ID: 999242844

View in Genome Browser
Species Human (GRCh38)
Location 5:150137548-150137570
Sequence CAGGAAATGGAGGAGGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 631}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999242833_999242844 15 Left 999242833 5:150137510-150137532 CCAGAACCCAGAGAACTCCCGCA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG 0: 1
1: 0
2: 6
3: 66
4: 631
999242834_999242844 9 Left 999242834 5:150137516-150137538 CCCAGAGAACTCCCGCAGCTCCA 0: 1
1: 0
2: 0
3: 15
4: 150
Right 999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG 0: 1
1: 0
2: 6
3: 66
4: 631
999242835_999242844 8 Left 999242835 5:150137517-150137539 CCAGAGAACTCCCGCAGCTCCAC 0: 1
1: 0
2: 1
3: 11
4: 149
Right 999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG 0: 1
1: 0
2: 6
3: 66
4: 631
999242837_999242844 -3 Left 999242837 5:150137528-150137550 CCGCAGCTCCACAAGCACAACAG 0: 1
1: 0
2: 6
3: 20
4: 293
Right 999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG 0: 1
1: 0
2: 6
3: 66
4: 631
999242836_999242844 -2 Left 999242836 5:150137527-150137549 CCCGCAGCTCCACAAGCACAACA 0: 1
1: 0
2: 0
3: 24
4: 233
Right 999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG 0: 1
1: 0
2: 6
3: 66
4: 631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999242844 Original CRISPR CAGGAAATGGAGGAGGCTGT GGG Intronic
900403928 1:2484183-2484205 GAGTATATGGAGGTGGCTGTGGG + Intronic
900419724 1:2550686-2550708 CAGGAAGAGGAGGAGGCAGCCGG + Intergenic
901049065 1:6417227-6417249 CAGGATATGAAGGAAGCTGTAGG - Exonic
901319287 1:8329928-8329950 CAGGAAGTGGAAGGGGATGTAGG + Intronic
901527276 1:9831505-9831527 TTGGAACTGGGGGAGGCTGTTGG + Intergenic
901533961 1:9870897-9870919 CAGGAAATGGAGATGTCTGGGGG - Intronic
901746926 1:11380000-11380022 AAGGCAATGGAGGAGGGAGTCGG + Intergenic
902436423 1:16400830-16400852 CAGGAGATGGAAGCGGCCGTAGG - Exonic
903027316 1:20438571-20438593 AAGGAAATGAAGGCGGCTTTTGG + Intergenic
903261643 1:22134766-22134788 GAGGAACTGGGAGAGGCTGTGGG - Intronic
903569731 1:24295334-24295356 AAGGAAAAGGGGGAGGCTGAGGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903619594 1:24688330-24688352 GAGGAAACAGAGGAGGCTGAGGG - Intergenic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
904350899 1:29905814-29905836 CAGGAAGTGGAGGTTGCAGTGGG - Intergenic
904496864 1:30892038-30892060 CAGGACCTGCAGGAGGCTGGAGG - Intronic
904646402 1:31970546-31970568 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
905402679 1:37715101-37715123 CAGGAGATGGAGGTTGCAGTGGG - Intronic
905653834 1:39673156-39673178 CAGGACCTGGTGGAGGCTGAGGG - Intergenic
905959405 1:42031221-42031243 CAGGAAGTAGAGGACGTTGTAGG - Intronic
906052749 1:42888256-42888278 CGGGAAGTGGAGGAGCCTGCGGG - Intergenic
906401425 1:45507585-45507607 GAGGAACTGGAGGCAGCTGTAGG - Intronic
906858671 1:49335145-49335167 ACTGAAATGGAGAAGGCTGTGGG - Intronic
907035068 1:51208907-51208929 CAGGAGGTGGAGGTGGCAGTGGG + Intergenic
907165381 1:52406060-52406082 CAGGAAATGGGGGTTGCAGTGGG - Intronic
907372116 1:54010379-54010401 AAGGAAGTGGGGGAGGCTCTGGG + Exonic
907405976 1:54253738-54253760 CAGGACATGGAGGTGGATGGGGG + Intronic
907486258 1:54780412-54780434 CAGGAGATGGAGGTTGCAGTGGG + Exonic
907598821 1:55746061-55746083 CAGGGAATGGAGGAGACATTAGG + Intergenic
908627825 1:66066269-66066291 TAGGGGATGGAGGAGGCTGCGGG - Intronic
908721040 1:67126255-67126277 CAGGAAGAGGAGCAGGCTGGAGG - Intronic
908730066 1:67216947-67216969 CAGAAAGGGGAGGAGGTTGTAGG + Intronic
908984729 1:70003679-70003701 AAGGAAGTGGAGGAGGAAGTAGG - Intronic
909019329 1:70413813-70413835 CAGGAGGTGGAGGATGCAGTGGG - Intronic
909814361 1:79973609-79973631 CAGGGACTGGAGGAAGATGTTGG - Intergenic
910991238 1:93058733-93058755 GAGGTAAAGGAGGAGGCTGGGGG + Intergenic
911090288 1:94012157-94012179 CTGGAGAGGGAGGAGGTTGTGGG - Intronic
911669188 1:100588963-100588985 CAGGAATTGGAGGAGGTTCTAGG - Intergenic
911832820 1:102576518-102576540 CAGGAAATTGAGGCTGCAGTGGG - Intergenic
912364721 1:109123874-109123896 CAGGAGATGGAGGTTGCAGTGGG - Intronic
912433326 1:109641326-109641348 CAGGACATGGAGGAAGCTCTAGG + Intergenic
912498510 1:110106642-110106664 CCGGGAAGGGAGGAGGCTTTAGG + Intergenic
912528507 1:110303132-110303154 AGGGGGATGGAGGAGGCTGTGGG + Intergenic
912700947 1:111877879-111877901 AAGCAAAAGGAGGAGGCTGATGG + Intronic
913189604 1:116402512-116402534 CAGGAAGTGAATGAGGCTGATGG - Intronic
913234552 1:116768564-116768586 CAGGTGGTGGAGGAGGATGTTGG - Exonic
913508321 1:119539665-119539687 CAGGAAGTGGAGGTTGCAGTGGG + Intergenic
915280417 1:154818604-154818626 CAGGGAAGGCAGGAGGCTGAGGG - Intronic
916170636 1:161999123-161999145 AAAGAAATGGGGGAGGCTGCAGG + Intronic
916407324 1:164510293-164510315 CAGGAAGAGGAGGAGGAGGTAGG - Intergenic
916546614 1:165811709-165811731 CAGGAAGTGGAGGTTGCAGTGGG - Intronic
917804144 1:178598283-178598305 GAGGGTATGGAGGAGGCTCTGGG - Intergenic
918322279 1:183375603-183375625 CAGGAGATAGGGGAGGCTGCAGG - Intronic
918477054 1:184936222-184936244 CTGGAAATGGAGGATCCTGAGGG + Intronic
919059833 1:192618544-192618566 CTGGAAGTGGAGGAGGGTGAGGG - Intergenic
919186041 1:194151621-194151643 CAGGAAGTGGAGGTTGCAGTGGG - Intergenic
919802278 1:201361151-201361173 CAGGAGCTGAAGGGGGCTGTTGG + Intronic
919972230 1:202588666-202588688 CAGGAGTTGTAGGAGGCTGGTGG - Exonic
920789866 1:209079723-209079745 GGGAAAATGGAGGAGGATGTTGG - Intergenic
920820104 1:209372262-209372284 CAGGAAATGGAGGAAGTGGAAGG + Intergenic
920832944 1:209481630-209481652 CAGCACTGGGAGGAGGCTGTGGG + Intergenic
920920365 1:210293018-210293040 CTGGAAAAGGAGGAGGCTGTGGG - Intergenic
922033220 1:221824576-221824598 CAGGAAATGGGGGAGCATGTAGG - Intergenic
922514706 1:226198402-226198424 CAGGAAGTGGAGGTTGCAGTGGG + Intergenic
922693853 1:227716217-227716239 CAGGAGATGGAGGCTGCAGTGGG + Intergenic
922715675 1:227869949-227869971 CAGGATGTGGTGGATGCTGTTGG + Intergenic
923015716 1:230125297-230125319 CAGAGAAGGGAGGGGGCTGTGGG + Intronic
923472888 1:234307940-234307962 AAGGAAGTAGAGGAGGCCGTGGG - Intronic
923919927 1:238552500-238552522 CAGGAAGTCAAGGAGACTGTGGG - Intergenic
924088496 1:240478790-240478812 CAGAAACTGGAGTAGGCTTTGGG + Intergenic
924640016 1:245824780-245824802 CAGGAGATGGAGGTTGCAGTGGG + Intronic
924673182 1:246149085-246149107 CAGTAGCTGGAGGAGGATGTGGG + Intronic
