGGGGGGCGGGGCGGGGCGG + Exonic
967719076 3:192796185-192796207 GTCGGGGGGTAGGGGGCTGGGGG + Intergenic
968090934 3:195897816-195897838 GGCGGGGGGTGGGGGGGGGGTGG - Intronic
968150760 3:196335361-196335383 GGGTGGGGGTAGGAGAGGGGAGG + Intronic
968150805 3:196335466-196335488 GGGTGGGGGTAGGAGAGGGGAGG + Intronic
968150820 3:196335501-196335523 GGGTGGGGGTAGGAGAGAGGTGG + Intronic
968473160 4:791175-791197 GGGCGGGGGGCGGGGAGCGGGGG + Intronic
968614817 4:1572656-1572678 GGTCGGGGGAAGGGGGCTGGAGG + Intergenic
968624111 4:1618829-1618851 GGCTGGGGGTCGGGGGCTGGGGG - Intronic
968701833 4:2061176-2061198 GGGCGGAGGTCGGGGAGCGGCGG - Intronic
968703844 4:2069228-2069250 GGCCAGGTGTAGGGGAGCCGAGG - Intergenic
968709976 4:2107538-2107560 GGATTGGGGTTGGGGAGTGGGGG + Intronic
968725043 4:2242824-2242846 GGCCGGGGGGGGGGGGGGGGGGG + Intergenic
968763894 4:2458352-2458374 GGCCCGGGGTAGGGGGGACGTGG - Intronic
969056747 4:4407203-4407225 GGTCGGGGTTGGGGGAGTGGAGG + Intronic
969173586 4:5383145-5383167 AGCCGTGGGTAGGTGAGTGTGGG + Intronic
969454594 4:7294214-7294236 GCCGGGGCGTAGGGGAGAGGAGG + Intronic
969455440 4:7297406-7297428 GGGTGGGGGTGGGGGAGGGGCGG - Intronic
969467427 4:7366094-7366116 TGCCGGGGGGTGGGGGGTGGTGG + Intronic
969476057 4:7422985-7423007 GGTGGGGGGTAGGGGAGGGGTGG - Intronic
969482997 4:7456768-7456790 TGGCAGGGGTAGGGGGGTGGAGG + Intronic
969518540 4:7662226-7662248 GGGTGGGGGTGGGGGAGGGGGGG - Intronic
970392630 4:15631061-15631083 TGGTGGGGGTAGGGGACTGGGGG - Intronic
970572670 4:17398254-17398276 GGCCTGGGATGGGGAAGTGGGGG + Intergenic
970686827 4:18577997-18578019 GGGTGGGGGGAGGGGAGGGGAGG - Intergenic
970804504 4:20015197-20015219 GGCCTCGGGTAGTGGAGAGGTGG - Intergenic
972026320 4:34382565-34382587 GGGTGGGGGTGGGGGAGGGGCGG + Intergenic
972298461 4:37762557-37762579 GAGCGAGGGTTGGGGAGTGGGGG + Intergenic
972390773 4:38610894-38610916 TGACGGGGGTTGGGGGGTGGGGG - Intergenic
972869501 4:43279739-43279761 GTCGAGGGGTAGGGGACTGGCGG + Intergenic
973279790 4:48347321-48347343 AGCCAGGGGTGGGGGAGGGGGGG - Intronic
973327504 4:48878254-48878276 TGCCTGGGGTTGGGGAGAGGTGG + Intergenic
974548959 4:63348638-63348660 GGCTGGGGGGATGGGGGTGGGGG + Intergenic
975047195 4:69820477-69820499 GGTCGGGGGTTGGGGAGTGGTGG - Intronic
975558360 4:75686562-75686584 GGCGGGGGGTGGGGGTGGGGGGG + Intronic
975625081 4:76337860-76337882 GGACTGGGGTAGGGGAGAGCAGG - Intronic
976009606 4:80471568-80471590 GGGCGGGGGTGGGGGTGGGGGGG + Intronic
976188040 4:82462635-82462657 GGCGGGGGTTGGGGGAGGGGGGG - Intergenic
976220965 4:82756653-82756675 GGACGGGGGGAGGGGGGTGGGGG - Intronic
976226181 4:82797464-82797486 GCCCAGGGGAAGGGGAATGGTGG + Intronic
976330951 4:83830440-83830462 GACAGGGGATGGGGGAGTGGTGG + Intergenic
976751681 4:88456384-88456406 GGGTGGGGGTAGGGGTGGGGGGG + Intergenic
976822470 4:89222059-89222081 TGCCAGGGGTAAGGGAGTGGGGG - Intergenic
977173391 4:93790109-93790131 GGCACGGGGTAGGGGTGGGGTGG - Intergenic
977569255 4:98612703-98612725 GGCCAGAGATAGGGGAGCGGGGG - Intronic
977997977 4:103517655-103517677 GGTTGGGGGGAGGGGAGGGGAGG - Intergenic
978285609 4:107073466-107073488 GGTGGGGGGAGGGGGAGTGGTGG - Intronic
978620073 4:110628998-110629020 CGCGGGGGGTGGGGGAGGGGAGG + Intronic
980172462 4:129306193-129306215 GCCTGGGGTTAGGGGAGGGGTGG + Intergenic
980243516 4:130206923-130206945 GGGTGGGGGGAGGGGAGAGGAGG - Intergenic
980476938 4:133330500-133330522 GTCAGGGGGTAGGGGGCTGGGGG - Intergenic
981086535 4:140689645-140689667 GGAGGGGGGAAGGGGAGAGGGGG - Intronic
981560408 4:146042406-146042428 GTCATGGGGTGGGGGAGTGGGGG - Intergenic
981745641 4:148049844-148049866 GGGCGGGGGGCGGGGGGTGGTGG + Intronic
981874939 4:149530790-149530812 GGGGGGGGGTGGGGGGGTGGGGG - Intergenic
982261554 4:153498553-153498575 GGAGGTGGGTAGGGAAGTGGGGG + Intronic
982339774 4:154284917-154284939 GCCTGGGGTTAGGGGAGGGGTGG - Intronic
982437375 4:155394750-155394772 GTCCGGGGGTTGGGGGCTGGGGG - Intergenic
982484553 4:155951895-155951917 GGACGGGAGGAGGGAAGTGGGGG - Intronic
982793983 4:159623864-159623886 GTCAGGGGGTAGGGGGGTAGGGG - Intergenic
982846221 4:160256019-160256041 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
982854647 4:160365267-160365289 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
983236162 4:165181525-165181547 GGCCGGGGGTGGGGTAGAGTGGG + Intronic
983828210 4:172291719-172291741 GGGCAGGGGGAGGGGGGTGGCGG - Intronic
983829241 4:172303834-172303856 GGGCAGGGGCAGGGGAGTGAGGG - Intronic
983940210 4:173529380-173529402 GGCTGGGGGGTGGGGGGTGGGGG - Exonic
983940217 4:173529387-173529409 GCCCGGGGGCTGGGGGGTGGGGG - Exonic
984040507 4:174726843-174726865 GGGCGGGGTTGGGGGAGGGGTGG + Intronic
984289913 4:177781976-177781998 GGCCCAGGGTGGGGGCGTGGCGG + Intronic
984639243 4:182144449-182144471 GGCCGGCGGGCGGGGAGAGGGGG + Intronic
984914303 4:184707360-184707382 TGCAGGGGGCAGGGGAGCGGGGG - Intronic
985478415 5:92345-92367 GCGCGGGGGTAGGGGCGGGGTGG + Intergenic
985478444 5:92398-92420 GCGCGGGGGTAGGGGTGGGGTGG + Intergenic
985714257 5:1446573-1446595 GGGGGCGGGGAGGGGAGTGGTGG - Intergenic
985817207 5:2135746-2135768 GGCCGGGGAGAGGTGGGTGGGGG + Intergenic
985865297 5:2509638-2509660 GGCTTGGGGTAGGGGAGAAGGGG - Intergenic
985896320 5:2751638-2751660 GGCCGGCGGTCGGGGTTTGGGGG + Exonic
986721721 5:10564873-10564895 GGTGGGGAGGAGGGGAGTGGGGG - Intronic
