ID: 999240896

View in Genome Browser
Species Human (GRCh38)
Location 5:150126849-150126871
Sequence CTGGCAGGGCTGAAGGGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 368}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999240896_999240906 11 Left 999240896 5:150126849-150126871 CCACGTCCCTTCAGCCCTGCCAG 0: 1
1: 0
2: 2
3: 33
4: 368
Right 999240906 5:150126883-150126905 TTGCTGCCAGAGCTCTGGACGGG 0: 1
1: 0
2: 1
3: 21
4: 180
999240896_999240905 10 Left 999240896 5:150126849-150126871 CCACGTCCCTTCAGCCCTGCCAG 0: 1
1: 0
2: 2
3: 33
4: 368
Right 999240905 5:150126882-150126904 CTTGCTGCCAGAGCTCTGGACGG 0: 1
1: 1
2: 4
3: 23
4: 205
999240896_999240907 12 Left 999240896 5:150126849-150126871 CCACGTCCCTTCAGCCCTGCCAG 0: 1
1: 0
2: 2
3: 33
4: 368
Right 999240907 5:150126884-150126906 TGCTGCCAGAGCTCTGGACGGGG No data
999240896_999240903 6 Left 999240896 5:150126849-150126871 CCACGTCCCTTCAGCCCTGCCAG 0: 1
1: 0
2: 2
3: 33
4: 368
Right 999240903 5:150126878-150126900 TGGCCTTGCTGCCAGAGCTCTGG 0: 1
1: 0
2: 0
3: 26
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999240896 Original CRISPR CTGGCAGGGCTGAAGGGACG TGG (reversed) Intronic
900906221 1:5561383-5561405 CTGGCAGGGCCAATGGGAAGGGG + Intergenic
901655409 1:10766544-10766566 CTGGCCGGGCTGAAAGGTGGGGG + Intronic
901685641 1:10941997-10942019 TTGGAAGGGCTGAAGGGAGGAGG + Intergenic
901773107 1:11540855-11540877 CTGGCCGGGCTAAGGGGACACGG + Intergenic
902165091 1:14563707-14563729 GTGGCAGGGCTGAGAGGATGGGG - Intergenic
902782951 1:18716368-18716390 CTGGCTGGGCTGAGGGGTGGGGG - Intronic
903181684 1:21608170-21608192 CTGGCCGGGGAGCAGGGACGTGG - Intronic
903349653 1:22710360-22710382 GTGGCAGGGCTGAGGCGAGGGGG + Intergenic
903455637 1:23484665-23484687 GTGGTAGGGCAGAAGGGGCGAGG - Intergenic
903480886 1:23652470-23652492 CCGGGAGGACTGAAGGGAGGAGG + Intergenic
903691354 1:25175862-25175884 CTGGCAGGGATGTAAGGATGGGG + Intergenic
903870403 1:26429966-26429988 CTGGCTGGGATGAAAGGATGGGG + Intergenic
904323283 1:29710469-29710491 CAGGCAAGGCTGAAGGGAGGTGG + Intergenic
905011619 1:34750996-34751018 TGGGCCGGGCTGGAGGGACGAGG + Intronic
905181113 1:36167490-36167512 CTGGCAGAGATGAGGAGACGTGG + Intronic
906517909 1:46450454-46450476 CTGGAAGGGCTGAGGGAACAGGG - Intergenic
911103119 1:94109457-94109479 CTGCCAAGGCTGATGGGACAGGG + Intronic
912682888 1:111739982-111740004 CTGGCAAGGCTGTAGGGCTGGGG + Intronic
914437230 1:147670670-147670692 CTGGCTGGGCCGGAGGGGCGAGG - Intergenic
915475415 1:156150111-156150133 CTGACAGTTCTGAAGGGAGGGGG + Intronic
915486164 1:156222238-156222260 GTGGCAGGGGTGAAGGCAGGGGG - Intronic
915625147 1:157109850-157109872 CTTGGAGGGCTGAAGGCAGGGGG - Intergenic
916086649 1:161275094-161275116 CTGGCAGGGCAGAGGGAAAGTGG + Intronic
917310079 1:173669704-173669726 CGGGCAGGGCTGGAGGGGAGTGG - Intronic
917846809 1:179026350-179026372 CGGTCGCGGCTGAAGGGACGCGG + Intronic
920875180 1:209828164-209828186 ATGACAGGTCTGAAGGGGCGTGG + Exonic
921162643 1:212484004-212484026 CTGGCAGGACTGCAGAGACAGGG + Intergenic
921167465 1:212517244-212517266 CTGGCAGGGTTGGATGGAGGCGG + Intergenic
922218208 1:223538140-223538162 CTGGAAGGGTAGAAGGGACTAGG + Intronic
922549603 1:226484343-226484365 CTGGCAGGGCTGACAGCAGGAGG - Intergenic
1063204114 10:3814405-3814427 CTGGCAGGGCTGGAGGGGAGGGG - Intergenic
1063790604 10:9441950-9441972 CTGACAGGGCTGTAGGGCCCAGG + Intergenic
1064981303 10:21170263-21170285 CTGGTAGGCCTGAAGGGATTGGG - Intronic
1065877988 10:30013607-30013629 GGGGCAGGGGTGAAGGGAGGTGG + Exonic
1067241970 10:44505249-44505271 CTTGCAGGGCTGGAGGGTAGGGG - Intergenic
1067412903 10:46080091-46080113 CAGGGAGGGCTGAAGGGATATGG - Intergenic