924718592 1:246602103-246602125 CTGGAAATGGTGCAGTCTGTTGG - Intronic
1063376218 10:5556118-5556140 CAGGGCATTTAGGAGGCTGTGGG - Intergenic
1063961600 10:11310369-11310391 CAGGGAAGGGAGCAGGTTGTGGG + Intronic
1064588998 10:16869237-16869259 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1064633151 10:17337821-17337843 TAAGAAATGGAGGACACTGTGGG + Intronic
1064709652 10:18110466-18110488 CAGTTAATGGTGGAGGGTGTCGG - Intergenic
1065248471 10:23784895-23784917 CAAGAAATGATGGAGGCAGTGGG - Intronic
1066995110 10:42555947-42555969 CAGGAGTTGGAGGAGCCTGCAGG - Intergenic
1066996253 10:42566798-42566820 CTGGATGTAGAGGAGGCTGTTGG - Intergenic
1067318714 10:45198055-45198077 CAGGAGGAGGAGGCGGCTGTAGG - Intergenic
1067987891 10:51171388-51171410 AAGTGAATGGAGGAGGCTGGTGG + Intronic
1068559953 10:58503197-58503219 AAGGAATTGAAGGAGGCTTTCGG + Intergenic
1069590786 10:69640659-69640681 CAGGAAAAGGAACACGCTGTTGG - Intergenic
1070338047 10:75472287-75472309 CAGGTAATGAAGGAGGCAGAAGG + Intronic
1070364533 10:75723500-75723522 CAGGAGAAGGAGGGGGCTCTTGG + Intronic
1070370437 10:75777269-75777291 AAGGAAATGGAAGGGGCTGGGGG - Intronic
1071122293 10:82293079-82293101 CAATACATGGAGGAGGCTTTTGG + Intronic
1073099231 10:100998295-100998317 CAGAAAGAGGAGGAGGCTCTCGG + Intronic
1073118813 10:101108698-101108720 CAGGGGATGGAGGAGGCAATGGG + Intronic
1073642138 10:105263606-105263628 GAGTAAAGCGAGGAGGCTGTGGG - Exonic
1073763697 10:106658586-106658608 CAGGAAATGAAGGAAGCCTTGGG + Intronic
1073941462 10:108703496-108703518 CATGAATCAGAGGAGGCTGTAGG + Intergenic
1074014826 10:109523812-109523834 CAGGAAATTGAGGCTGCAGTGGG - Intergenic
1074885227 10:117688178-117688200 CAGGAAATGGGAGAGGTTGGTGG + Intergenic
1074908438 10:117885293-117885315 CAGGAGAGGGAGGCTGCTGTGGG - Intergenic
1075077307 10:119359934-119359956 GAGGAGATTGAGGAGGCTGAGGG + Intronic
1075774702 10:124974869-124974891 CAGGAGGTGGAGGATGCAGTGGG - Intronic
1077320080 11:1937172-1937194 CAGGAGAGGGAGGAGGCTCCGGG - Intronic
1077425047 11:2471490-2471512 CAGGACTTGGAGGATGCTGATGG + Intronic
1078818567 11:14852128-14852150 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1079016846 11:16876125-16876147 CAGGAAATGGAGCTGACTGAGGG - Intronic
1079214566 11:18496720-18496742 CAGGAGATGGAGGTTGCAGTGGG + Intronic
1080859544 11:36141486-36141508 CAGGACAGGGATGGGGCTGTGGG - Intronic
1080974311 11:37318736-37318758 CTATAACTGGAGGAGGCTGTAGG + Intergenic
1081594744 11:44451290-44451312 CAGGAGATGGAGGATGCAGTGGG + Intergenic
1082079445 11:48000741-48000763 GAGGAAATGAAGGAGGATGATGG - Intronic
1082911551 11:58381597-58381619 CAACAAATGGAGGAGTCTGAAGG + Intergenic
1083750539 11:64758469-64758491 GAGGAAATTGAGGAGGATGCGGG - Exonic
1083850454 11:65363166-65363188 CAGGAATTTGAGGTGGCAGTGGG - Intergenic
1083892712 11:65604703-65604725 CAGGGAATGGAAGAGGCGATGGG + Intronic
1083894123 11:65611680-65611702 CAGGAAACGCAGGAAGCAGTGGG + Intronic
1084111983 11:67020186-67020208 CAGAAGACGGAGGAAGCTGTTGG + Intronic
1084342486 11:68515300-68515322 CAGGAACTGGACCAGCCTGTCGG + Intronic
1084356778 11:68644158-68644180 CAGGAACTGGACCAGCCTGTCGG + Intergenic
1084593301 11:70102859-70102881 GAGGAAGTGCAGGGGGCTGTGGG - Intronic
1084945178 11:72634405-72634427 GGGGAAGTGGGGGAGGCTGTGGG + Intronic
1085033950 11:73289091-73289113 CAGGGGATTGGGGAGGCTGTGGG + Intronic
1085306464 11:75488724-75488746 CACAAAAAGGAGGAGGCAGTGGG - Intronic
1085535252 11:77213653-77213675 CAGGAAGTCTAGGAGGCTGTTGG - Intronic
1085954219 11:81371449-81371471 AAGAAAATAGAGGAGGTTGTGGG + Intergenic
1086498489 11:87427843-87427865 CAGAAGATGGAGGGGGCTGTAGG + Intergenic
1087031601 11:93711574-93711596 CAGGAGATGGAGGCTGCAGTGGG - Intronic
1087104822 11:94398816-94398838 TAGGAAAGGGAGAAGGTTGTGGG - Intronic
1087551699 11:99658812-99658834 CAGGAGGTGGAGGATGCAGTGGG + Intronic
1087659321 11:100967785-100967807 CAGGAGATGGAGGTTGCAGTAGG - Intronic
1088446696 11:109938062-109938084 CAGGAGAAAGAGGAGGCTTTGGG - Intergenic
1089116808 11:116101903-116101925 AAGGAAATGCAGGAGCCTGAGGG + Intergenic
1089463359 11:118666157-118666179 CAGGAAGTGGAGGTTGCAGTGGG + Intronic
1090129373 11:124123682-124123704 CAAACAATGGAGGAGGCTCTGGG + Exonic
1090846814 11:130536434-130536456 GAGGACAAGGAGGAGGCTGTGGG + Intergenic
1091365492 11:135016312-135016334 AAGGAGATGGAGGAGGCTGTGGG - Intergenic
1092041241 12:5386542-5386564 GAGGAAAAGGAGGAGGATGAAGG - Intergenic
1092201390 12:6586024-6586046 CAGGAAGTGGAGGTTGCAGTAGG + Intronic
1092767799 12:11869326-11869348 CGGTAAATGGAGGAGCGTGTAGG - Intronic
1092840604 12:12536963-12536985 CAGGAAGTGGAGGTTGCGGTGGG + Intronic
1093509441 12:19908955-19908977 GAGGAAGTGGAGGATGCTCTTGG - Intergenic
1093844525 12:23952197-23952219 CAGGAAGAGGAGGAGGCGGGAGG + Intergenic
1094230108 12:28093051-28093073 CAGGAACTGGAAGAGGCTTTGGG + Intergenic
1094768312 12:33622990-33623012 CAGGCTATGGAGGATGCTCTTGG - Intergenic
1095315041 12:40750162-40750184 CAGTAACTGGATGAGGATGTGGG + Intronic
1095716791 12:45355075-45355097 CAGGAAATAGGGGAGGGGGTAGG + Intronic
1096174770 12:49506757-49506779 CAGGAAGTGGAGGCTGCAGTGGG + Intronic
1096216627 12:49801367-49801389 CAGGAGAAGCAGGAGGCTATTGG - Intronic
1096988024 12:55774672-55774694 CAGGAAGTGGAGGTTGCAGTGGG + Intronic
1097894408 12:64810076-64810098 CAGGAGATGGAGCAGGGTGGAGG - Intronic
1097904309 12:64904389-64904411 GAGGAGATGGAGAAGGATGTGGG + Intergenic
1099257704 12:80334625-80334647 GAGAAAATGTAGGAGGCTGCAGG + Intronic
1100497023 12:95135010-95135032 CAGGAAAGGGTGGAGGTTGGTGG - Intronic
1101003050 12:100375314-100375336 AAGGAGCTGGAGGAGGCTGGGGG + Intronic
1101488468 12:105190333-105190355 CAGGAAATGGGGCAGACTGAAGG - Intronic
1102436105 12:112925280-112925302 GAGGAAAAGGGGGAGGGTGTGGG - Intronic
1102440614 12:112961377-112961399 CAGGAAATGGAGGATGGAGGAGG - Intronic
1102533143 12:113561619-113561641 GAGGAAGAGGAGGAGGCTTTGGG + Intergenic
1102820831 12:115907908-115907930 CAGGAAGTGGAGGCTGCAGTGGG + Intergenic
1102871907 12:116420367-116420389 CAGGAGATGCAGGGGGCTCTGGG - Intergenic
1102930778 12:116860481-116860503 TGGGGAGTGGAGGAGGCTGTGGG + Exonic
1103862737 12:124027377-124027399 AGGGAAATGAAGGAGGCTGCTGG - Intronic
1103995531 12:124827633-124827655 CAGGATAGCAAGGAGGCTGTGGG - Intronic
1104512994 12:129398569-129398591 CAGGCAAAGGAGGAGGGGGTTGG + Intronic