987201943 5:15586255-15586277 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
987334346 5:16885693-16885715 CGGCGGGGGTTGGGGGGTGGTGG + Intronic
987920580 5:24274875-24274897 GGAAGGGGGTAGGGGGCTGGGGG + Intergenic
989103431 5:37840072-37840094 GGTCCGGGGTGGGGGAGGGGAGG + Intergenic
989104561 5:37849399-37849421 GGCCAGGGGAGGAGGAGTGGCGG - Intergenic
989146766 5:38257914-38257936 GGCCTGGAGCGGGGGAGTGGGGG - Intergenic
989164757 5:38423427-38423449 AGGTGGGGGTAGGGGAGGGGAGG - Intronic
990579110 5:57151157-57151179 GCCCGGGGTTGGGGGAGGGGTGG + Intergenic
990879315 5:60521685-60521707 GGGAGGGGGAAGGGGAGAGGAGG + Intronic
991205142 5:64041569-64041591 TGCCAGGGGTAAGGGAGAGGTGG - Intergenic
991261994 5:64677470-64677492 GGGCGGGGGTGGGGGGGCGGGGG - Intergenic
991495521 5:67221978-67222000 GGCCGGGGGTGGGGGATGGCTGG + Intergenic
992233544 5:74685588-74685610 GTCCTGGGGGAGGGGAGAGGCGG + Intronic
992276688 5:75128254-75128276 GGCAGGGGGTGGGGGACTAGGGG + Intronic
992403893 5:76437526-76437548 GGCCTGTGGGAGGGGAGCGGGGG - Intronic
992474492 5:77088489-77088511 GGGCGGGGGTAGAGGAGTTGGGG + Intergenic
992734622 5:79706191-79706213 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
993017509 5:82551714-82551736 GGCCGGGGGTGGGGTGGGGGTGG + Intergenic
993904766 5:93610702-93610724 TGTCGGGGCTAGGGGAGTTGTGG - Intergenic
994185122 5:96807823-96807845 AGCCGCGGGTAGGGGACTGCGGG - Intronic
994314147 5:98312871-98312893 GGCTGGGGATAAGGGAGTGAAGG + Intergenic
994452401 5:99959057-99959079 GTCAGGGGGTGGGGGACTGGTGG - Intergenic
995141006 5:108735037-108735059 GGCCGGGGGAGGGTGGGTGGCGG + Intergenic
995292534 5:110473969-110473991 GGCTGGGGGTGGGGGAGAGTAGG + Intronic
995632542 5:114149544-114149566 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
995700412 5:114929153-114929175 GGCTGGGGGGAGTGGGGTGGGGG - Intergenic
995854352 5:116576355-116576377 GGGAGGGGGTTGGGGAGTGTGGG + Intergenic
995971271 5:117974024-117974046 AGACAAGGGTAGGGGAGTGGTGG - Intergenic
996097213 5:119411627-119411649 GGCGGGGGGTAGGGGGTGGGGGG - Intergenic
996419843 5:123250675-123250697 GTCAGGGGGTAGGGGGCTGGAGG - Intergenic
996496318 5:124161322-124161344 GCCCTGGGGGAGGGGAGTGGTGG + Intergenic
996502808 5:124235729-124235751 GGGCGGGGGAAGGGTGGTGGGGG - Intergenic
997302993 5:132820035-132820057 AGTCGGGGGGAGGGGTGTGGGGG - Intergenic
997362427 5:133303598-133303620 GTCCTGGGGTTAGGGAGTGGTGG - Intronic
997519637 5:134514537-134514559 GGTTGGGGGTAGGGGAGAAGTGG - Intergenic
997628785 5:135350391-135350413 GGCGGGGGTCAGGGGAGTGGGGG + Intronic
997670985 5:135671852-135671874 GGGTGGGGGTGGGGGAGTAGAGG - Intergenic
998131114 5:139651404-139651426 GGGTGGGGGAAGGGGAGGGGAGG + Intronic
998140544 5:139697377-139697399 GGGCGGGGGTGGGTGAATGGGGG - Intergenic
998153258 5:139769274-139769296 GGCGGGGGTTGGGGGAGAGGAGG + Intergenic
998453762 5:142254499-142254521 GGCAGCTGGTTGGGGAGTGGGGG + Intergenic
998459578 5:142299771-142299793 AGCCGTGGGTAAGGGAGTGGAGG + Intergenic
998462519 5:142320327-142320349 TGCTGGGGGTAGGGAGGTGGGGG - Intronic
998521129 5:142801684-142801706 GGCGGGGGCTGGGGGAGGGGTGG - Intronic
999240537 5:150124902-150124924 GGCCGGGGGTAGGGGAGTGGGGG - Intronic
999241614 5:150131241-150131263 GAACGGGGATAGGGCAGTGGGGG - Intronic
999261570 5:150241826-150241848 GGGAGAGGGGAGGGGAGTGGAGG - Intronic
999345516 5:150816101-150816123 TGCCAGGGGTAAGGGAGGGGTGG - Intergenic
999406736 5:151313118-151313140 TGCTGGGGGTGGGGGAGGGGTGG + Intergenic
999432603 5:151536997-151537019 AGCCAGGGGTAAGAGAGTGGGGG - Intronic
999655705 5:153808380-153808402 CGACGGGGGGCGGGGAGTGGGGG + Intronic
999682514 5:154073183-154073205 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
999722999 5:154412622-154412644 GGTTGGTGGTGGGGGAGTGGAGG - Intronic
999782276 5:154858837-154858859 TGTAGGGGGAAGGGGAGTGGGGG + Intronic
999999741 5:157126433-157126455 GGAAGGGGGGAGGGGAGGGGAGG + Intronic
1000021328 5:157321741-157321763 GGGCTGGGGCAGGGGAGAGGTGG + Intronic
1000159983 5:158587620-158587642 TGCTGGGGGTTGGGGAGGGGTGG + Intergenic
1000731429 5:164838776-164838798 GGAGGGGGGAAGGGGAGCGGGGG - Intergenic
1001104795 5:168843979-168844001 GGCCAGGGGTAGGGGGGCGGGGG - Intronic
1001159199 5:169299572-169299594 GGGGTGGGGTAAGGGAGTGGGGG - Intronic
1001266551 5:170278414-170278436 GGCGGGGGGGATGGGAGTGCAGG + Intronic
1001266566 5:170278444-170278466 GGCTGGGGGGATGGGAGTGCAGG + Intronic
1001314021 5:170630025-170630047 GGCCTGGGGTGAGGGGGTGGGGG + Intronic
1001418185 5:171563714-171563736 GGCAGGGGGTGGAGGGGTGGTGG + Intergenic
1001422163 5:171596386-171596408 GGCCGGGGGTGGGGGAGGAGGGG - Intergenic
1001437912 5:171714960-171714982 GGCTGGGGGTGGGAGAGTGCTGG - Intergenic
1001625851 5:173132437-173132459 GGAGGGGGGGAGGGGAGGGGAGG - Intronic
1001712319 5:173788816-173788838 TGCTGGGGGTAGGGGGGTTGAGG + Intergenic
1001824880 5:174736421-174736443 TGCTGGGGGAGGGGGAGTGGAGG - Intergenic
1001852955 5:174985377-174985399 GCCCAAGGGTAGGGGAGTGGAGG - Intergenic
1001864810 5:175094205-175094227 GGGCGGGGGTGGGGGGGTAGGGG - Intergenic
1002045073 5:176536998-176537020 GGCAGGGGGCGGGGGAGGGGGGG + Exonic
1002058237 5:176610604-176610626 GGCCGGGGGCGGGGAAGAGGAGG - Intergenic
1002075550 5:176706187-176706209 GGCTGGGGGAAGGGCAGAGGAGG + Intergenic
1002081571 5:176740614-176740636 GGCTGGGGGTAGGGGCGGAGTGG + Intergenic