1069503270 10:68973579-68973601 CAGGCAGAGCTGGAAGGACGGGG + Exonic
1069583584 10:69581593-69581615 CTGCCAGTGCTGAAGGGGCAGGG + Intergenic
1070130733 10:73653713-73653735 CTGGAAGGGATGGAGGGAAGAGG + Intronic
1070305572 10:75237145-75237167 CTGGCAAGGCTGAAGTGCAGTGG + Intergenic
1070559025 10:77551934-77551956 CTGGAAGGCCAGAAGTGACGAGG + Intronic
1070761414 10:79026626-79026648 CTGGCAGGGCTGCAGTGATTTGG + Intergenic
1071380159 10:85051399-85051421 CTGGCAAGGCTGCAGAGAAGAGG + Intergenic
1071603497 10:86970265-86970287 CTGGTGGGGCTGGAGGGAGGCGG + Intronic
1071800513 10:89054726-89054748 CTGGCAGATCTGAAGGGCCTGGG + Intergenic
1072578288 10:96719883-96719905 CTGGGAGGGGTGGAGGAACGGGG + Intronic
1072694218 10:97590970-97590992 CTGGCAGGGATGGAGGGAGGGGG + Intronic
1073450105 10:103604095-103604117 CTGGCAGGATTGTAGGGACTGGG - Intronic
1073996765 10:109324558-109324580 CTGGGAGGGCGGAAGGGATGGGG - Intergenic
1074244982 10:111680710-111680732 CTCACATGGCAGAAGGGACGGGG - Intergenic
1074460103 10:113628981-113629003 CTGGCATGGATGAAGGGAGTTGG - Exonic
1076295231 10:129378683-129378705 GTGGCAGGGCTGGAGAAACGTGG - Intergenic
1076336240 10:129708172-129708194 TTGGCCGAGCTGGAGGGACGGGG + Intronic
1077102821 11:829733-829755 CAGCCAGGGCTGCAGGGAGGAGG + Intronic
1077182524 11:1223093-1223115 CTGGCACGGGTGGGGGGACGGGG - Exonic
1077414496 11:2418432-2418454 GGGACAGGGCTGAAGGGATGGGG - Intronic
1077635154 11:3837191-3837213 CGGGCGGGGCTAAAGGGACTGGG - Intronic
1077842062 11:5986188-5986210 CAGGCAGTGCTGAAGGTACCAGG - Exonic
1077849122 11:6057533-6057555 CAGGCAGTGCTGAAGGTACCAGG - Intergenic
1078081875 11:8209888-8209910 CTGACAGGGCTTATGGGACCTGG + Intergenic
1078152872 11:8774216-8774238 CAGGTAGGGCTGAAGGGTGGAGG - Intronic
1078511085 11:11984759-11984781 CTGGCAGGGCTGCTGGGTGGGGG + Intronic
1080795500 11:35559377-35559399 TTGGAAGGGCTGAAGGAGCGGGG - Intergenic
1083292360 11:61697030-61697052 CTGCCAGGGCTGAGGGCACAGGG + Intronic
1083367536 11:62150527-62150549 CCAGCAGGGCTGAAGAGACTTGG + Intronic
1084191908 11:67503337-67503359 CTGGCAAGGAAGAAGGGACTAGG + Intronic
1084203326 11:67576746-67576768 CAGGCATGGCTGAAGGCACTGGG - Intergenic
1084758845 11:71255615-71255637 CTGGCAGGGATGAGGGGATGTGG - Intergenic
1084964832 11:72739115-72739137 CTGGCAGGGCTGGAGGGAGGTGG - Intronic
1085251675 11:75148069-75148091 CTGCCAGGCCAGAAGGGAAGTGG + Intronic
1086345374 11:85890703-85890725 CTCTCAGTGCTGAAGGGAAGAGG - Intronic
1089452381 11:118607512-118607534 CTGGCCAGGCGGACGGGACGGGG + Intronic
1089833701 11:121351267-121351289 CTGGCAGGCCAGAAAGCACGTGG - Intergenic
1091268733 11:134290727-134290749 CTGCCATGGCTGCAGGGATGGGG - Intronic
1091831749 12:3554983-3555005 GTGGCAGGGCTGAAGCCACATGG - Intronic
1092045717 12:5430862-5430884 GTGGCAGGGAGGAAGGGATGAGG + Intergenic
1092241933 12:6840797-6840819 CTGGCAGGGGTGGGGGGAAGGGG - Intronic
1094689590 12:32755738-32755760 CTGGCAGCGCAGAAGGCTCGAGG - Exonic
1095155162 12:38843824-38843846 CTTGCAGGACAGAAGGGAGGTGG - Intronic
1096406345 12:51346729-51346751 CTGGCAGGGCTGAGGGTGCAAGG + Intergenic
1096843195 12:54391297-54391319 CTGGCCGGGCTGGGGGTACGGGG + Exonic
1096902142 12:54895276-54895298 TTGTCAGGGCTGAAGAGAGGAGG + Intergenic
1097391983 12:59026314-59026336 CAGGCAGGGCTGCAGGGTCCCGG - Intergenic
1101639428 12:106577114-106577136 CTGTCAGAGGTGAAGGGCCGGGG + Intronic
1102261661 12:111446919-111446941 CTGGCAGGGAGGAAGGGAACAGG - Intronic
1104364367 12:128163731-128163753 CTGGCAGGGCTCATGGGCCTGGG - Intergenic
1104561871 12:129853158-129853180 CTGGGAGGGTTGAAGGGAGGTGG - Intronic
1105519914 13:21122741-21122763 CTGGCAGGGGGCAGGGGACGGGG - Intergenic
