ID: 999242539

View in Genome Browser
Species Human (GRCh38)
Location 5:150136263-150136285
Sequence CTGGGCCTTGGGCAGAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 344}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999242539_999242553 8 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242553 5:150136294-150136316 CTGGGTGGGAGAGAGATGGGAGG No data
999242539_999242555 12 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242555 5:150136298-150136320 GTGGGAGAGAGATGGGAGGGAGG 0: 1
1: 1
2: 37
3: 290
4: 2500
999242539_999242557 14 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242557 5:150136300-150136322 GGGAGAGAGATGGGAGGGAGGGG 0: 1
1: 2
2: 51
3: 612
4: 3511
999242539_999242554 9 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242554 5:150136295-150136317 TGGGTGGGAGAGAGATGGGAGGG 0: 1
1: 0
2: 10
3: 172
4: 1432
999242539_999242552 5 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242552 5:150136291-150136313 GCTCTGGGTGGGAGAGAGATGGG 0: 1
1: 0
2: 3
3: 35
4: 492
999242539_999242547 -7 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242547 5:150136279-150136301 GGCCCAGAGGTGGCTCTGGGTGG 0: 1
1: 1
2: 7
3: 54
4: 510
999242539_999242546 -10 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242546 5:150136276-150136298 CAAGGCCCAGAGGTGGCTCTGGG 0: 1
1: 1
2: 7
3: 40
4: 306
999242539_999242556 13 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242556 5:150136299-150136321 TGGGAGAGAGATGGGAGGGAGGG 0: 1
1: 2
2: 31
3: 285
4: 2415
999242539_999242548 -6 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242548 5:150136280-150136302 GCCCAGAGGTGGCTCTGGGTGGG 0: 1
1: 0
2: 6
3: 52
4: 429
999242539_999242558 20 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242558 5:150136306-150136328 GAGATGGGAGGGAGGGGCTTAGG 0: 1
1: 0
2: 8
3: 95
4: 911
999242539_999242551 4 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242551 5:150136290-150136312 GGCTCTGGGTGGGAGAGAGATGG 0: 1
1: 0
2: 7
3: 107
4: 792

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999242539 Original CRISPR CTGGGCCTTGGGCAGAACCT GGG (reversed) Intronic
900083233 1:874700-874722 CTGGGCCTTGGGCAGCGACGTGG + Intergenic
900568348 1:3346382-3346404 CAGGGCCTTGGGCAGAACACGGG + Intronic
900604207 1:3516583-3516605 CTGGGCCTGGGGCCGAGTCTGGG + Intronic
901828914 1:11880349-11880371 CTGGGCCAAGGGCATATCCTGGG - Intergenic
901858574 1:12059757-12059779 CTGTGCCTTGCACAGAGCCTAGG + Intergenic
903462577 1:23530006-23530028 CTGGGCCTGGGGGAGGACCTAGG + Intronic
903565826 1:24264905-24264927 CGGGGCCTGGGCCAGGACCTCGG + Intergenic
903846833 1:26283890-26283912 CTGGGCCTTGGGCTCACCCCTGG + Intronic
903947529 1:26973056-26973078 CTGGGCCTTGGCCAAACTCTGGG - Intergenic
904431887 1:30469637-30469659 CTGAGTCCTGGGCAGAGCCTTGG + Intergenic
905550375 1:38833207-38833229 CTGGGCCTTAGGGAGGGCCTTGG - Intergenic
906056792 1:42924295-42924317 CTGGCCCTTGGGGACGACCTGGG - Intergenic
906906108 1:49893902-49893924 GTGGGCCTTGGGCAAGACCCAGG + Intronic
907275395 1:53314084-53314106 CTGGGCCTTGGGCAGGAACCTGG - Intronic
907285215 1:53375723-53375745 CGGGGCCTTGGGCGGAAGCTGGG + Intergenic
907832737 1:58080432-58080454 CTGTCCCTTGGGCATAATCTTGG - Intronic
909430497 1:75582468-75582490 CTGGGCCTTGGTTTGATCCTTGG - Intronic
911445250 1:97984444-97984466 CTGGGGCCTGGGCAGAATCTGGG - Intergenic
912628011 1:111222377-111222399 CTGGGCCCAGTGCAGAACCAGGG - Intronic
912643994 1:111373284-111373306 CTGGGCCTTGGGCAAGATCCAGG + Intergenic