1002195062 5:177497008-177497030 GGGGGGGGGGAGGGGAGGGGAGG + Intronic
1002320882 5:178375249-178375271 GGCAGGGGCTGGGGGAGAGGAGG + Intronic
1002428101 5:179187587-179187609 TGCTGGGGGGAGGGGAGGGGAGG - Intronic
1002474113 5:179454282-179454304 GGGCGGGGGCAGGGGTGTGAAGG - Intergenic
1002524251 5:179806691-179806713 GGCCCCGGGTCGGGGAGGGGCGG + Intronic
1002537420 5:179884837-179884859 GCCAGGGGCTGGGGGAGTGGGGG + Intronic
1002553564 5:180016463-180016485 GGCCTGGGACATGGGAGTGGTGG - Intronic
1002632260 5:180590131-180590153 GGCCGGGGGAAGGGGATGGACGG + Exonic
1002662790 5:180802900-180802922 GGCCGGGGGGCGGGGCGCGGCGG - Intronic
1002928127 6:1616813-1616835 GGCCGGGGTTGGGGGAGGGGGGG - Intergenic
1003337882 6:5192257-5192279 GGCCTGGGGTAGGGTGGTGGAGG + Intronic
1003551303 6:7104483-7104505 GGGAGGGGGAAGGGGAGAGGTGG + Intergenic
1003735754 6:8876099-8876121 GGCTGGGGGCAGGGCGGTGGTGG + Intergenic
1004329724 6:14710452-14710474 GGCAGGGGTGGGGGGAGTGGGGG + Intergenic
1004658386 6:17686897-17686919 GGGAGGGGGGCGGGGAGTGGGGG + Intronic
1005511761 6:26517989-26518011 GGTGGGGGGTAGGGGAGTGGGGG + Intergenic
1005715638 6:28544538-28544560 GTAGGGGGGTGGGGGAGTGGAGG + Intergenic
1006000707 6:30962958-30962980 GGGAGGGGGGAGGGGAGGGGAGG + Intergenic
1006153422 6:32001422-32001444 GGCCTGGGGCGGGGCAGTGGAGG + Intronic
1006159730 6:32034159-32034181 GGCCTGGGGCGGGGCAGTGGAGG + Intronic
1006180507 6:32150904-32150926 GTCCTGGGGGAGGTGAGTGGAGG + Exonic
1006188131 6:32191907-32191929 GGCTGGGGAGAGGGGTGTGGAGG + Exonic
1006271742 6:32970864-32970886 GGCCGGGGGGAGGGGAGGAGGGG + Intronic
1006300728 6:33192497-33192519 GGCCGGGGGCGGGGGCGAGGTGG - Exonic
1006305443 6:33215651-33215673 GGTCCCGGGTAGGGGAGTTGGGG - Intergenic
1006414401 6:33894973-33894995 GCCGGGGGGTCGGGGGGTGGGGG - Intergenic
1006475240 6:34248852-34248874 GGCCGGAGGTGGGGGTGTTGGGG + Intronic
1006729425 6:36225246-36225268 GCCTGGGGGTGGGGGAGGGGAGG - Exonic
1006900492 6:37497536-37497558 GGTCGGGGGTCGGGGATCGGGGG + Intronic
1007110496 6:39310855-39310877 GGCCAGGGGGATGGGGGTGGGGG - Intronic
1007371096 6:41427601-41427623 GGCCGGGGGGAGGGGCGAAGGGG - Intergenic
1007496078 6:42261026-42261048 GCGCGGGGATAGGGGAGGGGTGG - Intronic
1007821207 6:44561688-44561710 GGCGGGGGGAAGGGGACGGGAGG + Intergenic
1008019678 6:46561885-46561907 GGCTGGGGTTAGGGGAGTTGGGG + Intronic
1008177741 6:48288975-48288997 TGCTGGGGGTGGGGGAGGGGTGG + Intergenic
1008551218 6:52633134-52633156 GGGTGGGGGGTGGGGAGTGGTGG + Intergenic
1008591640 6:52999279-52999301 GTCGGGGGGTGGGGGAGTGAGGG + Intergenic
1008651145 6:53564203-53564225 GGCCTTGGGTAGGGGCGTTGTGG + Intronic
1008665199 6:53709372-53709394 GGGCGGGGGGAGGGGAGTTGGGG - Intergenic
1009245322 6:61230862-61230884 CGCCTTGGGTAGGGGAGGGGTGG - Intergenic
1010244785 6:73653491-73653513 GGGCGGGGGCGGGGGAGCGGCGG - Intronic
1010251588 6:73713078-73713100 GGCAGCGGGGAGGAGAGTGGGGG - Intronic
1010794576 6:80104598-80104620 GGCCAGGGCAAGGGGAATGGAGG + Intergenic
1010902157 6:81441403-81441425 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1011410244 6:87059759-87059781 GGCGGGGGGAGGGGGAGGGGAGG + Intergenic
1011639949 6:89409399-89409421 GGAAGGGGAAAGGGGAGTGGGGG + Intronic
1011664728 6:89622998-89623020 GGGTTGGGGTGGGGGAGTGGGGG + Intronic
1012029832 6:94044882-94044904 GACTGAGGGTAGGGGAATGGAGG + Intergenic
1012459503 6:99444772-99444794 GTCAGGAGGTAGGGGAGTGAGGG - Intronic
1012528994 6:100211836-100211858 AGCCCTGGGAAGGGGAGTGGAGG - Intergenic
1013117692 6:107115157-107115179 GGCGCGGGGCCGGGGAGTGGGGG + Intronic
1013117737 6:107115364-107115386 GGCCGGGGGTGGGGGCGGAGGGG - Intergenic
1013814662 6:114083423-114083445 GGATGGGAGTGGGGGAGTGGGGG + Intronic
1014405822 6:121049135-121049157 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1015231869 6:130923974-130923996 GGCTGGGGGAGGGGGAGTTGAGG - Intronic
1015402138 6:132798653-132798675 GGCCGGGGGCGGGGCAGGGGTGG + Intergenic
1015568363 6:134596686-134596708 GGCCTGGGGTGGGGGGGTGCAGG - Intergenic
1015683669 6:135835168-135835190 GGCGGGGGGCGGGGGAGTGGTGG + Intergenic
1015843654 6:137496902-137496924 GGGCGGGGGGAGGGGAGGGAAGG + Intergenic
1016185896 6:141197044-141197066 TGCCAGGGGTAGGGGAGGGGTGG + Intergenic
1016469428 6:144360096-144360118 GGAAGGGGGGAGGGGAGGGGAGG - Intronic
1016541358 6:145169904-145169926 GCCAGGGGGTGGGGGAGGGGTGG - Intergenic
1017311482 6:152982478-152982500 GCCCCGGGGTGGGGGAGGGGAGG + Intronic
1017446608 6:154511768-154511790 GGGCGGGGGTGGGGGGTTGGGGG - Intergenic
1017631094 6:156397181-156397203 GGTCGGGGGTGGGGGTGGGGGGG - Intergenic
1017651705 6:156589339-156589361 GGGTGGGGGTGGGGGGGTGGGGG - Intergenic
1017725400 6:157273460-157273482 GGCTGGGGGGAGGGGGTTGGTGG - Intergenic
1017801552 6:157900597-157900619 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1017924865 6:158901891-158901913 TGCCGGGGGTGGGAGAGGGGTGG + Intronic
1018203422 6:161415596-161415618 GGCGGGGGGTCGGGGGGGGGGGG - Intronic
1018240310 6:161767757-161767779 GGCTGGGGGTGGGGGGCTGGGGG + Intronic
1018376788 6:163220206-163220228 GGGCGGGGGTGGGGGAGTGCAGG + Intronic
1018488599 6:164268885-164268907 TGCCAGGGTTTGGGGAGTGGAGG + Intergenic
1018727477 6:166625318-166625340 GGGGGGGGGTGGGGGGGTGGTGG - Intronic
1018791629 6:167153031-167153053 GGCCGGGGAAACGGAAGTGGGGG + Intronic