1105712716 13:23028579-23028601 CAGGCAGGGCTGAACCGAGGAGG - Intergenic
1106311285 13:28556768-28556790 CTGGGAAGGCTGCAGGGAAGAGG + Intergenic
1107548931 13:41457606-41457628 CTGGCAGGGCTGAAGTGTGCGGG + Exonic
1108056960 13:46494722-46494744 CTGTCAGGGCTGAGGGGTGGGGG - Intergenic
1108312989 13:49214124-49214146 ATGCCAGGGCTGGAGGGAGGAGG + Intergenic
1111024032 13:82494826-82494848 CTGGCTTGGCTGAAGTGACCTGG - Intergenic
1112326127 13:98443842-98443864 CTGGGAGGAGGGAAGGGACGGGG + Intronic
1112625425 13:101098167-101098189 CTGGGAGGGCTTCAGGGAGGAGG - Intronic
1113468229 13:110526789-110526811 ATGGCAGGTCTGAAGGGTCGTGG - Intronic
1113767265 13:112889167-112889189 CTGGGAGGGCTCAGGGGACGGGG + Intergenic
1116916628 14:50532234-50532256 CTGGCGGGACGGAAGGGAAGGGG - Intronic
1117766252 14:59086433-59086455 CTGGCAAGGCTGCAGAGAAGAGG + Intergenic
1121042463 14:90760236-90760258 CTGGCAGGGGTGAGGGCAGGTGG + Intronic
1121100440 14:91246428-91246450 CTGGCAGGGCTGGAGGCGGGAGG - Intronic
1121111333 14:91315174-91315196 CTGGCAGAGCTGTAGGCAAGAGG + Intronic
1121391208 14:93576653-93576675 CTCCCAGGGCTGAAGGAACAAGG + Intronic
1121518714 14:94571033-94571055 CTGTCAGGGCTGCAGGAATGAGG - Intronic
1121927588 14:97942717-97942739 CTTGCATGGTTGAAGGGACAAGG + Intronic
1122968652 14:105143622-105143644 CTGGCAGGGCTGAAGGACTGCGG + Exonic
1123429302 15:20201365-20201387 CTGGCAGGACTGATGGTAGGTGG - Intergenic
1124152716 15:27196301-27196323 CTGGGAGGGCTGAGGGGAGCAGG - Intronic
1124428609 15:29586292-29586314 CTGTCAGGGCTGGAAGGAGGAGG + Intergenic
1126695764 15:51323948-51323970 GTGCCAGGGCGGAAGGGAGGAGG + Intronic
1128450541 15:67803658-67803680 CATGCAGGGCTGATGGGAGGAGG + Intronic
1128457659 15:67841343-67841365 GCGGCAGCGCTGAGGGGACGGGG + Intergenic
1129941627 15:79501991-79502013 CTGGGAGGGTTGAAGGAAAGTGG - Intergenic
1131348758 15:91677067-91677089 CTGTCAGAGATGAAGGGAGGAGG - Intergenic
1133303732 16:4797729-4797751 CTGGCAGAGCTGCAGGGAGACGG + Exonic
1138282037 16:55779574-55779596 CTGGCTGGGCTGAAAGGAAGTGG - Intergenic
1139473732 16:67192193-67192215 CTGGCCTGGCTGAGGGGAGGCGG + Exonic
1141915345 16:87092834-87092856 CTGGCTGGGCAGAAGGGAATGGG - Intronic
1142203972 16:88773950-88773972 CTTGCGGTGCTGAAGGGACTCGG - Intronic
1142977897 17:3656273-3656295 CTGGCAGGGGTGGAGGGGCAGGG - Intronic
1142977958 17:3656423-3656445 CTGGCAGGGGTGGAGGGACAGGG - Intronic
1143595639 17:7912062-7912084 CTGGGAGGGAGGAAGGGACGAGG + Exonic
1144837509 17:18164426-18164448 CAGGCAGGGCTGATGGCACATGG - Intronic
1145291753 17:21551757-21551779 CGGGCGGGGTTGAGGGGACGGGG + Intronic
1146261996 17:31427899-31427921 CTGGCATGGCTGGGGGGAGGGGG + Intronic
1146667733 17:34716046-34716068 CTGGGTGGTCTGAAGGGAAGTGG - Intergenic
1146826567 17:36028391-36028413 CTGGCAGAGGTGAGGGGATGGGG + Intergenic
1147189556 17:38730630-38730652 GTGACAGGGCTGAAGGGGCGAGG - Intronic
1147635255 17:41960005-41960027 CTGGCAGGGCTGCAGTGAGGTGG - Intronic
1147759854 17:42790481-42790503 CAGGCAGGGCTGGAGAGATGTGG + Intronic
1148147709 17:45376512-45376534 GGAGCAGGGCTGAAGGGATGGGG + Intergenic
1148189558 17:45669067-45669089 CTGGAGGGGCTGCAGGGAAGAGG - Intergenic
1148683587 17:49488274-49488296 CTGGCAGGGGAGCAGGGAGGGGG - Intergenic
1149537026 17:57441019-57441041 CTCCCAGGGCTGCAGGGACCTGG + Intronic
1149974346 17:61251040-61251062 GGGGCAGGGCTGGAGGGATGAGG - Intronic
1150620765 17:66806418-66806440 CCTGCAGGGCTGCAGGGACAGGG - Exonic
1151208152 17:72523646-72523668 TTGGCAAGGCTGAGGGGACATGG - Intergenic
1151475125 17:74340853-74340875 CAGGCAGGGCTGTAGCGAGGTGG + Intronic
1151557084 17:74852028-74852050 CGGGCAGGGCTGACGGGCCCAGG + Exonic
1151680707 17:75621284-75621306 CTGGCTGGGATGAAGGCAGGAGG + Intergenic