912747166 1:112254499-112254521 CTTGGCTTTGGCCAGAACTTTGG - Intergenic
913599586 1:120410380-120410402 CAGGGCCATGGGAAGAACCCTGG - Intergenic
914087795 1:144469235-144469257 CAGGGCCATGGGAAGAACCCTGG + Intergenic
914314357 1:146495753-146495775 CAGGGCCATGGGAAGAACCCTGG + Intergenic
914499992 1:148237628-148237650 CAGGGCCATGGGAAGAACCCTGG - Intergenic
914591287 1:149108177-149108199 CAGGGCCATGGGAAGAACCCTGG + Intergenic
915555233 1:156657517-156657539 CTGGCCCTTGAGCAGAGGCTGGG + Intronic
915721108 1:157986245-157986267 CTGGACCTGGGGAAGAATCTTGG + Intergenic
916873124 1:168938835-168938857 CTGGGCCTTGGTTTGATCCTTGG - Intergenic
916921348 1:169470916-169470938 CTGGGCCTTGCTCAGAACATGGG + Intronic
917151168 1:171946414-171946436 GTGGGCCTTTGGGAGAACATGGG + Intronic
917980556 1:180266439-180266461 CTGGGCCTTGCGGACCACCTGGG - Exonic
919669796 1:200328255-200328277 CGCAGCCTTGGGCAGAGCCTTGG - Intergenic
920872373 1:209805426-209805448 CTGGGCCTGGGAGACAACCTTGG - Intronic
922469366 1:225866483-225866505 CAGGGCCTGTGGCAGAGCCTGGG + Intronic
922670987 1:227508658-227508680 CTGGGCCTTGGGCATCTACTTGG + Intergenic
922896809 1:229107170-229107192 CTGAGGTTTGGGCAAAACCTCGG - Intergenic
922905881 1:229173480-229173502 CTGGGCCTTGGGCTGAGTCCCGG - Intergenic
1062763822 10:46680-46702 CTGGGCCTTGGGCAGTGACGTGG - Intergenic
1068865415 10:61889850-61889872 CTGGGCCTGCCGCAGAACTTGGG - Intergenic
1069898769 10:71695266-71695288 GGGAGCCTTGGGCAGAGCCTGGG - Intronic
1069920970 10:71815379-71815401 CCAGGCCTTGGGGACAACCTTGG + Exonic
1070493779 10:77002070-77002092 CTGGGCATTAGGCAGAGGCTGGG + Intronic
1070673452 10:78394610-78394632 ATGGGGCCTGGGCAGAAGCTGGG - Intergenic
1070969554 10:80552293-80552315 CTGGGCTTTTGGCAGCAGCTGGG - Intronic
1070982680 10:80662339-80662361 CTAGGCCTAGGGGAGAGCCTAGG - Intergenic
1071203768 10:83251291-83251313 CTTGGCCATGCGCTGAACCTTGG - Intergenic
1071295273 10:84214814-84214836 CAGGGCCTTGGGCAAGACATTGG + Exonic
1071567821 10:86680734-86680756 CGGGGCCTTGGGAAGGGCCTAGG - Intronic
1072662958 10:97373700-97373722 GTAGGCCTTGTGCAGAACCCAGG + Exonic
1073006798 10:100330708-100330730 CTGGGAGGTGGGCAGAGCCTGGG - Intergenic
1073052975 10:100681167-100681189 CCGGTCCTTGGGCAGAAGCTGGG + Intergenic
1073179256 10:101574088-101574110 CTGGGCCTTGGTGGGAGCCTGGG - Intronic
1073448787 10:103597186-103597208 CAGGGCCTGGGGCTGAGCCTGGG - Exonic
1074814583 10:117134668-117134690 CTGGGACTTGGGGAGAGCCCCGG - Intronic
1075671395 10:124266035-124266057 CTGGGCCTGGGGCAGCCACTGGG - Intergenic
1075810097 10:125218914-125218936 CCTGGCCTTGGGCAGCACCCAGG + Intergenic
1076806189 10:132860148-132860170 CAGGGCCTTGGGAAGGGCCTGGG - Intronic
1077117872 11:893468-893490 CCGGGCCTGGTGCAGAGCCTCGG + Exonic
1078195204 11:9131394-9131416 CTGGGCCATGGAGACAACCTGGG - Intronic
1078355094 11:10627145-10627167 CTGGGCCGTGAGCAGCACGTGGG + Intronic
1078739152 11:14050580-14050602 CTGGGCTTTTAGAAGAACCTAGG - Intronic
1080017455 11:27522373-27522395 CTGTGCCTTGGACAGACCCATGG - Intergenic
1080550601 11:33371099-33371121 CTGGGCCTTGGGGTGGGCCTGGG + Intergenic
1083501841 11:63115949-63115971 CTGGGCCTTGGTTTGACCCTTGG + Intronic
1083652765 11:64212733-64212755 CAGAGCCTGGGGCAGAGCCTGGG - Intronic
1083774496 11:64887900-64887922 CTGGGCCTAGGGCACAGCCCAGG - Intronic
1085824315 11:79827472-79827494 CAGAGCCTTGGGGAGAACTTTGG + Intergenic
1086443197 11:86848682-86848704 CTGGGCCTAAGGCAGACCTTTGG - Intronic
1089581058 11:119482245-119482267 CGGGGCCTGGGGCAGCCCCTTGG - Intergenic