1104794953 12:131510971-131510993 CTGGATCTGGAGGAGGCTCTGGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1104931410 12:132341275-132341297 CAGGGACTGGAGGAGGGTGGGGG + Intergenic
1105223849 13:18409099-18409121 CAGGAGGAGGAGGAGGCTGTGGG + Intergenic
1106102409 13:26706554-26706576 CAGGGCGTGGAGGAGGATGTTGG - Intergenic
1106285035 13:28311029-28311051 CAGGAGATGGAGGCTGCAGTGGG - Intronic
1106811785 13:33365196-33365218 AAGGGAATGGGGGAGTCTGTGGG + Intergenic
1108080259 13:46727988-46728010 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1108184762 13:47877423-47877445 CAGGAAATGGACGAGCCTTGTGG + Intergenic
1109247290 13:59971010-59971032 CTGGAAGTGGAGGAGGTGGTGGG + Exonic
1109588187 13:64438137-64438159 CTGGTAATGAAGGAGGCTGTTGG - Intergenic
1110215509 13:73020609-73020631 CAGGTAATAGAGGAGGATGAAGG - Intergenic
1110237768 13:73234342-73234364 CTGGAAAGGGAGGAGGAGGTGGG - Intergenic
1110361090 13:74626669-74626691 CAAGAAGTGGAGGATGGTGTTGG - Intergenic
1110598044 13:77340460-77340482 CAGGAAAAGGAGGAGATTTTGGG + Intergenic
1111255756 13:85666091-85666113 CAGGAAACAGAGGAGGCCTTAGG + Intergenic
1112666824 13:101584877-101584899 CATGAATTGCAGGAGGCTATTGG + Intronic
1112888516 13:104204260-104204282 CAGCAAAGGGAGGAGACTGGGGG - Intergenic
1113295223 13:108952248-108952270 AATGAAATGTAGGAGGCTTTAGG + Intronic
1113965082 13:114148007-114148029 CAGCAAGTGGAGGAGGCCGGGGG - Intergenic
1114007997 14:18333925-18333947 CAGGAGGAGGAGGCGGCTGTGGG + Intergenic
1115251162 14:31349430-31349452 CAGGAAAAAGAAAAGGCTGTAGG - Intronic
1115698038 14:35921917-35921939 CAGAAAAGGGAGGAGACTGTAGG - Intronic
1115957153 14:38794155-38794177 GGGGAACTGGAGGAGGCTGGGGG - Intergenic
1116991168 14:51278231-51278253 CAGGAAATGGCGGTGGTGGTGGG + Intergenic
1117142089 14:52799339-52799361 CAGGAAAGGGAAGAGGCAGAAGG + Intergenic
1117937797 14:60926784-60926806 TAGGGAAGGGAGGAGGCTGAAGG - Intronic
1118873918 14:69767000-69767022 CCGGAAATTTAGGAGGATGTGGG - Exonic
1119195883 14:72716220-72716242 CAGGAAAGGGAGGGTGCTGTGGG + Intronic
1119440212 14:74623178-74623200 ATGGAAAGGGAGGAGGCTGGAGG + Intergenic
1119512434 14:75222103-75222125 CAGGAAGAGTAGGAGGCTGTGGG - Intergenic
1119737304 14:76991347-76991369 CAGGAGATGGAGGTTGCAGTGGG + Intergenic
1119759914 14:77142893-77142915 CAGGAAATTGAGGATGGTGATGG - Intronic
1120584177 14:86290601-86290623 CAAAAAATGAAGGAGGCTGAAGG - Intergenic
1120799270 14:88670244-88670266 CAGGAAGTGGAGGTTGCAGTGGG + Intronic
1121710029 14:96030801-96030823 GAGGATATGGAGGAGGCTGCCGG + Intergenic
1121742021 14:96260635-96260657 CATAATATGGAGGAGGCTGGAGG - Intronic
1121906515 14:97751007-97751029 CAGGAACTGGAGAAGGCTGAGGG + Exonic
1122310380 14:100790570-100790592 CAGGAAATGGAAGAGGGTCTTGG + Intergenic
1122608959 14:102968332-102968354 AACGAGATGGAGGAGGCAGTAGG - Exonic
1122957409 14:105077161-105077183 CAGAAAATGCAGGAGGTTGGGGG + Intergenic
1123027263 14:105432099-105432121 CAGGAAATTGAGGCTGCAGTGGG - Intronic
1202870871 14_GL000225v1_random:162310-162332 CATGGAGTTGAGGAGGCTGTGGG + Intergenic
1124217384 15:27818676-27818698 GAGACCATGGAGGAGGCTGTTGG + Intronic
1124616988 15:31249063-31249085 CAGGGAGGGGTGGAGGCTGTTGG - Intergenic
1125449705 15:39795682-39795704 CCAGACTTGGAGGAGGCTGTGGG - Intergenic
1125748486 15:42013053-42013075 CTGGAAATGCAGCAGGCTCTGGG + Intronic
1125890151 15:43259934-43259956 CAGGGAATTGAGGAGGCTCTGGG + Intronic
1125927975 15:43578760-43578782 CAGGAGGTGGAGGTTGCTGTGGG + Intronic
1125941119 15:43678331-43678353 CAGGAGGTGGAGGTTGCTGTGGG + Intergenic
1126564628 15:50082218-50082240 CAGGAAATCTTGGAGGCTGAGGG - Intronic
1126758891 15:51950822-51950844 GGGGACATGGAGGAGGGTGTGGG + Intronic
1127774700 15:62255648-62255670 CAGGGGATGAGGGAGGCTGTAGG + Intergenic
1128186858 15:65649953-65649975 CAGGATAGGGAGGAGGCTCTAGG + Intronic
1128413196 15:67419427-67419449 CAGGCAATGGTGGAAGCTGGAGG - Intronic
1128668065 15:69553064-69553086 CAGGAAATGGATGAGCCTGTGGG - Intergenic
1129184068 15:73894966-73894988 CCAGAAATGAAGGAGGCTGGTGG + Intergenic
1129193446 15:73951111-73951133 CAGGAAACAAAGGAGGCTGCTGG + Intronic
1129681906 15:77662908-77662930 CAGGCACTGCAGGAGGCTCTGGG + Intronic
1130109758 15:80954474-80954496 CAGGGAAAGGAGTAGGATGTGGG + Intronic
1130543271 15:84837191-84837213 CAGGGGCTGGAGGAGGCTGTGGG + Intronic
1130578427 15:85114158-85114180 CAGGCAATGGAGGAGAGTTTAGG - Intronic
1130653552 15:85776097-85776119 CAGCAAATGGAGGTTGCAGTGGG + Intronic
1131174102 15:90199422-90199444 AATGAAATGGGGAAGGCTGTAGG + Intronic
1131193990 15:90340516-90340538 CGGGAGGTGGAGGAGGCTGCAGG - Intergenic
1131552071 15:93365663-93365685 CTGGATATGGAGGTGGCAGTTGG + Intergenic
1131701631 15:94942991-94943013 GAGGAAAGGGAGGAGGGGGTGGG + Intergenic
1131848251 15:96510849-96510871 AAGGAAATGGAGGGGGATGTGGG + Intergenic
1132051535 15:98611634-98611656 CAGGAAATCAAGGATGCAGTTGG - Intergenic
1132333570 15:101028977-101028999 CGGGAAATGGAGCAGGGTGCCGG - Exonic
1132777570 16:1604208-1604230 CAGTATATGGAGGAGCCTGCTGG + Intronic
1132860908 16:2071303-2071325 CAAGGGAGGGAGGAGGCTGTGGG + Intronic
1132914067 16:2332726-2332748 AAAGAAATGGAGGAGGCAATCGG - Intronic
1134067011 16:11234869-11234891 CAGTAAGTGGAAGTGGCTGTGGG - Intergenic
1134136818 16:11682141-11682163 GAGGAAATGAAAAAGGCTGTTGG - Intronic
1134747182 16:16597422-16597444 CAGGAGATGGAGGTTGCAGTAGG - Intergenic
1135241972 16:20815446-20815468 TAGGAAATGGAAGAGGCTACGGG - Intronic
1135424444 16:22325386-22325408 CAGGAAAGGAAGGAGGGTGAAGG - Intronic
1137235808 16:46616563-46616585 GAGGAAATGGAGGAGGGGGGCGG + Intronic
1137381319 16:48002247-48002269 GAGGAAGTGAAGGAGACTGTTGG + Intergenic
1137583520 16:49649794-49649816 AAGGAAAGGGATGAGGCTATTGG + Intronic
1137668901 16:50267847-50267869 CAGGAAGTGCAGGAGGCTGAGGG + Intronic
1137762091 16:50949110-50949132 CAGGGAAGGGTGGAGGGTGTGGG + Intergenic
1138276608 16:55739612-55739634 CAGGAAAAGGAGGAGGAAATTGG + Intergenic
1138530393 16:57631437-57631459 GAGGCCATGGAGGAGGCCGTGGG + Intronic
1138995532 16:62447973-62447995 GATGAATTGGAGGAAGCTGTAGG + Intergenic
1139530754 16:67541630-67541652 CTGGGAAGGGAAGAGGCTGTTGG - Intronic
1139545697 16:67648588-67648610 CAGGATCTGGGGGAGGTTGTGGG - Intronic
1139966231 16:70746855-70746877 CAGGAAATGGAGGTGGGGGGAGG + Intronic
1140476926 16:75243746-75243768 AGGGACTTGGAGGAGGCTGTGGG + Intronic