1018910837 6:168100276-168100298 GGCAGGGGGTGGGGGAGGTGGGG + Intergenic
1019103677 6:169651187-169651209 GGGGGGGAGTGGGGGAGTGGGGG + Intronic
1019381787 7:727689-727711 GGGCGGGGCTTGGGGCGTGGAGG - Intronic
1019472805 7:1230210-1230232 GGGCGGGGGCGGGGGAGGGGCGG + Intergenic
1019472949 7:1230904-1230926 GCCCGGGGGGAGGGCAGAGGAGG - Intergenic
1019693148 7:2428578-2428600 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1019703816 7:2488078-2488100 GGCTGGGGGCGGGGGAGAGGGGG - Intergenic
1020007414 7:4789985-4790007 GGGAGGGGGGAGGGGAGAGGGGG - Intronic
1020274327 7:6615597-6615619 GGCCGGGGGCGGGGGCGCGGGGG - Exonic
1020278729 7:6639164-6639186 TGCTGGGGGTAGGGGGTTGGGGG - Intronic
1020338437 7:7083584-7083606 GTCTGGGGGTAGGGGGGTAGGGG - Intergenic
1021046076 7:15924780-15924802 GGCTGGGGCTAGGGGAGGTGTGG - Intergenic
1021307719 7:19051723-19051745 GTCTTGGGGTGGGGGAGTGGCGG + Intronic
1021639198 7:22721781-22721803 AGACGGGGGTCGGGGAGAGGTGG - Intergenic
1021717152 7:23470539-23470561 GGCAGGAGGGAGGGGAGAGGAGG + Intergenic
1022091993 7:27113889-27113911 GGCAGGGGGCGGGGGTGTGGGGG - Intronic
1022114471 7:27250088-27250110 GGCCGGGGTTGGGGATGTGGGGG - Intergenic
1022230492 7:28408950-28408972 GGATGGGGGTAGGGGAGAGGTGG - Intronic
1022626818 7:32045187-32045209 GGGTGGGGGAAGGGGAGTGATGG - Intronic
1022988814 7:35686805-35686827 GGCTGGGGGGGGGGGGGTGGGGG + Intronic
1022988820 7:35686813-35686835 GGGGGGGGGTGGGGGGGTGGGGG + Intronic
1023152365 7:37214134-37214156 GGCAGGGGTGAGGGGATTGGGGG - Intronic
1023197954 7:37663096-37663118 GGCAGGGGCTCGGGAAGTGGGGG - Intergenic
1023872079 7:44268691-44268713 GGGATGGGGTAGGGGAGTGGGGG + Intronic
1023976886 7:45037150-45037172 GGCGGGGGGTGGGGGTCTGGGGG - Intronic
1024207958 7:47179881-47179903 GGACTGGGGTGGGGGTGTGGAGG - Intergenic
1024261743 7:47578549-47578571 GGCAGGGGGTTGGGGGGGGGCGG + Intronic
1024414909 7:49095740-49095762 GCCCAGGGGTAGAGGAGCGGTGG - Intergenic
1024548587 7:50541950-50541972 TGCCAGGGCTTGGGGAGTGGTGG + Intronic
1024656410 7:51454544-51454566 GGCAAGGGCTGGGGGAGTGGGGG - Intergenic
1024971917 7:55078876-55078898 GGCCGGAGACAGGGGAGTGGGGG - Intronic
1025104756 7:56161935-56161957 GGAGGGGGGTAGGGAAGTGCTGG + Intergenic
1025210634 7:57018023-57018045 GGCAGGGGGTGAGGGGGTGGGGG - Intergenic
1025296645 7:57780500-57780522 GCCCAGGGTTAGGGGAGTTGGGG + Intergenic
1025297425 7:57787109-57787131 GCCCAGGGTTAGGGGAGTTGGGG + Intergenic
1025661322 7:63558824-63558846 GGCAGGGGGTGAGGGGGTGGGGG + Intergenic
1025735622 7:64144135-64144157 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1025835280 7:65087288-65087310 GGCAGGGGGTTGGGGAGGGGAGG + Intergenic
1025905056 7:65776761-65776783 GGCAGGGGGTTGGGGAGGGGAGG + Intergenic
1025992469 7:66506238-66506260 GGCCGGGGGCCGGTGGGTGGCGG - Intergenic
1026360432 7:69598049-69598071 GGGCGGGGGCGGGGGCGTGGAGG - Intergenic
1026641487 7:72130054-72130076 GGTGGGGGGTGGGGGAGTGTTGG - Intronic
1026736823 7:72954344-72954366 GGCCAAGGGTAGGGGCGGGGCGG - Intergenic
1026839286 7:73660234-73660256 GGACGGAGGGAGGGGAGGGGAGG - Intergenic
1026968396 7:74454219-74454241 GGGCGGGGGTGGGGGAGAAGGGG - Intronic
1026968466 7:74454360-74454382 GCCCGGGGGGAGGGGAGGGACGG + Intronic
1027106911 7:75410719-75410741 GGCCAAGGGTAGGGGCGGGGCGG + Intronic
1027171905 7:75878858-75878880 GGACGGGGGGAGGGGGGTCGGGG - Intronic
1027241194 7:76330360-76330382 GGCTGGGGGAAGGGGGCTGGAGG + Intronic
1027374522 7:77537133-77537155 GGCGGGGGGTGGGGGGGAGGAGG + Intergenic
1028086858 7:86645989-86646011 GGGTGGGGGTGGGGGGGTGGGGG + Intronic
1028148106 7:87341239-87341261 GGGCGGGAGTGGAGGAGTGGGGG - Intergenic
1028181760 7:87732717-87732739 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1028288437 7:89034395-89034417 GGCGGGGGGTAGGGGGCTAGGGG - Intronic
1028306901 7:89277488-89277510 GGGTGGGGGTAGGGGGGAGGGGG - Intronic
1028707751 7:93870054-93870076 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1028736743 7:94221821-94221843 GTCAGGGGGTAGGGGGCTGGGGG + Intergenic
1028744372 7:94310518-94310540 TGCAGGGGGTCGGGGGGTGGCGG - Intergenic
1028977971 7:96935066-96935088 GGGCGGGGGTGGGGTGGTGGGGG - Intergenic
1029110406 7:98210965-98210987 GGACGGGAGTAGGGGAGGTGGGG + Intergenic
1029464809 7:100718833-100718855 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1029614226 7:101646101-101646123 GGTGGGGGGTAGGGGAGAGCTGG - Intergenic
1029632343 7:101760820-101760842 GGCGAGGGGTGGGGGACTGGTGG + Intergenic
1029938167 7:104450569-104450591 GACAGGGGGTGGGGGACTGGGGG + Intronic
1030330831 7:108268610-108268632 GGGCGGGGGTGGGGGTGGGGGGG + Intronic
1030462965 7:109863488-109863510 GTCAGGGGGTAGGGGGCTGGGGG + Intergenic
1030891782 7:115007796-115007818 GGGAGGGGGTCGGGGGGTGGGGG - Intronic
1031494681 7:122431921-122431943 GGGCGGGGGTGGGGGTGGGGAGG + Intronic
1031966385 7:128031041-128031063 GGCAGAGGGGAGGGGAGGGGAGG + Exonic
1032181028 7:129677984-129678006 GGCCGGGGGAAGGGGGGAGGGGG + Intronic
1032274581 7:130442951-130442973 GGCCGGCGGGTGGGGAGCGGGGG + Intergenic
1032587817 7:133163830-133163852 GGCAGGGGTGAGGGGATTGGGGG + Intergenic
1032593684 7:133217578-133217600 GGCAGGAAGTAGGGGAGTGACGG - Intergenic
1032761136 7:134943284-134943306 GGACGGGGGTAGGGTGGTGGGGG + Intronic
1032824636 7:135557245-135557267 GGGCGGGGGGTGGGGAGGGGAGG + Intergenic