1091540636 12:1458097-1458119 CTGGGCATTTGGCAGGACCATGG + Intronic
1092091053 12:5803910-5803932 CTGGGCCTTGGGGAGAACATGGG + Intronic
1094266345 12:28564747-28564769 CTGGGCCTTGGTTTGATCCTTGG + Intronic
1096839218 12:54370448-54370470 CAGGGACTTGGGCAGCTCCTTGG + Exonic
1098465723 12:70783926-70783948 CTGGGGCTGTGACAGAACCTGGG + Intronic
1100531712 12:95467466-95467488 CTGGGCCTTGGTTTGATCCTTGG + Intergenic
1101021040 12:100553985-100554007 CTGGACCTTGGGCTGGAGCTGGG + Intronic
1101960078 12:109242507-109242529 CTTGGCCTGGAGCAGATCCTTGG - Exonic
1102010072 12:109612797-109612819 CTGGGCATGGGGTAGAATCTGGG + Intergenic
1105266454 13:18822154-18822176 CTGGCCATTGGCTAGAACCTTGG - Intergenic
1107816511 13:44249630-44249652 CTAGGCCATGGTCAGAGCCTGGG - Intergenic
1108004707 13:45934914-45934936 CTGAGACTTTGGCAGAAGCTTGG + Intergenic
1111918363 13:94384949-94384971 CAGGGCCTTGCACAGAGCCTGGG - Intronic
1112852839 13:103728214-103728236 CTGGTCCTTGGGCCGCACCTTGG + Intergenic
1113561892 13:111287718-111287740 CTGTCCCTTGGGCACAGCCTGGG - Intronic
1113943620 13:114031907-114031929 CGTGGCCTGGTGCAGAACCTCGG + Intronic
1115310684 14:31975092-31975114 CTGGGTCATGGGCAGCAGCTGGG + Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1118439314 14:65798600-65798622 CTGGCCCTTGGGCAGATATTTGG + Intergenic
1119663198 14:76465888-76465910 CAGGGCCTTGGAGAGATCCTGGG + Intronic
1120237004 14:81903688-81903710 CTGGGGCTTGCCCAGAGCCTGGG + Intergenic
1120427133 14:84362641-84362663 CTCTGCCTTGGTCTGAACCTTGG + Intergenic
1120997134 14:90425571-90425593 CTGGGATTTGGGCAGGGCCTCGG - Intergenic
1121248864 14:92484612-92484634 CTGGGGCTGGGGCAGATGCTGGG - Intronic
1122115115 14:99523640-99523662 CTGGGCCTCAGGGAGGACCTGGG + Intronic
1122996891 14:105269896-105269918 CAGGGCCATGGGCTGACCCTGGG + Intronic
1124813571 15:32966066-32966088 CTGGGCCTTGGGAAGGTTCTGGG + Intronic
1125514239 15:40308974-40308996 CTGGGCCTGGGGCAGAGTGTGGG - Intergenic
1127598554 15:60511994-60512016 CTGTGCCTTGGTCTGAACGTGGG - Intronic
1127705667 15:61545179-61545201 GTTGGTCTTGGGCAGAACCCAGG - Intergenic
1127905579 15:63373652-63373674 CTAGGCCTTGGGCTAGACCTGGG - Intronic
1128834286 15:70796704-70796726 CTGGGCCTTGGTTTGATCCTTGG + Intergenic
1129305005 15:74653663-74653685 CTGGTCCTTAGCCAGAAACTTGG - Intronic
1129365367 15:75050761-75050783 ATGGGGCATGGGGAGAACCTGGG + Intronic
1129671827 15:77611955-77611977 GTGGGCCCTGGGAAGAACCCTGG + Intergenic
1129887508 15:79048954-79048976 CTGGCCACTGGGCAGATCCTTGG + Intronic
1132630014 16:912724-912746 CTGGGCCTTGCGGACACCCTGGG + Intronic
1132989771 16:2786749-2786771 CTGGGCCCTGGGCAGAACGAAGG - Intronic
1133199976 16:4198114-4198136 TTGGGCCTTGCCCAGATCCTTGG + Intronic
1134273306 16:12753894-12753916 GTGTGGCTTGGGGAGAACCTAGG + Intronic
1134813222 16:17185025-17185047 CTTGGCTTTCTGCAGAACCTTGG + Intronic
1135719957 16:24807888-24807910 CTGGGCTGTGGGCAGAGGCTGGG + Intronic
1138536994 16:57665720-57665742 GTGGGCCTTGGGGAGGACTTTGG - Intergenic
1139143842 16:64300421-64300443 CTGGTTCTTGGGTTGAACCTCGG + Intergenic
1139504405 16:67391888-67391910 CTGCGCCTAGGGCATAACCGTGG + Exonic
1140517616 16:75555766-75555788 CTGGGCCTGGGGCAGAGTCGGGG - Intronic
1141620892 16:85235990-85236012 CTGGGCCTGGGGCTGAGGCTGGG + Intergenic
1141849635 16:86636542-86636564 CTGGGGGTGGGGCAGAACATGGG + Intergenic
1142067133 16:88069029-88069051 CTGGGCCTGGGGCTGGAGCTGGG - Intronic
1142440822 16:90096544-90096566 CTGGGCCTTGGGCAGCGACGTGG + Intergenic