1152027801 17:77822979-77823001 CTTGCAGTGATGAAGGGACTGGG - Intergenic
1152204561 17:78967624-78967646 ATGCCAGGGCTGGAGGGAGGAGG + Intergenic
1152686629 17:81696884-81696906 CCGGCAGGGCTGAAGGTGCTGGG - Exonic
1154333457 18:13448429-13448451 CTGGCAGAGCTGTAGGAAAGCGG + Intronic
1156053923 18:32974673-32974695 CTGACAGAGCTAAAGGGAAGAGG + Exonic
1156513917 18:37663808-37663830 CTTGCAGGGCTGAGGGAACAAGG - Intergenic
1156825307 18:41424076-41424098 CTGGCATGGCTCAGGGGATGGGG - Intergenic
1157232789 18:45934828-45934850 CTGGGCGGGCTGCAGGGAGGAGG + Exonic
1158900486 18:61957612-61957634 CTGACAGGCCTGGAGGGAAGTGG + Intergenic
1159770855 18:72543855-72543877 CTGGCGGGGCTGCGGGGCCGAGG - Intronic
1161063468 19:2226647-2226669 CTGGCTGGGCTGAAGGGCGAGGG + Exonic
1161314570 19:3611819-3611841 CTGTCTGGGCTGCAGGGCCGCGG - Exonic
1161327208 19:3669693-3669715 CTGGCAGGGCTGATAGGGTGGGG - Intronic
1161342832 19:3752410-3752432 CTGGCTGGGCTGGAGAGACCTGG + Intronic
1162639881 19:11999926-11999948 CTGGCGGGGCTGGTGGGACAAGG + Intergenic
1162728807 19:12705600-12705622 CTGGCAGGGAGGAAGGCAGGTGG + Intronic
1162926561 19:13933172-13933194 GGGGCAGGGCTGGAGGCACGCGG + Exonic
1162936681 19:13984758-13984780 CCGGCAGGACTGAAGGGCCACGG + Intronic
1162955059 19:14092835-14092857 CTGGGAGGGCTGAGGGGCTGGGG + Exonic
1163222925 19:15934768-15934790 GTGGCAGGGCTGGAGGGTCCTGG - Exonic
1163287468 19:16357561-16357583 ATGGCAGGGCTGGGGGGACTGGG + Intronic
1163400881 19:17091768-17091790 CAGCCAGGGCTGCAGGGAAGGGG - Intronic
1163722762 19:18906043-18906065 CTGAGAGGGATGAGGGGACGAGG - Intronic
1164620628 19:29694090-29694112 CTGGCAGGGCTGAGGGAAAACGG - Intergenic
1165993594 19:39829844-39829866 CTGGCAGGGCTGTGGGCACCTGG - Intronic
1166316632 19:41993177-41993199 GGGGCGGGGCTGAAGGGAGGGGG - Intronic
1166565876 19:43765232-43765254 CTCTCAGGGATGAAGGGGCGAGG + Intergenic
1166943764 19:46384638-46384660 TTGGCAGGGCTCAAGGGATCTGG - Intronic
1167216543 19:48169692-48169714 CTGGAAGTGCTGAGGGGGCGGGG - Intronic
1167608536 19:50494692-50494714 CTGGCAGGGCAGAGAGGAGGGGG + Intergenic
1168246489 19:55115239-55115261 CTGGCAGGGCTGTGGTGAGGAGG - Intronic
925672197 2:6323230-6323252 CTGGCAAGGCTGCAGAGAAGAGG + Intergenic
925808232 2:7673454-7673476 CTGGCAGAACTGAAGGACCGTGG + Intergenic
926124551 2:10264264-10264286 CTGGAAGGGCTGATGTGATGCGG + Intergenic
926329681 2:11814111-11814133 CTGGCAGAGCTGATGGGAGCAGG + Intronic
926419535 2:12682901-12682923 TTGGAAAGGCTGAAGGGAAGAGG - Intergenic
927093266 2:19728508-19728530 CTGGCAGGGCTGGCTGGAAGGGG - Intergenic
927265760 2:21148961-21148983 CTGGCAGGGCTTAGGGGAGAGGG - Intergenic
927348377 2:22074698-22074720 ATGGGAGGGGTGAAGGGAGGTGG + Intergenic
928300171 2:30117761-30117783 CTTGGGGGGCTGAAGGAACGGGG + Intergenic
929505402 2:42524338-42524360 TTGCCTGGGCTGAAGGGCCGTGG + Intronic
929756334 2:44768645-44768667 CGGGCAGGGCTGGAGGGGCAGGG - Intronic
931220385 2:60283864-60283886 CTGGCAGGGCAGGAGGGAACGGG - Intergenic
933759769 2:85665468-85665490 CAGGCAGGGCCTAAGGGAGGAGG - Intronic
933779018 2:85788615-85788637 CTGTCAAGGCAGAAGGGACAGGG + Intergenic
934130272 2:88941403-88941425 CAGGCAGGGCTGCAGGGAAAGGG - Intergenic
934744982 2:96753420-96753442 CTTGCAGGGCTGAGGTGAAGGGG + Intergenic
934851149 2:97702099-97702121 CAGGCAGGACTGAAGGGCTGTGG - Intergenic
934862336 2:97774692-97774714 CTGGCAGGTGGGAAGGGAAGTGG + Intronic
935082787 2:99814738-99814760 CTGGGAGGGGTGGAGGGACATGG - Intronic
935126750 2:100231106-100231128 CTGGAAGGGATGGAGGGAGGTGG - Intergenic
938158305 2:128959993-128960015 CTGGGAGGGCTGCAGGGAAAGGG - Intergenic
938158439 2:128960760-128960782 CTGGGAGGGCTGCAGGGAAAGGG + Intergenic