1032851785 7:135801648-135801670 GGCGGGGGTTAGGGGAGAGGCGG - Intergenic
1032880275 7:136083015-136083037 GGAGGGGGGGAGGGGAGGGGAGG - Intergenic
1033242269 7:139690060-139690082 GGGCGGGGGTGGGGGAGTGCGGG + Intronic
1033313780 7:140281415-140281437 GGACTGGGGGAGGGGAGGGGAGG + Intergenic
1033319119 7:140323778-140323800 GCCAGGGGTTAGGGGCGTGGAGG + Intronic
1033354913 7:140591930-140591952 GGGAGGGGGGAGGGGAGGGGAGG - Intronic
1033705480 7:143882131-143882153 GGGAGGGGGCTGGGGAGTGGGGG + Intronic
1033707745 7:143905233-143905255 GGAAAGGGGTGGGGGAGTGGTGG - Intergenic
1034408381 7:150921833-150921855 GGCTGGGGGAAGTGGAGGGGAGG + Intergenic
1034433329 7:151051570-151051592 GGCGGGGGGCGGGGGAGGGGAGG + Intronic
1034451215 7:151138278-151138300 GCCTGGGGGCAGGGAAGTGGTGG - Exonic
1034706283 7:153148065-153148087 AGCCTGGGGTAGAGGAGTTGAGG + Intergenic
1034776116 7:153828238-153828260 ACCCAGGGGTAGGGCAGTGGAGG + Intergenic
1034934488 7:155190023-155190045 GGGTAGGGGTAGGGGCGTGGGGG + Intergenic
1035264683 7:157684583-157684605 GGCGGAGGGGAGGGGAGGGGAGG - Intronic
1035264693 7:157684598-157684620 GGCCGGAGGGAGGGGGGCGGAGG - Intronic
1035337204 7:158137619-158137641 GGCAGGGTGCAGGGGAGTAGTGG - Intronic
1035550430 8:519570-519592 GGCTGAGGGTGGGGGAGAGGGGG - Intronic
1035600633 8:894909-894931 GGGTGGGGGGAGTGGAGTGGCGG + Intergenic
1035670999 8:1417077-1417099 GGGCGGGGGTGGGGGGATGGGGG + Intergenic
1035819747 8:2578790-2578812 GACATGGGGTAGGGAAGTGGAGG - Intergenic
1036392543 8:8336882-8336904 GGGTGTGGGGAGGGGAGTGGGGG - Intronic
1036495769 8:9268591-9268613 GGAGGGGGGGAGGGGAGGGGTGG + Intergenic
1036664670 8:10730701-10730723 GGCCGGGGGCAGGCGCGGGGAGG - Intronic
1037288764 8:17328564-17328586 TGGCGGGGGTGGGGGAGTGGAGG + Intronic
1037390467 8:18387067-18387089 GGCCTGGGGTGGGGGAAGGGGGG + Intergenic
1037693157 8:21200520-21200542 GACCGGTGGAAGGGGAGTGAGGG + Intergenic
1038011874 8:23482256-23482278 CGCCCTGGGTAGAGGAGTGGGGG - Intergenic
1038484747 8:27926443-27926465 GTCAGGGGGTGGGGGACTGGGGG + Intronic
1038627256 8:29206135-29206157 GGCTGGGGATAGGGGCATGGTGG + Intronic
1038893222 8:31751283-31751305 GTCAGAGGGTAGGGGAGTGAAGG + Intronic
1040511645 8:48101001-48101023 TGCCAGGGGTTGGGGAGGGGTGG + Intergenic
1040688819 8:49910281-49910303 GGACGGGGGTCCGGGAGGGGCGG - Intronic
1040858027 8:51970372-51970394 GGCAGGGGGTAAGGGACAGGGGG - Intergenic
1041066805 8:54090562-54090584 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
1041100535 8:54392436-54392458 GCCAGGGGACAGGGGAGTGGGGG - Intergenic
1041166899 8:55101112-55101134 GGCCCGCGGGCGGGGAGTGGCGG - Intergenic
1041222212 8:55663344-55663366 GTCAGGGGGTAGGGGGTTGGGGG - Intergenic
1041296344 8:56361228-56361250 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1041551437 8:59106187-59106209 GGCCTGGGGTGGGGGAGGGAAGG - Intronic
1041744898 8:61197938-61197960 TGCTGGGGATAGGGGAGGGGTGG + Intronic
1042115117 8:65422858-65422880 GGCCCGGGGAATGGGAGTGGGGG - Intergenic
1042217026 8:66437540-66437562 GGCCTGGGGGAGGGGGGTGGGGG - Intronic
1042465815 8:69129411-69129433 GGCAGGGGGGCGGGGAGAGGCGG + Intergenic
1042564578 8:70099087-70099109 GGGAGGGGGGAGGGGAGAGGAGG + Intergenic
1042636841 8:70886035-70886057 GTGCGGGGGTAGGGGACTAGGGG - Intergenic
1043577548 8:81675243-81675265 TGGCGGGGGTGGGGGGGTGGTGG - Intronic
1043598097 8:81907180-81907202 TGTCGGGGGTAGGGGGCTGGGGG + Intergenic
1043960678 8:86414884-86414906 GGGCGGGGGTGGGGGGATGGGGG - Intronic
1044591296 8:93916808-93916830 GGCCGGGGGTGGGGCGGGGGCGG - Intronic
1044932029 8:97260149-97260171 GGGAGGGGGAAGGGGAGGGGAGG + Intergenic
1044954131 8:97462215-97462237 GGCTGAGGGTTGGGGTGTGGTGG - Intergenic
1045287576 8:100805254-100805276 GGCAGGGGGTGGGGGAGTGGTGG - Intergenic
1045295997 8:100872142-100872164 GGGTGGGGGTTGGGGAGGGGAGG - Intergenic
1045305363 8:100952565-100952587 GGCCGGGCCTCGGGGAGGGGTGG - Intronic
1045842843 8:106599825-106599847 GACCTGGGGTAGGGGTGTTGGGG + Intronic
1046254802 8:111681943-111681965 GTGGGGGGGTAGGGTAGTGGGGG - Intergenic
1046846526 8:118922290-118922312 GGGAGGGGGGCGGGGAGTGGTGG - Intergenic
1046962378 8:120124970-120124992 GGGCGGGGATGGGGGAGAGGAGG + Intronic
1047353697 8:124100128-124100150 GGCAGGGAGGAGGGGAGTGAAGG - Intronic
1047451159 8:124966252-124966274 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1047474470 8:125213541-125213563 GGAAAGGGGGAGGGGAGTGGAGG - Intronic
1047588116 8:126296805-126296827 GGCTGGGAATGGGGGAGTGGTGG - Intergenic
1047666518 8:127097487-127097509 GGCATGGGGTGGGGGAGTGACGG - Intergenic
1047962998 8:130024504-130024526 GGGTGGGGGTTGGGGGGTGGGGG - Intergenic
1048339835 8:133529910-133529932 GGCAGGGGGCTGGGGAGTGCTGG - Intronic
1048456694 8:134584785-134584807 GGCCGGGGGAAGGGGAAAGAGGG + Intronic
1048461306 8:134623778-134623800 GGCTGGGGGTAGAGGAGGGCAGG - Intronic
1048533195 8:135269480-135269502 GGCGGGGGGGCGGGGAATGGGGG - Intergenic
1048551105 8:135434079-135434101 GGCAGGGGGTGCGGGGGTGGGGG + Intergenic
1048881676 8:138877105-138877127 GGCTGGGGGTGGGGGAGGGGAGG - Intronic
1049103604 8:140597469-140597491 GGGCGGGGGGGGGGGGGTGGGGG - Intronic
1049135420 8:140893620-140893642 GGCTGGGGGTAGGGCAGAGTTGG + Intronic
1049194061 8:141306008-141306030 GGAGGGGGGTGGGGGAGGGGCGG - Intronic
1049423483 8:142526966-142526988 GCCTTGTGGTAGGGGAGTGGGGG - Intronic