1140657441 16:77155353-77155375 CTGGAAAAGGAAGAGGCTGGGGG - Intergenic
1140699986 16:77572742-77572764 CAGGAGATGGAGGAGGCTCCAGG + Intergenic
1141007417 16:80365341-80365363 GAGGAAAAGGTGGAAGCTGTAGG - Intergenic
1141128646 16:81419215-81419237 CAGGAAGTGGAGGTTGCAGTGGG + Intergenic
1141272287 16:82552438-82552460 GAGAAAATGGAGGAGCCTATCGG - Intergenic
1141499297 16:84432592-84432614 CAGGAGATGGAGGTGGCAGTGGG - Intronic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1142144908 16:88488896-88488918 CAGGAGATGGGGGTGGCTCTGGG + Intronic
1142227739 16:88885715-88885737 GAGGACAGGGAGGAGGCTGGTGG - Intronic
1142238804 16:88935781-88935803 CAGAAAAGGGACGAGGCTGATGG + Intronic
1142780729 17:2179206-2179228 AAGGAAGTGGTGGTGGCTGTGGG - Intronic
1143585701 17:7849157-7849179 CAGGCCAAGGAGGAGGCTGGCGG + Exonic
1143956284 17:10672109-10672131 AAAGAAAGGGAGGAGGCAGTGGG + Intergenic
1144334188 17:14254704-14254726 GAGATAAAGGAGGAGGCTGTGGG - Intergenic
1144656580 17:17041261-17041283 CAGGGAATGGAGGAGGTTTTAGG - Intergenic
1144848605 17:18232841-18232863 GAGGATCTGGGGGAGGCTGTGGG + Intronic
1144859956 17:18295224-18295246 CAGGAAGTGGAGGTTGCAGTGGG - Intronic
1145216374 17:21055703-21055725 CAGGATCTGGAGGAGGGTGGAGG - Intergenic
1145972975 17:28967770-28967792 CTGGAACTGTAGGAGGCTGGGGG + Intronic
1146175549 17:30663936-30663958 CAGGAAAGGGATGAGGGAGTAGG + Intergenic
1146338813 17:32001594-32001616 GAGGAGATGGGGGAGGATGTAGG + Intergenic
1146348998 17:32079982-32080004 CAGGAAACGGATGAGGGAGTAGG + Intergenic
1146351482 17:32098579-32098601 GAGGAGATGGGGGAGGATGTAGG - Intergenic
1146611556 17:34309939-34309961 CAGGAGATGGAGGTTGCTGAGGG - Intergenic
1147272556 17:39286286-39286308 CCGGAAATGGAGGTTGCAGTGGG - Intronic
1147325818 17:39668955-39668977 GAGGAAATGGAGGCAGATGTGGG + Intronic
1147331615 17:39702521-39702543 TAGTAAAGAGAGGAGGCTGTTGG - Intronic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148273654 17:46283742-46283764 CAGCATATGGAGGATGCTGCCGG + Intronic
1149684060 17:58525380-58525402 CAGGAAATGCCGGTGGCTGTTGG + Intronic
1150017156 17:61569688-61569710 CAGGAAGTCGAGGATGCAGTGGG - Intergenic
1150283753 17:63944211-63944233 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1150409406 17:64930839-64930861 CAGCATATGGAGGATGCTGCCGG - Intergenic
1150500159 17:65643119-65643141 GAGAAAATGGAGGGGGCTGAAGG + Intronic
1150683599 17:67302726-67302748 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
1151494139 17:74449544-74449566 CAGGAAAGGGAGGTGGCCCTAGG - Intronic
1151675817 17:75596853-75596875 CAGGATACTCAGGAGGCTGTGGG - Intergenic
1151808731 17:76423150-76423172 CAGGAAAAGGAGGAAGAGGTAGG + Intronic
1152463078 17:80451409-80451431 CAGGAAGCCCAGGAGGCTGTGGG + Intergenic
1152577442 17:81149132-81149154 CAGAAGCTGGAGGAGGCTGGCGG - Intronic
1152642752 17:81456039-81456061 GGGGACATGGAGGAGGCTGAGGG - Intronic
1152644870 17:81464074-81464096 CGGGAAACGGAGGGCGCTGTGGG - Exonic
1153078619 18:1194274-1194296 CAGGAAGTCGAGGATGCTGGTGG - Intergenic
1153338320 18:3947954-3947976 CAGGAAATAGAGGTAGTTGTGGG + Intronic
1153410703 18:4789462-4789484 CAGCAAGTGGAGGATGCAGTGGG - Intergenic
1153852517 18:9109083-9109105 CTGGCAATAGGGGAGGCTGTAGG + Intronic
1154475276 18:14748669-14748691 CAGGAGGAGGAGGCGGCTGTGGG + Intronic
1154529456 18:15330015-15330037 CAGGAGGAGGAGGAGGCTGTGGG - Intergenic
1157131656 18:45013170-45013192 CAGGAATGGCAGGAGGCTGCAGG - Intronic
1157317119 18:46601522-46601544 CAGGAAGGGGAGGAGGGGGTGGG - Intronic
1157754549 18:50206260-50206282 CAGGAAATGGCTGGGGCTGGTGG - Intergenic
1158817026 18:61113479-61113501 CAGGATATGGAGGAGTCTGCTGG + Intergenic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159527545 18:69612547-69612569 AAGGAAATGTAGGAGTCGGTTGG - Intronic
1159917256 18:74198471-74198493 CAGGACCTGGAGGTGGCTCTTGG - Intergenic
1160482548 18:79255409-79255431 CATCAAATGGAGGAAGCTGGTGG - Intronic
1160970950 19:1767577-1767599 CAGGAAAGGGCGGGGGCTGTAGG - Intronic
1161192782 19:2968401-2968423 CAGGGGATGGAGGGGGCTTTTGG - Intergenic
1161214188 19:3085110-3085132 CAAGGAAGGGAGGAGGCCGTGGG + Intergenic
1161454281 19:4362394-4362416 AAGCAAAACGAGGAGGCTGTGGG + Intronic
1162210191 19:9085128-9085150 CAGGAATTGGAGGCTGCAGTGGG + Intergenic
1162563309 19:11430660-11430682 CTGGAAATGAAGGAGGAGGTGGG + Intronic
1162621783 19:11849274-11849296 CAGGAGAAAGTGGAGGCTGTGGG - Intronic
1162811583 19:13167513-13167535 CAGGAAATGGCGGGGGCAGAGGG - Intergenic
1162983413 19:14253974-14253996 CAGGAAAGGGATGAGGGAGTAGG - Intergenic
1163026451 19:14515648-14515670 CAGGGACTGGAGGTGGATGTGGG + Exonic
1163310522 19:16511652-16511674 CAGGAGGTGGAGGAGGCAGTGGG - Intronic
1163664430 19:18596627-18596649 CGGGGAGTGGAGGCGGCTGTGGG + Exonic
1163857760 19:19718837-19718859 CAGGAAGTGGAGGTTGCAGTGGG - Intronic
1164266819 19:23626501-23626523 CAGGAAGTGGAGGTTGCAGTGGG + Intronic
1164651424 19:29893509-29893531 CAGGAAGCTGAGGAGGCAGTGGG + Intergenic
1164855169 19:31515378-31515400 CAGGAAATGGTGGCGGCCATAGG + Intergenic
1164998005 19:32737601-32737623 CAGGAATTGGAGGCTGCAGTGGG - Intronic
1165150315 19:33756501-33756523 CAGGGAATGGAGGAGCCCTTGGG - Intronic
1165393411 19:35550968-35550990 AAGGACAGGGAGGGGGCTGTAGG - Intronic
1165781642 19:38438077-38438099 CAGGAGATGGAGCAGGATGGTGG - Intronic
1166395958 19:42441314-42441336 GAGGAACTGAAGGAAGCTGTGGG + Intronic
1167077646 19:47259002-47259024 CAGGAAATTCAGGGGTCTGTGGG + Intronic
1167279933 19:48561056-48561078 CAGGAGACGGAGGTTGCTGTGGG + Intronic
1167965777 19:53145464-53145486 CAGGAAGTGGAGGTTGCAGTGGG - Intronic
1168565827 19:57422399-57422421 CAGGAGGTGGAGGAGGTTGCAGG - Intronic
1168650885 19:58091451-58091473 CTGGAAATGGTGCAGGATGTAGG + Intronic
1168723836 19:58570090-58570112 CATGGCATGGAGCAGGCTGTTGG - Intronic
925130091 2:1488519-1488541 CAGGTCAGGGAGGAGGCTGCCGG - Intronic
925198681 2:1948631-1948653 CTGGAAAGAGAGGAGGATGTGGG + Intronic
925307158 2:2856537-2856559 CAAGGAGAGGAGGAGGCTGTAGG - Intergenic
925860451 2:8170437-8170459 AATGAAATGAAAGAGGCTGTGGG - Intergenic
925960767 2:9013193-9013215 CAGCAAGTGGCGGGGGCTGTGGG - Intergenic
926020653 2:9492097-9492119 AAGGAAAGGAAGGAGGCAGTAGG + Intronic
926322103 2:11755648-11755670 GAGGAAATGGAGGAGGCAGGTGG + Intronic
927775007 2:25895910-25895932 GAGGAAGTGGAGGAGGAGGTGGG + Intergenic
