ID: 999242539

View in Genome Browser
Species Human (GRCh38)
Location 5:150136263-150136285
Sequence CTGGGCCTTGGGCAGAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 344}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999242539_999242552 5 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242552 5:150136291-150136313 GCTCTGGGTGGGAGAGAGATGGG 0: 1
1: 0
2: 3
3: 35
4: 492
999242539_999242556 13 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242556 5:150136299-150136321 TGGGAGAGAGATGGGAGGGAGGG 0: 1
1: 2
2: 31
3: 285
4: 2415
999242539_999242554 9 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242554 5:150136295-150136317 TGGGTGGGAGAGAGATGGGAGGG 0: 1
1: 0
2: 10
3: 172
4: 1432
999242539_999242551 4 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242551 5:150136290-150136312 GGCTCTGGGTGGGAGAGAGATGG 0: 1
1: 0
2: 7
3: 107
4: 792
999242539_999242557 14 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242557 5:150136300-150136322 GGGAGAGAGATGGGAGGGAGGGG 0: 1
1: 2
2: 51
3: 612
4: 3511
999242539_999242547 -7 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242547 5:150136279-150136301 GGCCCAGAGGTGGCTCTGGGTGG 0: 1
1: 1
2: 7
3: 54
4: 510
999242539_999242553 8 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242553 5:150136294-150136316 CTGGGTGGGAGAGAGATGGGAGG No data
999242539_999242555 12 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242555 5:150136298-150136320 GTGGGAGAGAGATGGGAGGGAGG 0: 1
1: 1
2: 37
3: 290
4: 2500
999242539_999242546 -10 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242546 5:150136276-150136298 CAAGGCCCAGAGGTGGCTCTGGG 0: 1
1: 1
2: 7
3: 40
4: 306
999242539_999242558 20 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242558 5:150136306-150136328 GAGATGGGAGGGAGGGGCTTAGG 0: 1
1: 0
2: 8
3: 95
4: 911
999242539_999242548 -6 Left 999242539 5:150136263-150136285 CCCAGGTTCTGCCCAAGGCCCAG 0: 1
1: 0
2: 5
3: 23
4: 344
Right 999242548 5:150136280-150136302 GCCCAGAGGTGGCTCTGGGTGGG 0: 1
1: 0
2: 6
3: 52
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999242539 Original CRISPR CTGGGCCTTGGGCAGAACCT GGG (reversed) Intronic