1142713509 17:1736051-1736073 CTGGGCGGTGGGCTGAACCCTGG + Exonic
1142851269 17:2705973-2705995 CTGGCCCATGGACAGATCCTGGG - Intronic
1143570447 17:7754759-7754781 CTGGGCCTTGGTTTGATCCTTGG - Intronic
1144466121 17:15499128-15499150 CTGGGCATTGGGCACTACCTGGG - Intronic
1144503487 17:15809354-15809376 CTGGGCCTTGGTTTGATCCTTGG + Intergenic
1144642496 17:16945270-16945292 GAGGGCACTGGGCAGAACCTTGG - Intronic
1145166533 17:20617066-20617088 CTGGGCCTTGGTTTGATCCTTGG + Intergenic
1145262878 17:21365228-21365250 CTGGGCCTTCGGCCGAGCCAGGG - Intergenic
1145314276 17:21720010-21720032 CTGGGCCTTGAGCACCCCCTTGG - Intergenic
1146287696 17:31585370-31585392 CTGGGCCTTGGCCACAGCCAGGG + Intergenic
1147390022 17:40103394-40103416 GTGGGCCTTGGGGAGGACCCCGG - Intergenic
1147855493 17:43476571-43476593 CTGGGCCTTGGTTTGATCCTTGG - Intergenic
1148214197 17:45825490-45825512 CTGGGCCTCAGGCACAGCCTGGG + Intronic
1148322862 17:46768123-46768145 ATGGTCCTTGGGCAGAGACTTGG - Intronic
1149188673 17:54031615-54031637 GTGGGCCTTGGGCAAGACCCAGG + Intergenic
1149468624 17:56898836-56898858 CAAGTCCTTGGGCAGAGCCTTGG - Intronic
1149596243 17:57866429-57866451 CCTGGCCTTGGGCAGTCCCTGGG + Intronic
1149640488 17:58199564-58199586 CCGGGCCTTGCCCAGAACCAGGG - Exonic
1150207089 17:63417253-63417275 CAAGGCCTTGGGCAGAACAAAGG - Intronic
1150319735 17:64202501-64202523 CAGGGACTTGGTCAGATCCTGGG - Intronic
1150649157 17:66998687-66998709 CTGGGCCTTGGGCACGCTCTGGG + Intronic
1151120316 17:71786254-71786276 CTGTGACTTGGGCAGAATTTGGG + Intergenic
1151890259 17:76947345-76947367 CAGGGCCGTGGCCAGAACCCAGG + Intronic
1152105363 17:78325534-78325556 CTGGGCCATGGGAAGAACACAGG + Intergenic
1152921211 17:83067466-83067488 CTGCGCCTGGGGGAGAGCCTGGG + Intergenic
1153659879 18:7317117-7317139 CTGGGGCTTTGGCAGAAGCAAGG - Intergenic
1155492929 18:26417700-26417722 CTGGGCCCTGGGAACAACCAAGG - Intergenic
1157665328 18:49481422-49481444 CTGGGCCTGGGTCTGGACCTGGG - Exonic
1157722989 18:49939691-49939713 CTGAGCCTGGGCTAGAACCTCGG + Intronic
1157810736 18:50693932-50693954 GTGGCCCTGGGGCAGAACCCTGG - Intronic
1158134043 18:54186591-54186613 CTGTGCATTGGGCAGAATATTGG - Intronic
1158604907 18:58887181-58887203 AGGGGCCCTGGGCAGAACCCAGG + Intronic
1160202397 18:76806598-76806620 GAGGGCCCTGGGCAGATCCTGGG - Intronic
1160232808 18:77060997-77061019 CTGGGCCTTTCTCAGAGCCTGGG + Intronic
1160715495 19:574680-574702 GGGGGCCTTGGGCAGAGGCTGGG + Intronic
1161238724 19:3210332-3210354 CTGGGCACCGGGCAGAACCTGGG - Intergenic
1161452450 19:4354141-4354163 CTGGGGCAGGGGCAGAACTTGGG - Intronic
1161653157 19:5497586-5497608 GTGGGCCTTGGAGAGAACTTGGG + Intergenic
1161767662 19:6216227-6216249 CTGGGCCTTGGGGTGGGCCTGGG - Intronic
1161857068 19:6772216-6772238 GTGGGCCTTGGGGAGGACTTGGG + Intergenic
1162402091 19:10452821-10452843 ATGGGCCTCAGCCAGAACCTAGG - Intronic
1164573865 19:29393863-29393885 CTGGGCCATGGGTAGAACTGGGG - Intergenic
1165093421 19:33397981-33398003 CTGCGGCCTGGGCAGGACCTGGG - Intronic
1165875143 19:39001232-39001254 CTGGGGATTGGGGATAACCTTGG + Intronic
1166770787 19:45280763-45280785 CTGGGCCTTGGGGAGAAGGAGGG - Intronic
1166851972 19:45765534-45765556 CTGGAGCTGGGTCAGAACCTTGG + Exonic
1167052601 19:47088855-47088877 CTGTGCTTTGGGGAGATCCTAGG - Intronic
1167253440 19:48413940-48413962 CTGGGGCCTGGGCTGGACCTTGG - Intronic
1167666521 19:50825679-50825701 CTGGGCCTTGGACAGGGTCTTGG + Intronic
1167898017 19:52597685-52597707 CAGGGCCTTGAACAGAATCTGGG + Intronic
924976348 2:179238-179260 GTGGGCCTTGGGTAGGTCCTGGG + Intergenic