927820670 2:26261284-26261306 AAAGAAATAGAGGGGGCTGTGGG + Intronic
928094941 2:28398680-28398702 CAGGAAAGCGTGGAGGCTGAAGG + Intronic
928104395 2:28458554-28458576 CTGGAAATGGATGATGGTGTTGG + Intronic
928104453 2:28459043-28459065 CTGGAAATGGATGATGGTGTTGG + Intronic
929022073 2:37563291-37563313 CAGGGAATGGAGGTGGCAGGAGG + Intergenic
929729683 2:44474371-44474393 CAGGAGATGGAGGTTGCAGTGGG + Intronic
929760423 2:44801996-44802018 AAGGAAAGGGCGGTGGCTGTGGG - Intergenic
929862781 2:45693597-45693619 ATGGAAAATGAGGAGGCTGTCGG + Intronic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
931634577 2:64329902-64329924 AAGGAAAGGGAGGAGCCAGTAGG + Intergenic
931759900 2:65407342-65407364 CAGGAAACTGAGGTGGCTGCAGG + Intronic
932394882 2:71436587-71436609 CAGGAGATGGAGGTTGCGGTGGG - Intergenic
932419018 2:71590557-71590579 CAGGTCAGGGAGGAGGCTGCAGG - Intronic
932492492 2:72131177-72131199 CAGGAGAGGGAGGAGGCAATGGG + Exonic
933746982 2:85578606-85578628 CAGGAAAGGGGGGTGGCTCTGGG + Intronic
934169619 2:89329711-89329733 CAGGAAAATGAGGAGGTTCTAGG - Intergenic
934197673 2:89852874-89852896 CAGGAAAATGAGGAGGTTCTAGG + Intergenic
934646217 2:96060637-96060659 CAGGAGCTGGAGGTGGCTGTGGG - Intergenic
934695995 2:96400537-96400559 CAGCAAAGGGAGAACGCTGTCGG + Intergenic
934839619 2:97616719-97616741 CGGGAGCTGGAGGTGGCTGTGGG - Intergenic
934964953 2:98713110-98713132 CTGGAGATGGAGGATGCAGTGGG + Intronic
935337280 2:102028219-102028241 GAGAACGTGGAGGAGGCTGTGGG - Exonic
936503942 2:113089744-113089766 AAGGAAATGGAGAGTGCTGTGGG + Intergenic
937255522 2:120552712-120552734 CTGGACTTTGAGGAGGCTGTAGG - Intergenic
937335983 2:121062621-121062643 CATGAAATGGAGAAGCCGGTGGG - Intergenic
938528554 2:132161437-132161459 CAGGAGGAGGAGGAGGCTGTGGG - Intronic
940195638 2:151091411-151091433 CAGGAAATGAAGGAGGGAGATGG + Intergenic
940485211 2:154288852-154288874 CAGGACATGGTGCAAGCTGTTGG + Intronic
941226647 2:162857820-162857842 AAGGAAAAGTAGGAGGCTATGGG + Intergenic
941383631 2:164826347-164826369 CAGGAAGTGGAGGATGAAGTTGG - Intronic
941716975 2:168774282-168774304 CAGGAACTCCAGGAGGCTGAAGG - Exonic
941889543 2:170564397-170564419 CAGGAGATGGAGGTGGCAGTGGG + Intronic
942321629 2:174741382-174741404 CAGGAGATGGAGCAGGCCGAGGG - Intergenic
942524030 2:176833785-176833807 CAAGAAAAGGAGGAGGGAGTGGG - Intergenic
942890440 2:180980879-180980901 AAGGAAATGGAGGCAGCTGTGGG - Exonic
944700249 2:202239561-202239583 CAGGAATTGGAGCATGATGTTGG - Intergenic
945357404 2:208856626-208856648 AAGGAAATGGGGCAGGCTCTTGG + Intergenic
945726779 2:213479623-213479645 CAACAAATGGTGGAGGATGTAGG - Intronic
946148554 2:217748927-217748949 CAGGAAGAGGAGGAGGCAGCAGG - Intronic
946217833 2:218199485-218199507 CAGAACATGGAGGAGCATGTTGG - Intergenic
946424399 2:219585324-219585346 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
947096525 2:226573046-226573068 AGGGAAGTGGAGGAGGCTGCAGG - Intergenic
948310462 2:236981899-236981921 CAGCCTGTGGAGGAGGCTGTGGG + Intergenic
948857183 2:240735619-240735641 CAGGAATTGGAGTAGGGGGTGGG - Intronic
1169064969 20:2690019-2690041 GAGCTAAGGGAGGAGGCTGTGGG + Intergenic
1171015826 20:21540910-21540932 CAGGAAATGGAGGAGGAGGTGGG + Intergenic
1172936681 20:38625490-38625512 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1173357637 20:42308987-42309009 CAAGAACTGGAGGAGGAAGTAGG + Intronic
1173606590 20:44336261-44336283 CTGGAAGGGGAGGGGGCTGTGGG + Intergenic
1173734177 20:45348008-45348030 CAGGGAAGGGACGAGGGTGTGGG + Intronic
1173871872 20:46347417-46347439 CAGGAAAGTGATGAGGCAGTGGG - Intronic
1173909650 20:46656874-46656896 CAGCAAATGGAGAAGGCAGAAGG - Intronic
1174321642 20:49746688-49746710 CAGGAAAAGGAGGTTGCAGTGGG - Intergenic
1174378839 20:50143548-50143570 CAGGAGATGGACCAGGTTGTGGG + Exonic
1175112739 20:56660151-56660173 CAGGGATGGGAGGAGGCTCTGGG - Intergenic
1176767942 21:13038453-13038475 CAGGAGGAGGAGGAGGCTGTGGG + Intergenic
1180085222 21:45505241-45505263 CAGGAAATGAAGGGGGCCCTGGG - Exonic
1180189422 21:46155385-46155407 CAGGCCATGGAGGAGGTGGTGGG - Intronic
1180432504 22:15264735-15264757 CAGGAGGAGGAGGCGGCTGTGGG + Intergenic
1180515076 22:16132715-16132737 CAGGAGGAGGAGGCGGCTGTGGG + Intergenic
1180784114 22:18537359-18537381 CAGGAACAGCAGGAGGCTGTAGG + Intergenic
1180912800 22:19464685-19464707 CAGGAGGTGGAGGAGGATGTGGG + Intronic
1181127681 22:20711408-20711430 CAGGAACAGCAGGAGGCTGTAGG + Exonic
1181241015 22:21476711-21476733 CAGGAACAGCAGGAGGCTGTAGG + Intergenic
1181497157 22:23293856-23293878 GGGGAAATGGAGGAGGGTGCGGG - Intronic
1181577171 22:23802429-23802451 AAGGAAAAGGAGGAGGGGGTAGG - Intronic
1182132529 22:27867239-27867261 CAGGAGATGGAGGAGGTGGGGGG + Intronic
1182158653 22:28099822-28099844 CCGGAAATGGACGAGCCTGAGGG + Intronic
1182548873 22:31090591-31090613 CAGGAGAAGGAGGTGCCTGTAGG + Intronic
1182702949 22:32255269-32255291 CAGACAATGGAGGTGGCTCTGGG + Exonic
1183198135 22:36367471-36367493 CGGGGAATGCAGGAGGCTCTGGG - Intronic
1183421439 22:37713826-37713848 GAGGAAAGGGAGCAGGCTGCGGG + Intronic
1183450845 22:37894101-37894123 CAGGAGTTTGAGGAGCCTGTGGG + Intergenic
1183454134 22:37912289-37912311 CAGGAAGAGGAGGAGGCGTTAGG - Intronic
1183482858 22:38074649-38074671 CAGGGAACGCAGGAGGCTGCAGG - Intronic
1183827141 22:40397495-40397517 GTGGACATAGAGGAGGCTGTTGG - Intronic
1184087539 22:42274228-42274250 CAGGCACAGCAGGAGGCTGTGGG - Intronic
1184263122 22:43330962-43330984 CAGGAAAGGCAGTAGGCGGTGGG - Intronic
1184751051 22:46487012-46487034 CAGGAAGTGGAGGGGGCAGGGGG - Intronic
1185064872 22:48627059-48627081 CAGGAAACAGAGGAAGCTGCAGG - Intronic
1185226465 22:49656505-49656527 CAGCAGATGGCGGAGGGTGTCGG - Intronic
1185281995 22:49976118-49976140 CAGGCTGTGGGGGAGGCTGTGGG + Intergenic
950038135 3:9902088-9902110 CATGAAGGGGAGGAAGCTGTGGG + Intergenic
950799170 3:15535364-15535386 CAGGAAATGGATCAGGTTTTAGG + Intergenic
950944685 3:16932861-16932883 AAGGAAAAGGAGAAGTCTGTTGG + Intronic
951134289 3:19085080-19085102 CAGGAGATGGAGGTTGCAGTGGG + Intergenic
952166649 3:30757028-30757050 CTGGAAATGGAGGAAGCTGAGGG - Intronic
954410374 3:50367985-50368007 CAGGTCATGGAGGAGGCTCCTGG - Intronic
954563786 3:51581169-51581191 CAGGAGATGGAGGTTGCAGTGGG - Intronic
954891203 3:53930594-53930616 CAGGAAGTGGAGGCTGCAGTGGG + Intergenic
955260500 3:57384568-57384590 CAGGAGATGGAGGCTGCAGTGGG + Intronic