1049440477 8:142607270-142607292 GGTGGCGGGGAGGGGAGTGGAGG + Intergenic
1049440510 8:142607337-142607359 GGCAGGGGGGAGGGGAGGGGAGG + Intergenic
1049452606 8:142670130-142670152 GGCCTGGAGGAGAGGAGTGGGGG + Intronic
1049578816 8:143401571-143401593 GGCAGAGGGGAGGGGAGGGGAGG + Intergenic
1049578830 8:143401598-143401620 GGCAGAGGGGAGGGGAGGGGAGG + Intergenic
1049610526 8:143552920-143552942 GGGCAGGGGTAGGGGAGTGGGGG + Intergenic
1049610546 8:143552955-143552977 GGGTGGGGGTAGGGGAGGGGAGG + Intergenic
1049615361 8:143573508-143573530 GGCCGGAGGAAGGGGTGGGGCGG - Intergenic
1049664594 8:143837332-143837354 GGCCGGGGCGAGGGGAGGGGAGG + Intronic
1049671107 8:143870274-143870296 GGCCGTGCGCAGGGGTGTGGTGG - Exonic
1049706941 8:144047410-144047432 GGCCGGGGCTGGGTGAGGGGCGG + Intergenic
1049734952 8:144199861-144199883 GGCTGGGGGCAGGGTTGTGGTGG + Intronic
1049756285 8:144312572-144312594 GGCAGGGGCTGGGGGTGTGGAGG - Intronic
1049760273 8:144329046-144329068 CACCGGGGGTGGGGGCGTGGCGG + Intergenic
1049761110 8:144332384-144332406 TGCCTGGGGTACGGGGGTGGGGG + Exonic
1050161466 9:2724021-2724043 TGCCGGGGGTTGGGGGGTGGAGG + Intronic
1050309646 9:4339842-4339864 GGGAGGGGGTAGGGGAGGGGTGG + Intronic
1050472536 9:6008024-6008046 GCCGGGGGGGAGGGGAGAGGAGG - Intergenic
1051216470 9:14803319-14803341 GGAGGAGGGTAGGGGAGGGGAGG - Intronic
1051302818 9:15671503-15671525 GGCAGGGGGTGGGGGGCTGGGGG - Intronic
1051619433 9:19036101-19036123 GGCGGGGGGTAGGGGGCTGGGGG + Intronic
1051629551 9:19128890-19128912 GGGCCGGGGGGGGGGAGTGGGGG - Intronic
1051698636 9:19795266-19795288 GGCCGGGGGTGGGGGTGGTGGGG - Intergenic
1051724826 9:20078313-20078335 GGTTGGGGGTTGGGGAGTGGGGG - Intergenic
1051893989 9:21969806-21969828 GGCGGGGGGGAGGGGAGGAGGGG + Intronic
1051894607 9:21974746-21974768 GGCCCGGGGTCGGGTAGAGGAGG - Exonic
1052265105 9:26562982-26563004 GGCCGGGGGTGGGGGGGGGGGGG + Intergenic
1052531205 9:29686340-29686362 GGCAGGGAGTGGGGGAGAGGGGG + Intergenic
1052659266 9:31407235-31407257 GGCGGGGGGTGGGGGGGGGGCGG - Intergenic
1053560460 9:39188459-39188481 GGGAGGGGGTCTGGGAGTGGTGG - Intronic
1053796186 9:41728926-41728948 GCCCAGGGTTAGGGGAGTTGGGG - Intergenic
1053824563 9:42008701-42008723 GGGAGGGGGTCTGGGAGTGGTGG - Intronic
1054136658 9:61430496-61430518 GGGAGGGGGTCTGGGAGTGGTGG + Intergenic
1054148995 9:61585945-61585967 GCCCAGGGTTAGGGGAGTTGGGG + Intergenic
1054175064 9:61869197-61869219 GGCCTGGGGGAGGGGAGGCGGGG + Intergenic
1054184591 9:61940996-61941018 GCCCAGGGTTAGGGGAGTTGGGG - Intergenic
1054468761 9:65517055-65517077 GCCCAGGGTTAGGGGAGTTGGGG + Intergenic
1054606008 9:67178662-67178684 GGGAGGGGGTCTGGGAGTGGTGG + Intergenic
1054653916 9:67647501-67647523 GCCCAGGGTTAGGGGAGTTGGGG + Intergenic
1054662473 9:67711596-67711618 GGCCTGGGGGAGGGGAGGCGGGG - Intergenic
1055577534 9:77675007-77675029 GGCGGGGGGTAGGGGAGGATGGG + Intergenic
1055689643 9:78815929-78815951 GGGGGGGGGTGGGGGGGTGGGGG - Intergenic
1056102434 9:83312737-83312759 GGGCGGCGGAGGGGGAGTGGTGG - Intronic
1056273257 9:84967815-84967837 GCCCGGGGTTAAGGGCGTGGAGG + Intronic
1056710900 9:88991343-88991365 GGGCGGGGGACGGGGAGAGGGGG + Intronic
1056765763 9:89443574-89443596 TGCCTGGGGTAGGCGGGTGGCGG + Intronic
1057081952 9:92179860-92179882 GGCCTGGGCTGGGGGAGTGGAGG + Intergenic
1057117441 9:92539338-92539360 GGTGGGGGGTGGGGGAGCGGGGG - Intronic
1057290681 9:93804890-93804912 GTCAGGGGGTAGGGGGGTAGGGG + Intergenic
1057767442 9:97934448-97934470 GGGAGGGGGGAGGGGAGGGGAGG + Intronic
1057771274 9:97970289-97970311 GGCCGGGGGTGGGGTGGTGGGGG - Intergenic
1057804075 9:98208350-98208372 GGACTGGGGTAGGGGAGGGGTGG + Intronic
1057927623 9:99167250-99167272 GGCCAGTGGGAGGTGAGTGGAGG + Intergenic
1058079699 9:100689026-100689048 AGCAGGGGGTATGTGAGTGGAGG - Intergenic
1058746541 9:107997165-107997187 GGCGGGGGGCGGGGGGGTGGGGG - Intergenic
1058800485 9:108540409-108540431 TGCTGGGGGTAGGGTGGTGGTGG + Intergenic
1059114893 9:111592445-111592467 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
1059162018 9:112043461-112043483 GGTAGGGGGTAGGGGATGGGGGG - Intronic
1059230677 9:112718306-112718328 GGCCCGGGGCGGGGGAGGGGCGG + Intergenic
1059309117 9:113376594-113376616 GGCCGGGGGGCGGGGTGGGGCGG - Intronic
1059549113 9:115210085-115210107 GGATGGGGGTAGGGATGTGGAGG + Intronic
1059746502 9:117206698-117206720 GGCTGGAAGTAGGGTAGTGGGGG - Intronic
1059941246 9:119362042-119362064 GGTTGGGGGTGGGGGGGTGGTGG - Intronic
1060195813 9:121622735-121622757 GGCAGGGGGTGGGGTGGTGGTGG - Intronic
1060418232 9:123448161-123448183 GGCAGGGGGAAGGGAAGGGGAGG + Intronic
1060478124 9:124000172-124000194 GGCCGGGGGGCGGGGGGCGGGGG - Intergenic
1060660964 9:125405110-125405132 GGCCATGGATGGGGGAGTGGTGG - Intergenic
1060729268 9:126027085-126027107 GGAAGGGAGTAGGGGAGGGGAGG - Intergenic
1060803297 9:126558088-126558110 GGGGGGGGGGAGGGGAATGGGGG - Intergenic
1061147310 9:128807659-128807681 GTCTGGGGGTTGGGGAGTGTGGG + Intronic
1061306451 9:129735809-129735831 GGGTGGGTGTCGGGGAGTGGTGG - Intergenic
1061347982 9:130042580-130042602 GACCGGGCGTGGGGGCGTGGAGG - Intronic
1061371644 9:130200850-130200872 GGCCGTGGGGAGGGGAGGGCTGG + Intronic
1061391380 9:130319081-130319103 GGCGAGGGGTAGGGGAGGGTAGG + Intronic
1061403760 9:130382658-130382680 GGCTGGGGGTGGGGGAGAGGGGG - Intronic