938570071 2:132554696-132554718 CTGGCAGGGCTTAAAGGGGGAGG + Intronic
939162635 2:138607954-138607976 CTGGAAGGGATGAAGGGGAGAGG + Intergenic
939570138 2:143831303-143831325 CTGGCAGGGCCTAAGGAAAGAGG + Intergenic
939630041 2:144518601-144518623 CTGAGAGGGGTGAAGGGAGGGGG + Intronic
942163284 2:173215191-173215213 CTGGCAGGGGTGTGGGGACTGGG + Intronic
943529863 2:189065799-189065821 CTGGGAGGGCAGAAAGGACCTGG - Intronic
944837476 2:203594063-203594085 CTGGGAGTGCTGAAGGGACATGG - Intergenic
945108885 2:206344106-206344128 CTGACAGGGCTCCAGGGAGGTGG - Intergenic
946336690 2:219042348-219042370 CTGGCAGGGCTGGAGGGAAGGGG + Intergenic
948082461 2:235217725-235217747 CTGCCAGGGCTGAAGTGGTGGGG - Intergenic
948106954 2:235421923-235421945 CTGGCAGGGCTGCAAGGAACTGG + Intergenic
948368893 2:237475199-237475221 CGGGAAGGGCTGGAGGGCCGGGG + Intergenic
948689635 2:239693885-239693907 CTGCCAGGGCTGCAGGGCCATGG + Intergenic
948889317 2:240899210-240899232 CTGGCAGGGCTCCTGGCACGCGG - Intergenic
948993252 2:241565026-241565048 CAGGGAGGGCTGAGGGGAAGGGG + Intronic
1168992180 20:2103894-2103916 CTGCCTGGGATGAAGGGCCGGGG - Intronic
1169221290 20:3824563-3824585 CTGGCAGGGATGGAGGAAGGTGG - Exonic
1169354932 20:4898183-4898205 CAAGCTGGGCTGAAGGGAGGAGG - Intronic
1169424563 20:5485853-5485875 CTGGCGGGGCTGAAGGTCAGTGG - Intergenic
1169448527 20:5691888-5691910 CTGGGAGGGATGGAGGGACGGGG + Intergenic
1169747137 20:8953912-8953934 CTTGCATGGCAGAAGGGACAAGG + Intronic
1172175386 20:32969175-32969197 CCGGCTGGGCTGAGGGGTCGTGG + Intergenic
1172354351 20:34269191-34269213 CAGGCAGGGCTTCGGGGACGCGG + Intronic
1172357905 20:34292478-34292500 CTGGAAGGGCGAAACGGACGAGG - Exonic
1173130740 20:40390888-40390910 CTGGGAGGGCAGAAGGAAAGTGG - Intergenic
1173298245 20:41778424-41778446 CAGGCAGGGCTGTAGGCACAGGG - Intergenic
1173450852 20:43162693-43162715 CTGGTGTGGCTGAAGGGAAGGGG - Intronic
1173871721 20:46346287-46346309 AAAGCAGGGGTGAAGGGACGTGG + Intronic
1174040399 20:47695443-47695465 TTGGCAGGGCTGAGGGGAGGGGG - Intronic
1174082898 20:47983458-47983480 CTGGAAGGGCAGGAGGGACTGGG + Intergenic
1174416081 20:50368138-50368160 ATGGCAGAGCTGGAGAGACGTGG - Intergenic
1175458389 20:59132474-59132496 TTGGCAAGGCTGCAGGGAAGAGG - Intergenic
1175928227 20:62481108-62481130 CTGGCAGGGCTGTGGGGCCCGGG + Intergenic
1176041641 20:63068838-63068860 CTGGCAGGGCAGACAGGAAGCGG - Intergenic
1176059859 20:63167818-63167840 CTAGCAGGGCTGAAAGAAGGAGG + Intergenic
1176141630 20:63547524-63547546 CTGGCAGGGCCGGTGGGACCCGG + Intergenic
1177264584 21:18765789-18765811 TTGGAAGGGATGAAGGGAAGAGG - Intergenic
1178503587 21:33145434-33145456 CTGGAAGGGCTGGAGGGGAGAGG + Intergenic
1178882465 21:36460369-36460391 GAGGCAGGGCAGAAGGGAAGGGG - Intergenic
1179251532 21:39675013-39675035 CTGACGGGGCTGAAGGGGCTGGG - Intergenic
1179265127 21:39796327-39796349 CTGGCAGGGCTGCAGGGCTACGG - Intronic
1179532030 21:42026217-42026239 CTCGCAGGGCTGACGGGAGTGGG - Intergenic
1179603453 21:42496425-42496447 GGGGCGGGGCGGAAGGGACGAGG + Intronic
1179945405 21:44670827-44670849 TCGGCAGAGCTGAAGGGATGTGG - Intronic
1180000517 21:44993440-44993462 CTGGCAGCGCTGAACGGGAGTGG - Intergenic
1181035961 22:20169832-20169854 CAGGCAGGGCTGACAGGGCGGGG - Intergenic
1181136798 22:20772980-20773002 CTTGCAGGGCTGAGGTGAGGAGG + Intronic
1182041769 22:27243572-27243594 CTGGAAGGGGTGAAGTGACTTGG - Intergenic
1182355593 22:29721068-29721090 CCCGCAGGGCTGCAGGGAAGGGG - Intronic
1182829595 22:33294252-33294274 ATCGCAGGGCTGAAGGCACTGGG + Intronic
1183030385 22:35099579-35099601 GTGGCAGGGCTAAGGGGAAGAGG + Intergenic
1183740128 22:39664586-39664608 GTGGCGGGGCCGAAGGGAAGGGG - Intronic