956289262 3:67644544-67644566 CAGGAAATGGATGATGGTGATGG + Intronic
957042303 3:75345305-75345327 TAGGGAAAGGAGGAGGCTGGTGG - Intergenic
957322612 3:78651820-78651842 CAGGTATTGGAGCAGCCTGTTGG - Exonic
958097952 3:88972002-88972024 CAGAAAATTGATGAGGTTGTAGG + Intergenic
959121841 3:102242015-102242037 GAGGAATTGGAGGATGCTGAGGG + Intronic
959457490 3:106580830-106580852 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
960543366 3:118884836-118884858 CAGGTGGTGGAGGAGGCAGTGGG - Intergenic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961047031 3:123716155-123716177 TAGGGAAAGGAGGAGGCTGGTGG - Intronic
961426736 3:126854388-126854410 CAGGAAATGGAGATTGGTGTGGG + Intronic
962228040 3:133632844-133632866 CAGGAGATAGAGGACGCAGTGGG - Intronic
962874352 3:139524518-139524540 CAGAAAAGGCAGGTGGCTGTGGG + Intronic
962936025 3:140081619-140081641 CAGGAAAGGGAGGACTCTGCAGG - Intronic
963130741 3:141855623-141855645 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
963353698 3:144183759-144183781 CAGGAGAGGGAGTAGGCTGAAGG - Intergenic
963749650 3:149163246-149163268 GAGGAACTGCAGAAGGCTGTGGG + Intronic
963865411 3:150355452-150355474 CAGGCAGTGGAGGTGGGTGTGGG - Intergenic
964314590 3:155429753-155429775 CAGGAAGTGGAGGTTGCAGTGGG + Intronic
964525300 3:157610792-157610814 CAGGAAAGGGCTGAGGCTGTGGG + Intronic
965058605 3:163753830-163753852 CAGCAAATGGGTGGGGCTGTGGG - Intergenic
966540104 3:181079560-181079582 GAGGCAATGGAAGAGGCTATTGG - Intergenic
966645359 3:182240546-182240568 CAGAAAATGGAGGGAGTTGTGGG + Intergenic
966918882 3:184599662-184599684 CAGGAAATGGAGGGGACTGTTGG + Intronic
967340628 3:188393356-188393378 CGGGAAGTAGAGGAGGCTTTGGG - Intronic
967762817 3:193243860-193243882 AAGGAAGTGGAGGAGGCAGTGGG - Intronic
967918074 3:194593882-194593904 CAGGAGATGGAGGCAGCAGTGGG - Intronic
969130061 4:4984426-4984448 CAGGAAATGGAGACAGCTGAAGG + Intergenic
969153240 4:5188018-5188040 CATGAAAGGGAGGGAGCTGTAGG - Intronic
969475898 4:7422336-7422358 CAGGACCTAGAGGAGGCTGCAGG - Intronic
969636101 4:8370311-8370333 CAGGCAGTCGAGGAGGCTGGTGG + Intronic
969933509 4:10658007-10658029 CAGCAAATGGAGGAGACAGTGGG - Intronic
970943486 4:21662820-21662842 CATGAAATGCTGGAGGATGTTGG - Intronic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
971301948 4:25449414-25449436 CAGGAAGTGGAGGCTGCAGTGGG - Intergenic
972353362 4:38258365-38258387 CAGGAAATGAAGAAGGCAGAGGG - Intergenic
972367899 4:38393212-38393234 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
972630308 4:40836401-40836423 CAGGAGATGGAGGTTGCAGTAGG + Intronic
973981893 4:56314583-56314605 CAGGAGGAGGAGGAGGCTGAGGG + Exonic
974199296 4:58618459-58618481 CAGGTAGTGGAGGAGGATGCAGG + Intergenic
974377954 4:61102155-61102177 CAGGAACTGGTGGAATCTGTTGG - Intergenic
977757536 4:100690761-100690783 CAGGAAATCGAGGCTGCAGTGGG + Intronic
978289619 4:107121865-107121887 GAGGAAATAGAGCAGACTGTAGG - Intronic
978342716 4:107735098-107735120 CAAAAAGTGGAGGCGGCTGTTGG + Intergenic
978657379 4:111080391-111080413 CAGGACATGGATGAAGCTGGAGG + Intergenic
978691921 4:111523906-111523928 CAGCAAATGGATGCGGCTGGAGG - Intergenic
978998466 4:115185329-115185351 CAGGAAACTGAGAAGGTTGTGGG + Intergenic
979049782 4:115916218-115916240 GAGGAGCTGGAGGAGGCTGGGGG - Intergenic
979659541 4:123237884-123237906 CAGGAACTGGAAGGGGTTGTGGG + Intronic
979736405 4:124091271-124091293 CAGGAACTGGACATGGCTGTGGG + Intergenic
980666649 4:135948087-135948109 TAGGAAATAGAGGAGGAGGTGGG - Intergenic
982072257 4:151705775-151705797 CATCAAATGAGGGAGGCTGTGGG + Intronic
982253524 4:153431214-153431236 CAGAAAAAGGAGTAGGTTGTAGG + Intergenic
982721820 4:158867842-158867864 CAGGCAATGGGAGGGGCTGTGGG + Intronic
982971714 4:161996625-161996647 CAGGAAAAGTATTAGGCTGTAGG - Intronic
983077486 4:163343883-163343905 CAGGACCTGGAGGCGGCGGTGGG - Intronic
983354732 4:166642157-166642179 CCAGAAAAGGAGGAGGATGTAGG - Intergenic
983522683 4:168726865-168726887 GAAGAAAGGGAGGAGGCTGTGGG - Intronic
983749761 4:171252391-171252413 GAGGAAACTGAGTAGGCTGTTGG - Intergenic
984628631 4:182037219-182037241 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
984961058 4:185099338-185099360 CATGAAATAGAGGAGTCTGCTGG + Intergenic
985003732 4:185512054-185512076 CAGGAAGAGAAGGAGGATGTTGG + Intronic
985284036 4:188316185-188316207 CAGGAGAAGGAGGTGGCTGTGGG + Intergenic
985486407 5:154077-154099 CAGGAGGTGGAGGTTGCTGTGGG - Intronic
985510529 5:310759-310781 CAGGAAATGGGAGTGGCTGGGGG - Intronic
985641777 5:1066778-1066800 CAGGAGCTGGAGGAGGCAGGAGG + Intronic
985649881 5:1102549-1102571 CAGGAAGGGGCGGAGGCTGTCGG - Intronic
985679964 5:1250696-1250718 CAGGCAAGGGTGGAGGCTGTGGG - Intergenic
985814729 5:2118180-2118202 CAGCAATTGGAAGAGGCTGTGGG + Intergenic
985967758 5:3350791-3350813 CAGGAAGTGGAGGGTGCGGTGGG - Intergenic
986444417 5:7808707-7808729 CAGGAAAGGGTGGGGGCTGGTGG - Intronic
987858750 5:23456342-23456364 CTGGACATGGAAGAGCCTGTTGG + Intergenic
988526690 5:31993311-31993333 CAGGGGATGGAGGAGACAGTTGG + Intronic
989272749 5:39552060-39552082 GAGGAAAGGAAGGAGGATGTAGG - Intergenic
991961031 5:72044412-72044434 GAAGAAATGGAGAAGGCAGTAGG + Intergenic
992410681 5:76502471-76502493 CAGCAAGTGGTGGTGGCTGTTGG - Intronic
992840894 5:80693729-80693751 CAGGAGATGGAGGTTGCAGTGGG - Intronic
993462444 5:88200395-88200417 CAGGAAAGGGTCAAGGCTGTGGG - Intronic
993466279 5:88250609-88250631 CAGGAGAAGGAAGAGGATGTTGG + Intronic
994368780 5:98946217-98946239 TAGGAAATAGAGGAGTATGTGGG - Intergenic
996070974 5:119131267-119131289 CAGGAATTGGGGGAGGGTGAGGG + Intronic
997035824 5:130190107-130190129 CAGCATGTGAAGGAGGCTGTGGG - Intergenic
997238262 5:132288100-132288122 CAGGAACTGGAGCATGATGTCGG + Intronic
997352868 5:133243603-133243625 CAGGGCATGTAGGTGGCTGTAGG + Intronic
997384205 5:133459680-133459702 CAGGAGAGGAAAGAGGCTGTGGG + Intronic
997427490 5:133813781-133813803 CAGGAAATATAGGAGCCTGATGG - Intergenic
997482287 5:134195322-134195344 CAGGAGATGGAGGTTGCAGTGGG - Exonic
997616660 5:135251115-135251137 CAGGAAGAGGAGGAGGTTCTGGG + Intronic
997658543 5:135573166-135573188 CAGGTTATGGAAGAGGCTGAGGG - Intronic
998179208 5:139924777-139924799 CCGGAAAGGGAGGCGGCTGAGGG - Intronic
998340728 5:141415181-141415203 CAGGACTTGGGGGATGCTGTCGG - Exonic
998342812 5:141432753-141432775 CAGGACTTGGGGGATGCTGTCGG - Exonic