924988697 2:293236-293258 CTGGGCCTGGGGCAGCAGCAGGG - Intergenic
925148236 2:1595122-1595144 CTGGGCCCTGCACAGAACCCCGG - Intergenic
926105202 2:10145624-10145646 GTGGGCCTGGGGCAGACCCCAGG + Intronic
926134407 2:10326412-10326434 CTGGGCCTGCTTCAGAACCTTGG + Intronic
926380997 2:12289013-12289035 CTGGAACTTGGGCACAACCAGGG + Intergenic
926891818 2:17645176-17645198 CTGGGCCTTGGGCAGAGCCCTGG + Intronic
927832594 2:26365491-26365513 TTTGGCCTGGGGCAGAAGCTGGG - Intronic
927878295 2:26673470-26673492 CTGGCTTCTGGGCAGAACCTGGG + Intergenic
929879504 2:45823746-45823768 CTGGGCCCAGGGAACAACCTGGG - Intronic
930717712 2:54608408-54608430 ATGGGCCTTGGCCTGAGCCTTGG + Intronic
932309636 2:70729215-70729237 GTGGGCCTCTGGCAGAAGCTGGG - Intronic
933636523 2:84714082-84714104 CTGGAGCTGGGGCAGCACCTGGG - Intronic
933984731 2:87581140-87581162 CTGGGCCTGGGTCAGAATCCTGG + Intergenic
934053842 2:88235089-88235111 TTTGGCCATTGGCAGAACCTTGG + Intergenic
934071533 2:88388914-88388936 CTGGGCCCTGGGGAGAGACTGGG + Intergenic
934765141 2:96876346-96876368 CAGGGCAGTGGGCAGCACCTGGG - Intronic
934865073 2:97801213-97801235 TTTGGCCTTGGGCAGAAACAAGG + Intronic
934991575 2:98925238-98925260 CAGGGCCTGGGGCTGAGCCTAGG - Intronic
935282824 2:101533915-101533937 ATGGGCCTTGAGCTGAAACTTGG + Intergenic
936008244 2:108908658-108908680 ATGTGCCTAGGGCAGACCCTGGG - Intronic
936269652 2:111040112-111040134 CTGGTGTTAGGGCAGAACCTGGG - Intronic
936309120 2:111369660-111369682 CTGGGCCTGGGTCAGAATCCTGG - Intergenic
937314401 2:120921786-120921808 CCAGGCCATGGGAAGAACCTTGG - Intronic
937865248 2:126746202-126746224 CTATGCCTAGGGCTGAACCTGGG + Intergenic
937927237 2:127176695-127176717 CTGGCCCATGGGAAGAACGTTGG - Intergenic
938707853 2:133949033-133949055 CTCAGCCTTTGGCAGCACCTAGG + Intergenic
938785808 2:134628358-134628380 CTGGCCCTTGGCCAGAGACTAGG + Intronic
939407084 2:141772498-141772520 CTGGGTCTTGGGAAGCGCCTGGG - Intronic
939660773 2:144886958-144886980 CAGGGCCTGGGGGAGGACCTCGG + Intergenic
942177706 2:173350453-173350475 CTTGGCCATGGGAAGAACTTTGG - Intergenic
945996177 2:216438258-216438280 CTGGGCCTAGGTCAGGACCCAGG - Intronic
946061565 2:216946240-216946262 CTGAGCCTAGGGCAGGACCCAGG - Intergenic
946195777 2:218032487-218032509 CTGGGCCTACGGCAGGGCCTGGG + Intergenic
946573383 2:221048717-221048739 CTGGGCCTTGCCAGGAACCTGGG - Intergenic
946774670 2:223125041-223125063 CTGGGGCAAGGGCAGGACCTTGG + Intronic
947581718 2:231323962-231323984 GGGGGCCTGGGGCAGAACCAGGG - Intronic
947705457 2:232271776-232271798 CTGAGCTTTGGGGAGAACCTGGG + Intronic
947911948 2:233807434-233807456 CCGGGCCTTGGGCTTCACCTTGG + Exonic
948059536 2:235032841-235032863 CTACGCCTTGGGGAGAACCCCGG - Intronic
948100587 2:235369784-235369806 AGGGGCCTTGGACTGAACCTTGG + Intergenic
948163736 2:235845211-235845233 CTGGGCCTTTGTGAGATCCTGGG - Intronic
948368310 2:237472865-237472887 CTGGGCCTGGGACAGAGGCTGGG + Intergenic
948892656 2:240914928-240914950 CTGCGCCTGGGGCATCACCTTGG - Intergenic
948950729 2:241249576-241249598 CTTGGCCTTGGCCACACCCTGGG - Intronic
1170494825 20:16914805-16914827 CTGGGCCTGGGCCAGCATCTGGG - Intergenic
1171203155 20:23257740-23257762 CTGAGCCTGGGGCAGAGCCTGGG - Intergenic
1171367618 20:24636920-24636942 CTGCGCCCCAGGCAGAACCTAGG - Intronic
1171947294 20:31389926-31389948 CTGGGGCTTGGGCTGAGGCTGGG - Intronic
1172020662 20:31911535-31911557 ATGGGCCAGGGGAAGAACCTGGG - Intronic
1172218778 20:33257465-33257487 CTGGGCCCTAGGCTGACCCTCGG - Intergenic
1172425683 20:34854508-34854530 GTGGGTCTTGGGCAGGACCTGGG - Intronic