1061487778 9:130929002-130929024 GGCTGGGGGCAGGGGTGGGGAGG + Intronic
1061567168 9:131448748-131448770 GGTTGGGGGATGGGGAGTGGGGG - Intronic
1061589619 9:131590013-131590035 GGCTGAGGGTGGTGGAGTGGAGG + Intronic
1061706524 9:132457300-132457322 GGACGGGGGTGGGGGGGCGGGGG + Intronic
1061753916 9:132799621-132799643 GGTGGGGTGTAGGGGTGTGGGGG - Intronic
1061831595 9:133299755-133299777 GGTGGGGGGCTGGGGAGTGGGGG + Intergenic
1062222492 9:135424961-135424983 GGCTGGGGGGCGGGGGGTGGGGG - Intergenic
1062225322 9:135446820-135446842 GGCCGGGATCAGGGGAGAGGGGG + Intergenic
1062225430 9:135447101-135447123 GGCCGGGATCAGGGGAGAGGGGG + Intergenic
1062234843 9:135502810-135502832 AGCCGGGGGTAGGGGAGATGTGG + Intronic
1062298376 9:135847883-135847905 GAGTGGGGGGAGGGGAGTGGGGG + Intronic
1062465148 9:136677620-136677642 GGCCTGGGGGTGGGGTGTGGAGG + Intronic
1062488201 9:136791480-136791502 GGCGGGGGGCCGGGGCGTGGGGG + Intronic
1062498873 9:136843983-136844005 CGGGTGGGGTAGGGGAGTGGGGG - Intronic
1062534810 9:137016737-137016759 GCCTGGGGGTCGGGGAGGGGAGG + Exonic
1062612191 9:137380336-137380358 GGACGGGGGTTGGGGTGGGGGGG - Intronic
1062615474 9:137394111-137394133 GGCTGGGGTTAGGGAAGCGGCGG - Intronic
1062615485 9:137394140-137394162 GGCCAGGGTTAGGGAAATGGAGG - Intronic
1062615504 9:137394198-137394220 GGCCGGGGTTAGGGAAGCGGAGG - Intronic
1062615515 9:137394227-137394249 GGCCGGGGTTAGGGAAGCGGAGG - Intronic
1062615526 9:137394256-137394278 GGCCGGGGTTAGGGAAGCGGAGG - Intronic
1062615537 9:137394285-137394307 GGCCGGGGTTAGGGAAGCGGAGG - Intronic
1062615548 9:137394314-137394336 GGCCGGGGTTAGGGAAGCGGAGG - Intronic
1062615559 9:137394343-137394365 GGCCGGGGTTAGGGAAGCGGAGG - Intronic
1062615570 9:137394372-137394394 GGCCGGGGTTAGGGAAGCGGAGG - Intronic
1062615581 9:137394401-137394423 GGCCGGGGTTAGGGAAGCGGAGG - Intronic
1062615592 9:137394430-137394452 GGCCGGGCTTAGGGAAGCGGAGG - Intronic
1062615602 9:137394459-137394481 GGCCGGGGTTAGGGAAGCGGAGG - Intronic
1062615613 9:137394488-137394510 GGCCGGGGTTAGGGAAGCGGAGG - Intronic
1062615624 9:137394517-137394539 GGCCGGGGTTAGGGAAGCGGAGG - Intronic
1062615635 9:137394546-137394568 GGCCGGGATTAGGGAAGCGGAGG - Intronic
1062615644 9:137394575-137394597 GGCCAGGGTTAGGGAAGCGGAGG - Intronic
1062630890 9:137462602-137462624 GTCCTGCGGCAGGGGAGTGGGGG - Intronic
1062665426 9:137668618-137668640 GGACTGGGTTGGGGGAGTGGGGG - Intronic
1203771159 EBV:50726-50748 GGCCGTGGGGAGGCGGGTGGCGG + Intergenic
1203663925 Un_KI270754v1:8449-8471 AACCGAGGGTAGGGGAGAGGTGG - Intergenic
1185459484 X:328236-328258 GGGCGGGGAGAGGGGAGGGGGGG - Intergenic
1185459496 X:328256-328278 GGGCGGGGAGAGGGGAGGGGGGG - Intergenic
1185459821 X:328850-328872 GGGAGGGGGGAGGGGAGAGGTGG - Intergenic
1185464386 X:346140-346162 GGCAGGGGGCAGGGGACAGGGGG + Intronic
1185466671 X:358936-358958 CGGCGGGGGTAGGGGAGGGCGGG + Intronic
1185525036 X:771843-771865 GGCAGGGGGTGGGGGAGAGGGGG - Intergenic
1185716470 X:2346794-2346816 GTCGGGGAGTAGGGGACTGGGGG - Intronic
1185736547 X:2500652-2500674 GGCCGGGGGTGGGGGGGGGGCGG - Intronic
1186120447 X:6355409-6355431 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
1186140540 X:6567281-6567303 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
1186356825 X:8799648-8799670 GGATGGGGGCAGGGGAGGGGAGG - Intronic
1186357152 X:8800763-8800785 GGATGGGGGCAGGGGAGGGGAGG - Intronic
1186391535 X:9164646-9164668 AGCAGGGGCAAGGGGAGTGGGGG + Intergenic
1186847450 X:13544552-13544574 GGCCGGGGGTGGGGGGTGGGGGG + Intergenic
1186875878 X:13817216-13817238 AGTTGGGGGTAGGGGGGTGGGGG + Exonic
1186971397 X:14848817-14848839 GGGCGGGGGTAGGTTAGTGAGGG - Intronic
1187067424 X:15854640-15854662 CGCCGGGGATGGGGGAGAGGGGG - Intronic
1187144048 X:16621299-16621321 GTCGGGGGGTAGGGGGTTGGGGG + Intronic
1187146677 X:16643828-16643850 GGTGGTGGGTAGGAGAGTGGAGG - Intronic
1187253866 X:17623482-17623504 GGATGGGGGTAGGGGGGAGGTGG + Intronic
1187610720 X:20939863-20939885 TGCTGGGGGTAAGGGAGGGGTGG + Intergenic
1187612801 X:20960973-20960995 AGCCTGGGGTTGGGGAGGGGTGG - Intergenic
1187898205 X:24002624-24002646 GGGGTGGGGTAGGGGATTGGGGG + Intronic
1187975958 X:24705694-24705716 GGCCAGGGGCAGGGGAGGGGGGG - Intronic
1188669541 X:32866725-32866747 GGGGGGGGGTGGGGGGGTGGGGG + Intronic
1188720020 X:33510713-33510735 GTCCGGGGGTGGGGGGCTGGGGG + Intergenic
1188975021 X:36662709-36662731 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1189071247 X:37866363-37866385 AGCCGGGGGTTGGGGGGTGGAGG - Intronic
1189323221 X:40098321-40098343 GGCCGGGGGACGAGGAGGGGGGG - Intronic
1189330947 X:40144973-40144995 GGGCGGGGGGAGGGGGGTTGAGG - Intronic
1189333454 X:40156372-40156394 GGGCGGGGGTAGGGCTGGGGCGG + Intronic
1189411955 X:40780247-40780269 GCCCGGGGTTAGGGGAGGGGTGG + Intergenic
1189804267 X:44719624-44719646 GGCTGGGGGTGGGGTGGTGGAGG - Intergenic
1189821884 X:44876618-44876640 GGCCGGGGGGTTGGGGGTGGGGG - Intronic
1190052156 X:47158355-47158377 GGCCAGGGGTGGGGGGGTTGTGG - Intronic
1190066477 X:47244995-47245017 GGCTGGGGGTGAGGGAGAGGTGG - Exonic
1190089684 X:47427001-47427023 GGACGGGGGAAGGGGAAAGGGGG - Intergenic
1190149925 X:47936826-47936848 GGGCGGGGGGAGGGGTGCGGCGG + Intronic
1190526540 X:51333747-51333769 GGCGGGGGGGGGGGGGGTGGGGG + Intronic
1190789557 X:53686366-53686388 GGCCTGGGGGAGGGGAGAGGAGG + Intronic