998359582 5:141573650-141573672 CGGGAAATGGAGGAGGTGGAGGG + Exonic
998888931 5:146725760-146725782 CAGGAAATGCAGGGTGCTATGGG - Intronic
999032058 5:148305006-148305028 CAGGAAATGTATTAGTCTGTAGG - Intergenic
999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG + Intronic
999724019 5:154419853-154419875 CAGGTAATGGGTGAGACTGTGGG + Exonic
999910241 5:156189630-156189652 CAGAAAGTGGAGGAGGCTAAGGG + Intronic
1000850058 5:166329090-166329112 CAGGAAATGGGGGAACCTGATGG + Intergenic
1001037572 5:168308793-168308815 CAGGTTGTGGAGGAGGCTGAAGG - Intronic
1001041376 5:168337965-168337987 CAGGACCTGGAGGAGGCTGGAGG + Intronic
1001118993 5:168963243-168963265 CAGGAGATGGAGGTTGCAGTAGG - Intronic
1001137101 5:169111676-169111698 CAGGAAGTGGAGGTGGCAGTGGG + Intronic
1001150548 5:169223875-169223897 GAGGGAAAGGAGGAGGCTGCAGG + Intronic
1001427049 5:171629550-171629572 CAGGAAATGGAGGAAGCCCTCGG - Intergenic
1001700696 5:173704812-173704834 GAGGCAATGAAGGAGGCTGGAGG + Intergenic
1002141285 5:177141402-177141424 CAGGAGATGGAGGTTGCCGTGGG - Intronic
1002299687 5:178250239-178250261 GAGGAAACAGAGGAGGCGGTGGG - Intronic
1002301790 5:178261646-178261668 CAGGAAGTGGAGGTGGTGGTGGG + Intronic
1002362265 5:178681812-178681834 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
1002812278 6:641970-641992 CGGGATGTGGAGGAGGTTGTGGG - Intronic
1003031971 6:2609228-2609250 CAGGAAGAGGAGGAGGCCATAGG + Intergenic
1003049433 6:2766109-2766131 CAGGAGGAGGAGGAGGCCGTGGG + Exonic
1003173880 6:3740716-3740738 CTGGAGGTGGAGGAGGCTGGAGG - Intronic
1004458779 6:15816671-15816693 CTGGAAATGGGGGAGACTGATGG + Intergenic
1004927601 6:20430949-20430971 CAGGAGATGGAGGTTGCAGTGGG + Intronic
1005969367 6:30749254-30749276 CTGGAAATGGAGGAGGCTAAGGG - Intergenic
1006106812 6:31721779-31721801 CAGGGAAGGGAGGAGCCTTTGGG - Exonic
1006112914 6:31759605-31759627 CAGGAAGAGGAGGGGCCTGTTGG - Intronic
1006385966 6:33731135-33731157 CAGGAACTGCACGAGGCTGCTGG - Intronic
1006412819 6:33885147-33885169 CAGGAATGGGATGGGGCTGTTGG + Intergenic
1006648214 6:35529990-35530012 GAGGAAAAGGATGAGGCTTTTGG - Intergenic
1006986725 6:38180377-38180399 CAGGAGCTGGAGGAGGGTGATGG + Intronic
1007032674 6:38642219-38642241 CAGGTAATGGAGAAAGCTGCAGG - Intergenic
1007102678 6:39260935-39260957 CAGGGAATGGAGGGGGCTTCAGG - Intergenic
1007279137 6:40697454-40697476 CAGGAGGTGGAGGATGCTTTGGG - Intergenic
1007752180 6:44077163-44077185 CAGGGAAGGGAGGAGGCGGTCGG + Intergenic
1007819508 6:44550666-44550688 CAGGAAATGAAGAAGGCTAGAGG + Intergenic
1007905984 6:45461207-45461229 CAGTTAATGGAGCAGGCAGTAGG + Intronic
1008030532 6:46688730-46688752 CAGCGAACGGAAGAGGCTGTCGG - Exonic
1008213289 6:48752711-48752733 ACTGAAATGGAGGAGGCTGTGGG - Intergenic
1008253142 6:49265135-49265157 CAGGAAGTGGCGGTGGCTCTTGG - Intergenic
1008527539 6:52421005-52421027 CAGGAAATGGAGCTGGGAGTGGG - Intronic
1008538618 6:52527302-52527324 CAGGAGGTGGAGGATGCAGTGGG + Intronic
1010091752 6:71990828-71990850 CAGGACATGGTTGAGACTGTGGG + Intronic
1010441249 6:75897151-75897173 AAAGAAATGGAGGAAGCTTTAGG + Intronic
1011157673 6:84351405-84351427 CAAGGAATGGAGCAGGCTGCTGG + Intergenic
1011638519 6:89398162-89398184 AAAGAAATGGAAGAGGCAGTAGG + Intronic
1012683917 6:102219005-102219027 CAGAATATGTTGGAGGCTGTAGG + Intergenic
1012917898 6:105190147-105190169 CAGGAGATGGAGGTTGCAGTGGG + Intergenic
1013596293 6:111663800-111663822 CAGCCATTGGAGGAGGATGTAGG - Intronic
1013613501 6:111818879-111818901 TAGGCAATGGAGGAAGCTGATGG - Intronic
1015165321 6:130195183-130195205 GAGGACATGAAGGAGGCTTTGGG - Intronic
1015558132 6:134483623-134483645 CAGGAAGTGGAGGTTGCAGTGGG + Intergenic
1015685141 6:135850804-135850826 GGGGAAAAGGAGGAGGATGTGGG + Intergenic
1015763727 6:136692880-136692902 CAGGAGGTGGAGGTGGCAGTGGG + Intronic
1016961604 6:149677944-149677966 CAGGAGATGGAGGTTGCAGTGGG + Intronic
1017648272 6:156558430-156558452 CAGGAAGTGGAGGTTGCAGTTGG + Intergenic
1018014919 6:159703238-159703260 CAGGAGATGGAGGTTGCAGTGGG + Intronic
1018030025 6:159834345-159834367 CAGGAAATGGTGGGGGGTGAGGG - Intergenic
1018189104 6:161292776-161292798 CAGGAGAAGGAAGAGGCTGTTGG - Intergenic
1018597880 6:165502825-165502847 CAGGAACTAGAGGAGGGTGGAGG + Intronic
1018863169 6:167726939-167726961 CAGGAGGCAGAGGAGGCTGTGGG + Intergenic
1019210760 6:170402641-170402663 CAGAAAAAGGAGGAGACAGTTGG + Intronic
1019493448 7:1325554-1325576 AAGCACATGGAGGAGGCTGAGGG + Intergenic
1019974704 7:4571830-4571852 CAGGAAGCGGAGGATGCAGTGGG + Intergenic
1020063257 7:5168394-5168416 CAGGAAGTGGAGGCTGCAGTGGG + Intergenic
1020105374 7:5420214-5420236 CGGGAAATGGTGGAGGCCGCGGG + Intronic
1020164999 7:5800779-5800801 CAGGAAGTGGAGGCTGCAGTGGG - Intergenic
1020186834 7:5965590-5965612 CAGGAAGGGGAGGAAGGTGTGGG - Intronic
1020296082 7:6759184-6759206 CAGGAAGGGGAGGAAGGTGTGGG + Intronic
1020524282 7:9238527-9238549 CAGGAAGTGGAGGTTGCAGTGGG + Intergenic
1020544727 7:9512742-9512764 GAGGCAATGGGGGAGGCTATGGG - Intergenic
1020605641 7:10333332-10333354 CAGGAGGTGGAGGATGCAGTGGG + Intergenic
1021178355 7:17476092-17476114 CAGGAAGTGGAGGTTGCAGTGGG + Intergenic
1022588915 7:31642626-31642648 CAGGAAGTGGAGGAGGCAATAGG - Intronic
1022601971 7:31769513-31769535 CAGGATATGGAGAAAGTTGTGGG - Intronic
1022763085 7:33378736-33378758 AAGAAAATGGGGGATGCTGTGGG - Intronic
1023191917 7:37592208-37592230 CAGGAGATGGTGGAGGCTGATGG - Intergenic
1023307060 7:38841675-38841697 CAGGAGATGGAGGTTGCAGTAGG - Intronic
1023837063 7:44074446-44074468 CAGGTGGTGGAGGAAGCTGTGGG - Exonic
1024002160 7:45197274-45197296 AAAGAAATGGGGAAGGCTGTGGG + Intergenic
1024063975 7:45718004-45718026 CAGGAAGGGGTGGAGGCTTTGGG - Exonic
1025977577 7:66381115-66381137 CAGGATTTGGAGGAGACAGTAGG - Intronic
1026065766 7:67071524-67071546 CAGGAAGTGGAGGTTGCAGTGGG - Intronic
1026711113 7:72740324-72740346 CAGGAAGTGGAGGTTGCAGTGGG + Intronic
1028229263 7:88287074-88287096 CAGGAGAAGGAAGGGGCTGTTGG + Intronic
1029706234 7:102277838-102277860 CAGGTCAAGGAGAAGGCTGTGGG + Intronic
1030490510 7:110227502-110227524 CAGGAAATACATGAGGCGGTGGG - Intergenic
1031404561 7:121369051-121369073 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1031460874 7:122047126-122047148 TTGGGAATGGAGGAGGCCGTTGG + Intronic
1031971492 7:128068033-128068055 CATGACCTGGAGGAGGCTTTAGG + Intronic