1173334502 20:42101753-42101775 CTGGGCCTTGGCCTGAGCGTGGG - Intronic
1174114349 20:48216629-48216651 CTGGGAGTTTGGCAGAGCCTGGG - Intergenic
1174159615 20:48541512-48541534 CTGGGGTCTGGGCAGAACCAAGG + Intergenic
1175387806 20:58608491-58608513 CAGGGCCTGGGGCAGAAGCTAGG - Intergenic
1175732237 20:61361903-61361925 CTGGGCCTGGAACAGTACCTGGG - Intronic
1175924309 20:62464572-62464594 CGGAGCCTTGGGCCGCACCTGGG + Exonic
1176113935 20:63422926-63422948 CTGTGATTTGGGCGGAACCTCGG - Intronic
1176455255 21:6902499-6902521 CTGGGCCTGGGTGAGTACCTGGG + Intergenic
1176833427 21:13767547-13767569 CTGGGCCTGGGTGAGTACCTGGG + Intergenic
1178493889 21:33071071-33071093 CTGGGCCTGGGGCGCGACCTCGG + Exonic
1178589367 21:33896326-33896348 CTGGGCCTTGGGCATCCACTGGG + Exonic
1178598205 21:33973618-33973640 CTGGACCTTGGGAGGACCCTTGG - Intergenic
1179494508 21:41763357-41763379 CTGAGCCTGGAGAAGAACCTTGG - Intronic
1179655881 21:42844555-42844577 CTGGATCTTGGTGAGAACCTCGG + Intronic
1179830798 21:43994730-43994752 CTGGGCCATAAGCACAACCTGGG + Intergenic
1179836096 21:44034460-44034482 CTGTGCCCTGTTCAGAACCTAGG - Intronic
1180048716 21:45321517-45321539 CTGGCCTGTGGGCAGGACCTTGG - Intergenic
1181422552 22:22811836-22811858 CTGAGCCTGGGGCAGGGCCTGGG - Intronic
1181508785 22:23379613-23379635 CTGGGCCCTGGGCAGAGCTCTGG + Intergenic
1181883173 22:25997747-25997769 CTGGGGCCTGGGCAGGAGCTGGG - Intronic
1182300600 22:29334813-29334835 CTGGGCCTCGGCCAGAATCTGGG + Intronic
1183064564 22:35354137-35354159 CTGGGCCTGGGGCTGCGCCTAGG + Intergenic
1183178912 22:36245385-36245407 CTGGACCAGGGGCAGAACCAGGG + Intergenic
1183198477 22:36369523-36369545 CTGGTCCTTGTGGGGAACCTGGG - Intronic
1184198043 22:42945355-42945377 GAGGGCCTGGGACAGAACCTGGG - Intronic
1184352168 22:43951687-43951709 CTGGGCCTTGGTGACAAGCTCGG - Intronic
1184731829 22:46374900-46374922 CTCGGCCTCGGGAAGCACCTGGG + Intronic
1185343641 22:50302192-50302214 CAGGGTGTTGGGCAGGACCTGGG + Intronic
950518980 3:13485113-13485135 CCGGGCCTTGGGGAGACCCCTGG + Intronic
950534516 3:13571332-13571354 CTGGGGCAAGGGCAGAAGCTGGG + Exonic
952772662 3:37016592-37016614 CTGGGCCTTGGTTTGATCCTTGG + Intronic
954038748 3:47868404-47868426 ATGAGCCTTGGTCTGAACCTAGG + Intronic
954620706 3:51993821-51993843 CTGGGCCTTGGTTTGATCCTTGG + Exonic
957366038 3:79225243-79225265 CTGTGCCTTGGGCATAAGATAGG + Intronic
960573429 3:119206854-119206876 CTGGGGCTGGGGCTGAGCCTGGG - Intergenic
960936065 3:122903414-122903436 CTGGGCCCTGGGAGGAGCCTGGG + Intergenic
961136744 3:124518631-124518653 CTGGGCCATGGGCTCACCCTCGG + Exonic
961387003 3:126528462-126528484 GTGGGCCTTGGGGGGAACCAGGG + Intronic
962949142 3:140202103-140202125 GTGGGCCATGGTCAGAACATAGG + Intronic
963441933 3:145351368-145351390 CTGGGCATTGTGCAGAAACTAGG - Intergenic
963962167 3:151321998-151322020 CTCAGCCTTGGTCAGAAACTGGG - Intronic
966694787 3:182778563-182778585 CTGGGCCCTGAGCAACACCTGGG - Intergenic
968357582 3:198121133-198121155 CTGGGCCTTGGGCAGCGACGTGG + Intergenic
968646720 4:1744729-1744751 CTGGGCCTTGCTCCGGACCTGGG - Exonic
968771416 4:2509928-2509950 CTGGCCCTTGGGGAAAGCCTTGG - Intronic
969378389 4:6778275-6778297 CTGGGCCTTGGAGAAAAGCTGGG + Intergenic
969418380 4:7075640-7075662 CTGGGCTGTGGGCACAGCCTGGG - Intergenic
969688190 4:8688658-8688680 CTGGGCCGGGGGCGGAACCCAGG + Intergenic
975957672 4:79861161-79861183 CTGGGACCTGGGTACAACCTGGG + Intergenic
977127595 4:93189087-93189109 CTGGGTAATGGGCAGAACCTGGG - Intronic