1184245437 22:43233501-43233523 CTGGCAGGTCTGCTGAGACGTGG - Intronic
1184246138 22:43236700-43236722 CGGGGAGGGCTGAGGGGAAGAGG - Intronic
1184301447 22:43563129-43563151 CTGCCAGGGCAGAAGGAACGCGG + Intronic
1184853878 22:47136160-47136182 CTGGGAGGCCTCAGGGGACGTGG - Intronic
950315438 3:11997964-11997986 CAGGCAGGACTGAAGGGTCGGGG + Intergenic
950854052 3:16088918-16088940 CTTGGTGGGCTGAAGGGAGGTGG + Intergenic
952114198 3:30159663-30159685 ATGGCAGGGCTGAGGGGGCCTGG - Intergenic
952268083 3:31806205-31806227 CTGGGAGGGCTGAGGGAACAAGG - Intronic
953026240 3:39146832-39146854 CAGGCAGGGCTGGAGGGCAGAGG - Intronic
953114910 3:39983188-39983210 CTGGCAGGGATAAAGGAACCGGG - Intronic
954389270 3:50260366-50260388 CTGGCAGGTGTGCGGGGACGGGG - Intergenic
954460897 3:50626297-50626319 CTGGGAGGGCTCAAGGTATGAGG + Intronic
956873263 3:73438896-73438918 CTGGCAGTGCTGAATGAACTGGG + Intronic
960120997 3:113948311-113948333 CTGGCAGTGCTCAGGGGTCGCGG - Intronic
960588991 3:119347236-119347258 CTGGCACTGCTTAAGGGACAAGG + Intronic
961115178 3:124323248-124323270 CTGGCAGGGCTGTTGGGAAGAGG - Intronic
961809755 3:129514963-129514985 CTGGCTGGGTTGAAGGAATGTGG - Intronic
962385533 3:134929538-134929560 ATGGCAGGACTGAAGGGGCCAGG + Intronic
963793158 3:149604788-149604810 CTGGCAGGCCAGAAGGCAGGTGG + Intronic
966087400 3:176085154-176085176 CTCACATGGCTGAAGGGAAGAGG + Intergenic
968209345 3:196835323-196835345 TACGCAGGGCTGAAGGGAAGTGG - Intergenic
968658288 4:1787917-1787939 CGGGCAGGGCTGAGAGGAAGGGG + Intergenic
968879431 4:3291762-3291784 CCTGCAGGGCTGAAGGAGCGCGG - Intergenic
970994267 4:22247727-22247749 CTGGCAGTGAAGAAGGGAAGGGG - Intergenic
972542960 4:40056014-40056036 CTGGCAGGGCCGATGGGGCTGGG + Intergenic
974863668 4:67553636-67553658 TTGGCAAGGCAGAAGGGAGGCGG - Intergenic
975758239 4:77592660-77592682 CTGGCAAGGCTGAAGGACTGAGG + Intronic
975909062 4:79247139-79247161 ATGGCAGGGCTGGAGGGATTTGG + Intronic
976151996 4:82101645-82101667 CCGTTAGGGCTGAAGGGACCAGG + Intergenic
977021642 4:91767635-91767657 TTGTCAGGGCTGGAGGGAGGTGG - Intergenic
982157159 4:152535077-152535099 CTGGCAGCGCGGAAGAGACCCGG - Exonic
984869133 4:184311311-184311333 CTGGCAGGGCTGAAGCTGCAAGG - Intergenic
985575491 5:671732-671754 CTGGCAGGGCAGGATGAACGTGG - Intronic
985629178 5:1005861-1005883 CTGGAATGGCTGAGGGGACCAGG + Intergenic
985657962 5:1141992-1142014 CCTGCAGGGCTGCAGGGAAGAGG - Intergenic
986483134 5:8209617-8209639 CTGGCAGGGGTGAGGAGAGGAGG + Intergenic
987072842 5:14354102-14354124 CTGGCAGGGCTTCAGGGAGAGGG + Intronic
988523639 5:31967710-31967732 CTGGCAGGGCTGAAGACTTGGGG + Intronic
989351788 5:40495053-40495075 CTGGCAGGGATGGAGGGGCAGGG - Intergenic
991046840 5:62231802-62231824 CTGGCAGGACTGATGGTAGGTGG - Intergenic
992239418 5:74751101-74751123 TTAGCAGGGGTGAAGGGAGGGGG + Intronic
992482910 5:77168824-77168846 ATGGCAGGTCTGCAGGGACGAGG - Intergenic
992941568 5:81767330-81767352 CTGCCAGGCCAGCAGGGACGAGG + Intergenic
996973659 5:129404282-129404304 TTGTCAGGGCTGAAGGGCGGTGG + Intergenic
999139434 5:149348279-149348301 GTGGCAGTGCTGAATGGAAGCGG - Exonic
999240896 5:150126849-150126871 CTGGCAGGGCTGAAGGGACGTGG - Intronic
1001775289 5:174324261-174324283 TTGGCAGGGGTGGAGGGAAGTGG + Intergenic
1002044698 5:176535443-176535465 CTGGCAGGGCTTAAAGAACCAGG - Intronic
1002303635 5:178271223-178271245 CTGGCAGGGATGCTGGGACCAGG + Intronic
1002535910 5:179875264-179875286 CTGGCAGGGCTGGAGTGGCCAGG - Intronic
1002630045 5:180567121-180567143 CTGGTAGAGCTGAAAGAACGTGG + Exonic
1008232962 6:49007688-49007710 CTGGCAGGGATGAACAGATGTGG - Intergenic
1009267809 6:61578143-61578165 GTGGCAGGGCTGAAGGGTTGTGG + Intergenic