1031972896 7:128076765-128076787 CAGGAAGTGCAGAAGGCTTTAGG + Intronic
1032454897 7:132065780-132065802 CCGGAAATGAAGGAGCCAGTGGG - Intergenic
1032562752 7:132909415-132909437 CAGGAAGTGGAGGTTGCAGTGGG + Intronic
1032834774 7:135662572-135662594 CAGGAACTGGAGCATGATGTCGG - Exonic
1032933612 7:136703097-136703119 CAGTAAATGGTGGAGGGTGGAGG - Intergenic
1033109529 7:138562096-138562118 CAGGAGATGGAGGAGGTCTTGGG + Intronic
1033168457 7:139062475-139062497 CAGAAAATGGAGGAGTCAGTGGG - Intronic
1033176327 7:139127232-139127254 CAGGAGATGGAGGTTGCAGTGGG + Intergenic
1033315476 7:140293763-140293785 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1033345351 7:140521928-140521950 CAGGAAGTGGCGGAGGCTCTTGG + Exonic
1035443441 7:158922801-158922823 TAGGAAATGGAGGTGGTTGTAGG + Intronic
1035581198 8:739823-739845 CAGCATGTGGAGCAGGCTGTAGG + Intergenic
1035658917 8:1332096-1332118 CAGCAAAGGAAGGTGGCTGTTGG - Intergenic
1035703368 8:1654271-1654293 CAAGAACTGGAGGATGCTGGTGG - Intronic
1035752163 8:2003308-2003330 CAGGACACAGAGAAGGCTGTGGG + Exonic
1035882887 8:3261625-3261647 CAGGGAATGGAGGCAGCAGTTGG - Intronic
1036171351 8:6488674-6488696 CAGGTGTTGGAGAAGGCTGTAGG + Intronic
1038342559 8:26699367-26699389 GAAGAAATGGAGGAGTTTGTTGG - Intergenic
1038464096 8:27743818-27743840 CAGGAATTGGAGGCTGCAGTGGG + Intronic
1038583390 8:28769486-28769508 CAGGATTTGCAGGAGGCAGTCGG - Intronic
1039442238 8:37603155-37603177 CGGGAAAGGGAGCAGGCTCTGGG - Intergenic
1040472820 8:47749750-47749772 CAGGAGATGGAGGTTGCAGTGGG - Intergenic
1040848777 8:51876330-51876352 ATGGAAATGGAGGAGTCAGTGGG + Intronic
1041362141 8:57065716-57065738 CAGGAGAAGGAGGAAGCAGTGGG - Intergenic
1041643607 8:60229244-60229266 CAGGAAATGGTGGGAGATGTTGG - Intronic
1043132819 8:76482757-76482779 CAGGCAATGGACTAGGCTCTAGG - Intergenic
1043859096 8:85294920-85294942 AAGGAAATAGATGAGGGTGTAGG - Intergenic
1044061193 8:87638038-87638060 CAGGATATGAAGGAGGCTACTGG - Intergenic
1044582713 8:93838048-93838070 TAGGGAAGTGAGGAGGCTGTGGG - Intergenic
1044810223 8:96053074-96053096 CAGGGAATGGGGGAGGCAGGTGG + Intergenic
1044927084 8:97218551-97218573 GAGGGACTGGAGGAGGCAGTGGG - Intergenic
1046867947 8:119171758-119171780 AAGGTAAAAGAGGAGGCTGTTGG + Intronic
1048026254 8:130589832-130589854 CAGGAAATGGAGGTGGGGATGGG + Intergenic
1048695013 8:137017793-137017815 GAGGAACAGGAGGAGGCTGCAGG - Intergenic
1049600137 8:143503814-143503836 CTGAACATGGAGGAGGCGGTGGG - Intronic
1049907095 9:228079-228101 GAGGAAATAGAGGAAGCTGGTGG + Intronic
1050548627 9:6730034-6730056 CAGGAAATGGAGGCTGCAGTGGG + Intronic
1050672573 9:8014390-8014412 ATGGAGATGGAGCAGGCTGTGGG + Intergenic
1051097555 9:13483964-13483986 CAGGAGAAAAAGGAGGCTGTGGG - Intergenic
1051113826 9:13671508-13671530 CAGGAAGTGGAGGTGAATGTTGG + Intergenic
1051345183 9:16144971-16144993 CAGTGAAAGGAGGAGGCTGATGG - Intergenic
1051534173 9:18138423-18138445 AACGAACTTGAGGAGGCTGTAGG + Intergenic
1051841046 9:21398785-21398807 CAGGAAATGGAAGAGACCTTGGG - Intergenic
1052113607 9:24620558-24620580 CAGGATATGGATGAGACTGCAGG + Intergenic
1053707172 9:40767777-40767799 CAGGAGGAGGAGGCGGCTGTGGG - Intergenic
1054417085 9:64888545-64888567 CAGGAGGAGGAGGCGGCTGTGGG - Intergenic
1056159763 9:83877001-83877023 CAGGAATTGGAGGCTGCAGTGGG + Intronic
1056350815 9:85746925-85746947 CAGGAATTGGAGGCTGCAGTGGG - Intergenic
1056925560 9:90831236-90831258 CAGGAAGTTGAGGGGGCTGGAGG + Intronic
1059260602 9:112972375-112972397 CAGGGATTGGAGGAAGTTGTGGG + Intergenic
1060153030 9:121300705-121300727 CAGGGTCTGCAGGAGGCTGTTGG - Intronic
1060455744 9:123794174-123794196 CAGGAAAAGGACTAGGCTGGCGG + Intronic
1060654557 9:125360933-125360955 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1060763650 9:126276652-126276674 CAGGAAGGAGAGGAGGCTGCTGG + Intergenic
1061166980 9:128928627-128928649 CAGGAAGTGGAGGTTGCAGTGGG + Intronic
1061685272 9:132271489-132271511 CAGGAGGTGGAGGATGCAGTGGG + Intronic
1061772080 9:132933137-132933159 CAGGAGATGGAGGTTGCAGTGGG - Intronic
1061851924 9:133421363-133421385 CAGGAAGGTAAGGAGGCTGTTGG - Intronic
1062425525 9:136504445-136504467 CAGGAAAAGGGTGTGGCTGTGGG + Intronic
1203733584 Un_GL000216v2:114275-114297 CATGGAGTTGAGGAGGCTGTGGG - Intergenic
1185499090 X:584123-584145 GAGGAAGAGGAGGAGGCTGGAGG + Intergenic
1185499115 X:584223-584245 GAGGAAGAGGAGGAGGCTGGAGG + Intergenic
1185499143 X:584323-584345 GAGGAAGAGGAGGAGGCTGGAGG + Intergenic
1185693022 X:2172114-2172136 CAGGAGATGGAGGTTGCAGTGGG + Intergenic
1185975089 X:4711230-4711252 AAAGAAATGGAGGAGGGTCTTGG + Intergenic
1186429753 X:9495021-9495043 TAGGAATTGAAGGGGGCTGTTGG + Intronic
1186498616 X:10032496-10032518 CAGGCCAAGGAGGAGGCAGTGGG + Intronic
1186772407 X:12830948-12830970 GAAGAACTGGAGGAGGGTGTTGG + Intergenic
1186917962 X:14244142-14244164 AAGGAAATGGACGCAGCTGTTGG - Intergenic
1187507536 X:19888762-19888784 CTGGAAATGGAGGAGGCTGAGGG + Intergenic
1187536772 X:20148078-20148100 AAGGAAGTGCAGGATGCTGTAGG - Intergenic
1188723881 X:33556886-33556908 CTGGAATTGGCGGGGGCTGTGGG - Intergenic
1189214259 X:39309838-39309860 CAGGAAATGAAGGGGCCTGTCGG + Intergenic
1189268866 X:39736417-39736439 CAGGAAGCTGAGGAGACTGTTGG - Intergenic
1189948408 X:46203820-46203842 CAGGAAATGGGGGTGGGGGTGGG - Intergenic
1190499649 X:51062167-51062189 CAGGAATTCAAGCAGGCTGTGGG + Intergenic
1191682038 X:63850906-63850928 CAGCCCCTGGAGGAGGCTGTTGG + Intergenic
1193680391 X:84511833-84511855 TAGGTAATGGCGGAGGATGTTGG + Intergenic
1194112464 X:89852153-89852175 AAGGAGATGGAAGAGTCTGTAGG + Intergenic
1195045545 X:101051678-101051700 CGGGGAATGGAGGAGGCAGGCGG - Exonic
1195082652 X:101385942-101385964 CAGCTAGTGGAGGAGGCTGACGG - Intronic
1196024705 X:111029061-111029083 CAGGAGATGCAGGCTGCTGTGGG + Intronic
1197345921 X:125325886-125325908 CAAGAAAAGAAGGGGGCTGTTGG + Intergenic
1198683237 X:139203815-139203837 GGGGAAGTGGAGGAGGCTGGAGG + Intronic
1199599802 X:149535214-149535236 GAGGAAAAGGAGGAGGGGGTGGG - Intergenic
1199650838 X:149945038-149945060 GAGGAAAAGGAGGAGGGGGTTGG + Intergenic
1199883141 X:151992414-151992436 CAGTAATTGGATGAGGCTGTGGG + Intergenic
1200311682 X:155084894-155084916 CAGGAGTTGGAGGTGGCAGTGGG + Intronic
1200465118 Y:3506965-3506987 AAGGAGATGGAAGAGTCTGTAGG + Intergenic
1201342072 Y:12945285-12945307 CAGGAAGTGGAGGTTGCAGTAGG - Intergenic