981341497 4:143626741-143626763 CTGGGCCTGGAGCAGAGACTAGG + Intronic
983475715 4:168209231-168209253 CTGGGCCTTGCTGACAACCTGGG - Intergenic
985440959 4:189982131-189982153 CTGGGCCTTGGGCAGCGACGTGG - Intergenic
985791463 5:1930754-1930776 CCGGGCCTTGGTCACCACCTGGG - Intergenic
985797352 5:1972845-1972867 CTTGGCCAAGGGGAGAACCTAGG - Intergenic
985827684 5:2205007-2205029 CTGGGGCTTGGGCGGGACCCCGG + Intergenic
988708946 5:33754380-33754402 CTGGGCATTCAGAAGAACCTGGG + Intronic
988972050 5:36478494-36478516 GTGGGCCAAGGGCAGAACCTGGG + Intergenic
989338566 5:40348652-40348674 CTGGGACTTGGTCATAAACTGGG + Intergenic
989409034 5:41096043-41096065 CTGAGCCTTGGGGAAATCCTAGG + Intergenic
989648992 5:43666837-43666859 CTGGGCCTTGGTTTGATCCTTGG + Intronic
990823138 5:59865513-59865535 CTGGGTTTGGGGAAGAACCTAGG - Intronic
990900050 5:60739847-60739869 GTGGGCCTTGTGCAAGACCTAGG + Intergenic
991977827 5:72200028-72200050 TTGGCCATTGAGCAGAACCTGGG + Exonic
995341915 5:111070359-111070381 CTGGTCCTTGGGAAGTTCCTAGG - Intronic
996301252 5:121988766-121988788 CTGGACCTTGGCCAGCTCCTAGG - Intronic
997284666 5:132669529-132669551 CAGGGCCATGGGCAGTGCCTTGG - Intergenic
997444817 5:133933371-133933393 CTGGGCCTGGGGCAGCCCCATGG - Intergenic
998991754 5:147824652-147824674 CTGGGCCTTGCTGAGAACCAAGG - Exonic
999242539 5:150136263-150136285 CTGGGCCTTGGGCAGAACCTGGG - Intronic
999321504 5:150618307-150618329 CTGGGCCTGGGCCAGGGCCTGGG - Exonic
999475595 5:151895749-151895771 GTGGGCCATGGGAAGCACCTGGG - Intronic
999805140 5:155074006-155074028 CTGGGCCTTGGGCAGGTCTCTGG - Intergenic
1000254085 5:159521284-159521306 CTGACCCTGGGGCAGAACCCGGG + Intergenic
1001329212 5:170750537-170750559 CTGGGCTCTGGGCAAAGCCTGGG - Intergenic
1002075793 5:176707737-176707759 CTGGGGCCTTGGCAGAACCCTGG - Intergenic
1002159991 5:177309398-177309420 CTGGCCTGTGGGCAGGACCTGGG - Intronic
1002416538 5:179123746-179123768 CTGGCCCTTGTGCAGCTCCTGGG + Intronic
1002718220 5:181242128-181242150 TGGGGCCTTGGGAAGAATCTGGG - Intronic
1003611789 6:7620772-7620794 CTGGGCCTTGGTTTGATCCTTGG - Intergenic
1005219178 6:23566453-23566475 CTGTGCACTGGGAAGAACCTGGG - Intergenic
1006918064 6:37608774-37608796 TTGGGCCTGAGTCAGAACCTTGG + Intergenic
1007662187 6:43493638-43493660 CTGAGCTTTAGGCAGAACCCCGG + Intronic
1007762337 6:44140376-44140398 CTGGGGATGGGGCAGGACCTGGG - Intronic
1008638652 6:53438037-53438059 CTGGGTAATGGGCAGAGCCTGGG + Intergenic
1010161187 6:72857911-72857933 CTGGGCATTGGGCAAACTCTTGG + Intronic
1010982145 6:82380369-82380391 CTGGGCCTTGGTGAGGACATAGG - Intergenic
1011289780 6:85765120-85765142 CTGGGCCTTGAGAAGACTCTAGG + Intergenic
1011379674 6:86729780-86729802 CTGGGCCTTGGTTTGATCCTTGG + Intergenic
1014146066 6:117999354-117999376 CTGGGCCTTGGTTTGATCCTTGG - Intronic
1014514315 6:122362265-122362287 CTGGGATTGTGGCAGAACCTGGG - Intergenic
1015571459 6:134625463-134625485 CTGGGGCTAGGACAGAACCTAGG + Intergenic
1016387579 6:143543487-143543509 CTGGGCCTGGGGGAGAACCTAGG + Intronic
1016461779 6:144285942-144285964 CTGGGACTTGGGAAGCAGCTCGG - Intronic
1019260980 7:81874-81896 CTGTGCTGTGGGCAGAAGCTGGG - Intergenic
1020220444 7:6232551-6232573 CTGAGCCCTGGGCAGAAGTTTGG - Intronic
1020965379 7:14859916-14859938 CTGGGCTTTGGGTACAACTTCGG - Intronic
1021823370 7:24519945-24519967 ATGAGCCTTGAGCAGTACCTGGG + Intergenic
1022167766 7:27787260-27787282 CTAGTCATTTGGCAGAACCTGGG + Intronic
1023980789 7:45068824-45068846 CTGGGCCTGGGGCAGGACCTGGG - Intronic
1023988057 7:45109577-45109599 GGAGGCCTTGGGCAGGACCTGGG - Intronic
