ID: 999243570

View in Genome Browser
Species Human (GRCh38)
Location 5:150141000-150141022
Sequence ATTGCTGCGGGGGTTGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999243553_999243570 12 Left 999243553 5:150140965-150140987 CCCACGACACAGGCAGGCCAGGG 0: 1
1: 0
2: 0
3: 19
4: 224
Right 999243570 5:150141000-150141022 ATTGCTGCGGGGGTTGATGGGGG 0: 1
1: 0
2: 0
3: 8
4: 141
999243555_999243570 11 Left 999243555 5:150140966-150140988 CCACGACACAGGCAGGCCAGGGA 0: 1
1: 0
2: 0
3: 26
4: 237
Right 999243570 5:150141000-150141022 ATTGCTGCGGGGGTTGATGGGGG 0: 1
1: 0
2: 0
3: 8
4: 141
999243550_999243570 21 Left 999243550 5:150140956-150140978 CCTGAGGCTCCCACGACACAGGC No data
Right 999243570 5:150141000-150141022 ATTGCTGCGGGGGTTGATGGGGG 0: 1
1: 0
2: 0
3: 8
4: 141
999243560_999243570 -5 Left 999243560 5:150140982-150141004 CCAGGGAGGGGGCCCTGCATTGC No data
Right 999243570 5:150141000-150141022 ATTGCTGCGGGGGTTGATGGGGG 0: 1
1: 0
2: 0
3: 8
4: 141
999243548_999243570 30 Left 999243548 5:150140947-150140969 CCTCAGGGTCCTGAGGCTCCCAC 0: 1
1: 0
2: 3
3: 43
4: 353
Right 999243570 5:150141000-150141022 ATTGCTGCGGGGGTTGATGGGGG 0: 1
1: 0
2: 0
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999243570 Original CRISPR ATTGCTGCGGGGGTTGATGG GGG Intronic