1010570004 6:77464235-77464257 CTGGGGGAGCTGGAGGGACGCGG + Intergenic
1012435773 6:99213826-99213848 CTGGCAAGGCTGCAGGGAAAAGG + Intergenic
1013570330 6:111417348-111417370 CTGGCAGGGCTGTATGGAAGTGG + Intronic
1015111721 6:129599708-129599730 CTAGCAGGGCTGTAGGTAGGAGG - Intronic
1016408832 6:143760591-143760613 CTGGCTTGGGTGGAGGGACGGGG - Exonic
1017729742 6:157304939-157304961 CTGGCAGGGCTGGAGTGCAGTGG + Intronic
1017816693 6:158021537-158021559 CTGGGAGGGCTGGAGGGAGGAGG + Intronic
1018902136 6:168057005-168057027 CTGGCGGGCAGGAAGGGACGAGG + Exonic
1019074808 6:169378749-169378771 CTGGGAGGCCAGAAGGGATGGGG - Intergenic
1019209481 6:170393820-170393842 GGGGAAGGGCTGTAGGGACGTGG + Intronic
1019299508 7:296238-296260 CAGGCAGGGCTGAGGGCACCAGG - Intergenic
1019337544 7:492456-492478 CTGCCCAGGCTGAAGGAACGGGG - Intergenic
1019507724 7:1401256-1401278 CAGGCAGGGGCGAGGGGACGGGG - Intergenic
1019516859 7:1444030-1444052 CTGGCGGGTCTGAGTGGACGCGG - Intronic
1019516871 7:1444078-1444100 CTGGCGGGTCTGAGTGGACGCGG - Intronic
1019516883 7:1444126-1444148 CTGGCGGGTCTGAGTGGACGCGG - Intronic
1019516895 7:1444174-1444196 CTGGCGGGTCTGAGTGGACGCGG - Intronic
1019516907 7:1444222-1444244 CTGGCGGGTCTGAGTGGACGCGG - Intronic
1019516920 7:1444270-1444292 CTGGCGGGTCTGAGTGGACGCGG - Intronic
1019537736 7:1537827-1537849 CTGGCAGGGAGGACGGGATGCGG + Intronic
1019601093 7:1884220-1884242 CTGCCCTGGCTGAAGAGACGTGG + Intronic
1019707012 7:2501779-2501801 CTGGCAGGGGAGGAGGGCCGGGG - Intergenic
1020022685 7:4878498-4878520 CTGCCCGGGCTGGAGGGCCGTGG - Intronic
1020076725 7:5263377-5263399 CAGGCAGGGCTCAGGGGAGGAGG - Intergenic
1020281204 7:6650981-6651003 CTCGCAAGGCTGAAGGGAGAGGG + Intronic
1022095639 7:27139505-27139527 TTGGCAGGGCTGAATTGAGGCGG - Intronic
1023872180 7:44269192-44269214 CTGCCAGGGCTGAAAGGGCAAGG + Intronic
1023905248 7:44517172-44517194 GTGGCTGGGCTGGAGGGAGGTGG - Intronic
1024210622 7:47200352-47200374 CTGGGAGGGCTGTAGGCACCTGG - Intergenic
1024313503 7:47991876-47991898 CAGGCGGGGCTGGAGGGGCGTGG - Intronic
1024970544 7:55065777-55065799 ATGGCAGAGCTGAAGGCAAGGGG + Intronic
1025202368 7:56970217-56970239 CAGGCAGGGCTGAGGGGAGGAGG + Intergenic
1025669580 7:63606710-63606732 CAGGCAGGGCTGAGGGGAGGAGG - Intergenic
1025789296 7:64672924-64672946 CTGGCAAGGTTGAAGGGAAAAGG - Intronic
1026850285 7:73719470-73719492 CAGCCAGGGCTGAAGGGAGCGGG - Intronic
1028505114 7:91561864-91561886 CTGGAACGGCTGAAGGGATATGG + Intergenic
1029705701 7:102274688-102274710 CCGGCAGGGCTGAAGGGTCAGGG - Intronic
1030067842 7:105674077-105674099 ATGGCAGGGCTGAGGAGCCGAGG + Intronic
1031837572 7:126696678-126696700 CTGGCAATGGAGAAGGGACGTGG + Intronic
1032584756 7:133135971-133135993 CTGGAAGGGCTGGAGGCACTAGG + Intergenic
1032957634 7:136989932-136989954 CTGGGAGAGGTGAAGGGAGGTGG - Intronic
1034263430 7:149770971-149770993 CTGGCAGAAATGAAGGGACTTGG - Intronic
1034506290 7:151494324-151494346 CTTGCGGGAGTGAAGGGACGGGG + Intronic
1034879188 7:154750576-154750598 CGGGCAGAGCTGAAGGGTGGCGG + Intronic
1034919508 7:155068412-155068434 CTGGCAGGGGGTAAGGGAGGGGG + Exonic
1034999910 7:155604282-155604304 CTTACATGGCAGAAGGGACGTGG + Intergenic
1035118129 7:156542228-156542250 TTGGCAGGGATGTAGGGAAGGGG + Intergenic
1035580538 8:737244-737266 CTCGCGGGGCAGAGGGGACGCGG - Intronic
1035619904 8:1028932-1028954 CAGCCAGGGCAGGAGGGACGTGG + Intergenic
1036699827 8:11005393-11005415 ATGGAAGGGCTGGAGGGAAGTGG + Intronic
1036824525 8:11965866-11965888 CTGCCAGGGGTGAAGGGAAGTGG - Intergenic
1038311956 8:26451561-26451583 CTGGCATGGCTGAAGTGACATGG + Intronic
1038540226 8:28385511-28385533 CCGCCAGGGCGGGAGGGACGCGG + Intronic