1024866532 7:53910185-53910207 CTGGCCCATGGGCGGAACCTGGG + Intergenic
1024988091 7:55213281-55213303 CTGGGCCTTGAGCAGAATGCTGG - Intronic
1025078383 7:55962821-55962843 CTGGGGGTGGGGGAGAACCTGGG - Intronic
1025812826 7:64885985-64886007 AGGGGCCTTGGGCAGAAGCAGGG + Intronic
1027838751 7:83279766-83279788 GTGGGGCTTGGCCAGAACCAGGG - Intergenic
1029203549 7:98855077-98855099 CTGGGCCATGGGGAGAGCATGGG - Intronic
1030072201 7:105707467-105707489 CTGGGCTATGGGCTGAACCCTGG + Intronic
1032153586 7:129450741-129450763 AAGGCCCTTGGGCAGAAGCTGGG - Intronic
1034115355 7:148579057-148579079 CAGGGCCATGGACAGAAGCTTGG + Intergenic
1034147933 7:148888675-148888697 CTGGGCCTGAGGCAGAAGCGTGG + Intergenic
1034721690 7:153299532-153299554 CGGGGCATGGGGGAGAACCTGGG + Intergenic
1035326215 7:158067811-158067833 CTGGGCCGTGGGCAGCACACTGG + Intronic
1035326222 7:158067840-158067862 CTGGGCCATGGGCAGCACACTGG + Intronic
1036674388 8:10818004-10818026 ATCGGTCTTGGGCAGAACCCTGG + Intronic
1037540267 8:19864195-19864217 CTTGGCCTTGGGAAGAAGTTAGG - Intergenic
1037814305 8:22103723-22103745 CTGGGCCCTGGGCAGAAGGGAGG - Exonic
1037828828 8:22176696-22176718 CAGGGCCCAGGGCAGAACCTGGG - Intronic
1039118007 8:34113870-34113892 CTGGGTCCTTGGCAAAACCTAGG - Intergenic
1039981123 8:42410775-42410797 CTGTCCCTTGAGCAGACCCTCGG - Intergenic
1042428275 8:68673814-68673836 CTGGGCCTTGGGCAAGACCTAGG + Intronic
1044480252 8:92678630-92678652 CTGGGCCATGGGCAGATATTTGG + Intergenic
1045485538 8:102628218-102628240 CTGGGCTTTGGGCCAAAGCTGGG - Intergenic
1045713279 8:105011474-105011496 CTGGGCCTTGGTTTGATCCTTGG - Intronic
1047114517 8:121825934-121825956 CTGGGCATTGGGAAGAATTTTGG - Intergenic
1048508288 8:135040573-135040595 CTGGACCTTGGGCTAAACCAAGG + Intergenic
1048809371 8:138271477-138271499 CTAGGTCTTGGGCAAAACATTGG + Intronic
1048939556 8:139386496-139386518 CTGGGCCTTGGGTGGACCCCAGG - Intergenic
1049487594 8:142874663-142874685 GTGGGGCTTGGGCAATACCTGGG - Intronic
1049492380 8:142912270-142912292 ATGGGGCTTGGGCAAGACCTGGG - Intronic
1051214433 9:14780936-14780958 TTGGGTCTTGGGCAGACGCTAGG + Intronic
1051360692 9:16278972-16278994 CTGCTCCTTGCCCAGAACCTGGG - Intergenic
1052347540 9:27425511-27425533 CAGAGCCTGGGGCAGCACCTTGG + Intronic
1056088866 9:83184971-83184993 CTGGGTCTGGGGCAGAGCCTGGG - Intergenic
1056678217 9:88694974-88694996 CTGGAACTTGCCCAGAACCTGGG + Intergenic
1059311317 9:113390692-113390714 CTGGGTTTTGGGGAGCACCTTGG + Intronic
1060975765 9:127764129-127764151 CTGGGACAGGGGCAGAGCCTTGG + Intronic
1061272073 9:129549456-129549478 CTGGGCCCTGGACGGCACCTGGG - Intergenic
1062252760 9:135606533-135606555 CTGGCCCATGGGCAGAAGCCAGG - Intergenic
1062389529 9:136328357-136328379 CTGGGCCCAGGGCAGCCCCTGGG - Intronic
1062741429 9:138177623-138177645 CTGGGCCTTGGGCAGCGACGTGG + Intergenic
1186618646 X:11215054-11215076 CTGGGCCCTGGGAACCACCTGGG - Intronic
1187748096 X:22431647-22431669 CTGGGCTGTGGGCAGGACCATGG + Intergenic
1189097411 X:38155049-38155071 CTGGCTCTTGGCAAGAACCTTGG + Intronic
1191924451 X:66295086-66295108 GTGGGCCTTGGGCAAGACCCAGG - Intergenic
1192834476 X:74784734-74784756 CTGGTCCTTGGCCAGCTCCTGGG + Intronic
1195211318 X:102654026-102654048 CTGGGCCTGGGTCCTAACCTTGG - Exonic
1196639335 X:118039768-118039790 ATGAGCCTTGGGCAAAACCCAGG + Intronic
1196758308 X:119177395-119177417 CTGGGTCCTGGGCAGAACAATGG - Intergenic
1197785106 X:130190916-130190938 CCTTGCCTTGGGCAGAAGCTGGG + Intergenic
1200124212 X:153805645-153805667 CTGGCCCTGGGGCGGACCCTGGG + Intronic