1191269494 X:58445059-58445081 GGGCGGGGGTAGGTTAGTGAGGG + Intergenic
1191638895 X:63409284-63409306 AGCAGGGGGTACGTGAGTGGGGG - Intergenic
1191717822 X:64205342-64205364 GGCTGGGGGGAGGGGGGTTGGGG - Intronic
1191791569 X:64976929-64976951 GGGCGGGGGTGGGGAAGAGGAGG + Intronic
1191975683 X:66868706-66868728 GGGAGGGGGTAGGAGAGGGGAGG - Intergenic
1192210295 X:69123519-69123541 GGCAGGCGGTAGGGCTGTGGGGG + Intergenic
1192212507 X:69136927-69136949 GGCCTGGGGATGGGGAGGGGAGG - Intergenic
1192276689 X:69638928-69638950 GGCTGGGGGGAGGGGAGAGTAGG - Intronic
1192601670 X:72471014-72471036 GGCTGGGGGTTGGAGAGTGTTGG - Intronic
1192636577 X:72825362-72825384 GTCCGGGGGTGGGGGGCTGGGGG - Intronic
1192645137 X:72895452-72895474 GTCCGGGGGTGGGGGGCTGGGGG + Intronic
1192784653 X:74324459-74324481 GGCTGGGGGAATGGGAATGGGGG + Intergenic
1192803974 X:74493876-74493898 GGCTGGGGGGATGGGAATGGGGG - Intronic
1192813791 X:74570918-74570940 TGCCAGGGGTTGGGAAGTGGTGG + Intergenic
1192962526 X:76145395-76145417 GGCCGGGGGAAGGAGCGGGGCGG + Intergenic
1192963007 X:76149692-76149714 GGCCGGGGGAAGGAGCGGGGCGG - Intergenic
1193305627 X:79948260-79948282 GTCAGGGGGAAGGGGAGGGGTGG - Intergenic
1193507169 X:82358983-82359005 GGGCGGGGGAAGGGGAGGGAGGG + Intergenic
1193642796 X:84032696-84032718 GGGCAGGGGTAGGGGGGTGATGG - Intergenic
1193807280 X:86010190-86010212 GTGGGGGGGTAGGGGGGTGGGGG + Intronic
1193815612 X:86101781-86101803 TGCCTGGGGTGGGGGAGGGGTGG - Intergenic
1193925353 X:87477068-87477090 TGCAGGGGGTGGGGAAGTGGTGG + Intergenic
1193969963 X:88039127-88039149 GGGCGGGGGGCGGGGGGTGGGGG - Intergenic
1194167030 X:90529877-90529899 GGCGGGGTGGCGGGGAGTGGGGG + Intergenic
1194247587 X:91534939-91534961 AGCCTGGGGTGGGGGAGGGGTGG + Intergenic
1194427847 X:93762162-93762184 GGCAGGGGGCAGGGGGGTGGTGG - Intergenic
1194522196 X:94932424-94932446 AGCTGGGGGTAGGGGTGTGAAGG + Intergenic
1194823289 X:98531486-98531508 TGCCAGGAGTAGGGGAGGGGTGG - Intergenic
1194977730 X:100410391-100410413 GGCGGGGGGTAGCGGGGGGGCGG + Intergenic
1195172503 X:102282407-102282429 GGCCAGGGGTGGGGGAGGGGTGG + Intergenic
1195186363 X:102404688-102404710 GGCCAGGGGTGGGGGAGGGGTGG - Intronic
1195506713 X:105666379-105666401 GGGCGGGGGTAGGTTAGTGAGGG + Intronic
1195642205 X:107188428-107188450 TGGCGGGGCTGGGGGAGTGGTGG - Intronic
1195695368 X:107663098-107663120 GGCCGGGGGGTGGGGGGTGGGGG - Intergenic
1196243144 X:113366773-113366795 TGCCAGGGGAAGGGGAGAGGTGG + Intergenic
1196574981 X:117306558-117306580 GTCGGGGGGTGGGGGACTGGGGG - Intergenic
1196644194 X:118098927-118098949 GGGTGGGGGAAGGGGGGTGGGGG + Intronic
1196762628 X:119213178-119213200 GGCTAGGGCTAGGGCAGTGGAGG - Intergenic
1196916858 X:120545860-120545882 GGCAGGGGGTGGGGGTGGGGAGG + Intronic
1196979208 X:121193176-121193198 GTCAGGGGGTAGGGGGCTGGGGG - Intergenic
1197050147 X:122047353-122047375 GGAGGGGGGCGGGGGAGTGGGGG + Intergenic
1197327979 X:125117547-125117569 GTCAGGGGGTAGGGGATTAGGGG + Intergenic
1197727832 X:129788107-129788129 GGCCCTGGGCAGGGGGGTGGGGG + Intronic
1197749487 X:129954848-129954870 GACTGGGGGTAGGGCAGCGGGGG - Intergenic
1197796641 X:130305382-130305404 AGCCAGGGATAGGGGAATGGGGG - Intergenic
1197828167 X:130612936-130612958 GGGCAGGGGTAGGGGAGGAGAGG - Intergenic
1197935637 X:131737322-131737344 GGGCGGGGGGAGGGGGGCGGTGG + Intergenic
1198074222 X:133179495-133179517 GGGACGGGGTAGGGGGGTGGGGG - Intergenic
1198205490 X:134460671-134460693 GGCGCGGGGTGGGGGCGTGGGGG + Intronic
1198229575 X:134676272-134676294 TGGCGGGAATAGGGGAGTGGAGG + Intronic
1198267675 X:135024511-135024533 GGGCGGGGGTAGGTTAGTGAGGG - Intergenic
1198485335 X:137081559-137081581 GGCAGGGGATGTGGGAGTGGAGG + Intergenic
1198513133 X:137374299-137374321 GCCCGGGGGTGGGGGAGGGCGGG + Intergenic
1198517569 X:137425044-137425066 GGGCGGGGGGCGGGGAGAGGGGG + Intergenic
1198534040 X:137569217-137569239 GGGCGGGGGTGGGGGTGAGGGGG + Intronic
1198809579 X:140521866-140521888 GGCCTGGGGCAGGGGTGTGGGGG + Intergenic
1198853686 X:140993296-140993318 GCCCAGGGGTAGGGGGGTGTAGG - Intergenic
1199179629 X:144838508-144838530 GGCAGGGGGGAGGGGAGGGGAGG - Intergenic
1199358184 X:146885852-146885874 TGCTGGGGGTCGGGGAGGGGTGG - Intergenic
1199649615 X:149939239-149939261 GGCTGGGGCTCGGGGAGGGGTGG + Intergenic
1199747540 X:150783140-150783162 GTCGGGGGGTAGGGGGGTAGGGG + Intronic
1199794045 X:151178171-151178193 GGCAGGGCGTGGGGGAGAGGTGG + Intronic
1199832950 X:151562818-151562840 GGCGGGGGGTGGGGGGGCGGGGG + Intergenic
1200071074 X:153529710-153529732 GGCTGGGGGCTGGGGAGTTGGGG - Intronic
1200082234 X:153583452-153583474 GGCTGGGGGGTGGGGAGTTGGGG - Intergenic
1200143790 X:153915225-153915247 GGCTGGGGGGTGGGGAGTTGGGG + Intronic
1200179517 X:154141763-154141785 GGCTGGGGGGTGGGGAGTTGGGG - Intergenic
1200216830 X:154371766-154371788 GGCGGGGGGTAGGGATGTGCAGG - Intronic
1200256667 X:154586044-154586066 GGGGAGGGGTGGGGGAGTGGGGG + Intronic
1200261102 X:154618359-154618381 GGGGAGGGGTGGGGGAGTGGGGG - Intronic
1200566609 Y:4776472-4776494 AGCCTGGGGTGGGGGAGGGGTGG + Intergenic
1200756341 Y:6993543-6993565 GGGCTGGTGTAGGGGTGTGGGGG - Intronic
1201075594 Y:10185110-10185132 GGCGGGGGGTAGGGGTTTTGGGG - Intergenic
1201077224 Y:10197124-10197146 GGGCGGTGGGAGGGGGGTGGTGG - Intergenic
1201286265 Y:12381365-12381387 GGCGGGGGGTGGGGCGGTGGTGG - Intergenic