1040307428 8:46219443-46219465 ATGGGAGGGCTGAAGGGATGCGG - Intergenic
1040858029 8:51970374-51970396 CTGGCAGGGGGTAAGGGACAGGG - Intergenic
1044737189 8:95290886-95290908 CTGGCAGGGCTGCAGTAATGGGG + Intergenic
1046084642 8:109417056-109417078 TTGGGATGGCTGAAGGGATGTGG + Intronic
1047526554 8:125638812-125638834 CAGGCAGGGCTTCAGGGAGGAGG + Intergenic
1047540136 8:125756780-125756802 CTGGCAGGGCTGCAGAGAAAAGG - Intergenic
1048873263 8:138816142-138816164 CTGGCAAGGCCGCAGGGACAGGG + Intronic
1049482625 8:142834297-142834319 CTGGCGGGGCTGAAGGGCAAGGG + Intronic
1049624210 8:143612833-143612855 CTGGCAGGGTTGACGGGTGGTGG + Exonic
1049624751 8:143615003-143615025 CTCCCAGGGCTGAAGGGCCAGGG - Intronic
1049689184 8:143951299-143951321 CTGCCAGGCCTGGAGGGATGAGG + Intronic
1049706849 8:144047102-144047124 CAGACAGGGCTGAAGGGGCACGG - Intergenic
1049728779 8:144164945-144164967 CTGGAGGGGCTGAAGGGACTAGG + Intronic
1049747510 8:144269269-144269291 CTGGCAGGGTTGGGGGGAGGTGG - Intronic
1050411244 9:5368090-5368112 CTGGCAAGGCTGCAGAGAAGAGG + Intronic
1051664509 9:19456173-19456195 CTGGCAGAGGTGAGGGGACAAGG + Intergenic
1052820879 9:33137222-33137244 CAGGCATGGCTTAAGGGATGGGG - Intronic
1055245714 9:74240049-74240071 CTGGCAGGGCTGGAGGTTCTGGG - Intergenic
1057043455 9:91864689-91864711 CTGGCATGTCAGAAGGGACCAGG + Intronic
1058176071 9:101737863-101737885 CTGGCAGGGCTGCGGGTGCGAGG + Exonic
1058896075 9:109401673-109401695 CTCGCAGGGCTGAAGGACGGTGG + Intronic
1060676251 9:125517783-125517805 CAGGCAGGGCTGCAGAGAGGAGG - Intronic
1061033982 9:128103325-128103347 CTGGCTGCGCTGAAGGGATCAGG - Intronic
1061042177 9:128146568-128146590 CTAGCAGGGCTGCAGGGAGGGGG - Intergenic
1061500453 9:130998556-130998578 CTGGGAAGGCAGAAGGCACGAGG + Intergenic
1061779401 9:132986947-132986969 CTAACAGGGCAGAAGGGATGAGG - Intronic
1062102727 9:134737017-134737039 CTGGGAGGGCAGCAAGGACGAGG - Intronic
1062225270 9:135446677-135446699 CTGGCAGGGGTGGGGGGAGGGGG + Intergenic
1062225341 9:135446864-135446886 CTGGCAGGGGTGGGGGGAGGGGG + Intergenic
1062225378 9:135446958-135446980 CTGGCAGGGGTGGGGGGAGGGGG + Intergenic
1062225449 9:135447145-135447167 CTGGCAGGGGTGGGGGGAGGGGG + Intergenic
1062467272 9:136686884-136686906 CACGCCGGGCTGCAGGGACGCGG + Intronic
1062549541 9:137079573-137079595 CAGGCACGGCTGATGGGTCGGGG + Intronic
1062613122 9:137383833-137383855 CAGGCGGGGCTGGAGGGAGGGGG - Intronic
1062636844 9:137495952-137495974 CTGGCAGAGCTGAGGCGAGGCGG + Intronic
1187571025 X:20502301-20502323 CTGGGTGGGCTGAGGGGAGGTGG - Intergenic
1188020480 X:25151659-25151681 CTTGCAGAGCTGCAGGGACAAGG - Intergenic
1189280553 X:39817760-39817782 TTGGCAGGGCTGAAGGTTCATGG - Intergenic
1190101331 X:47524633-47524655 CTGGGAGGGCTGCATGGAGGAGG + Intergenic
1190380598 X:49836807-49836829 CTGCCAGGGCTTAAGGGTCTTGG + Intergenic
1190385220 X:49878366-49878388 CTGCCAGGGCTTAAGGGTCTTGG + Intergenic
1191765937 X:64698442-64698464 GTGGCAGTGCTGAATGGAAGTGG + Intergenic
1192798833 X:74446967-74446989 CTGGCATGGCTGGAGGCAGGAGG - Intronic
1192809387 X:74536031-74536053 CTGGCAGGAGTGAGGGAACGAGG - Intergenic
1194531587 X:95055710-95055732 CTGGCTGGGCAGCAGGGATGGGG - Intergenic
1195915210 X:109928790-109928812 CTGCCAAGGCTGAGGGGAGGTGG - Intergenic
1196334831 X:114519734-114519756 CTGGCAGGCCAGAAGAGACTGGG + Intergenic
1196893301 X:120310447-120310469 CTCGCAGGGCGGAATGGAGGGGG - Intronic
1198838457 X:140830307-140830329 CTGGCAGGGCAGAGAGGATGGGG + Intergenic
1199679067 X:150213123-150213145 CTGGCAGGGATGGAGGCAGGGGG + Intergenic
1200126781 X:153818998-153819020 CTGGCGGGCCTTAGGGGACGCGG + Intronic
1200215607 X:154366906-154366928 CAGGGAGGGCTGAAGGGTGGAGG - Intronic