ID: 999244709

View in Genome Browser
Species Human (GRCh38)
Location 5:150147649-150147671
Sequence GCCCTCCTGCTCTGCCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1439
Summary {0: 1, 1: 0, 2: 5, 3: 78, 4: 1355}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999244709 Original CRISPR GCCCTCCTGCTCTGCCGCCC AGG (reversed) Intronic
900186174 1:1334294-1334316 GCCCTCCTGCTCTGTGTCCTGGG + Exonic
900278841 1:1852252-1852274 GGCATCTTGCTCTGTCGCCCAGG + Intronic
900286386 1:1902721-1902743 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
900311413 1:2035266-2035288 GCCCTCCTCCTCCTCCACCCTGG + Intergenic
901074165 1:6542481-6542503 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
901095594 1:6676652-6676674 GCGCGCGTGCTCTGTCGCCCAGG - Intronic
901399265 1:9004879-9004901 CCCATCCTGCTCTGCCCTCCAGG - Exonic
901414822 1:9109416-9109438 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
901454384 1:9354773-9354795 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
901693172 1:10987273-10987295 GGTCTCTTGCTCTGTCGCCCAGG - Intergenic
901788234 1:11638709-11638731 TCCCTCCTGCTCTCCCTCCCCGG + Intergenic
901855757 1:12043270-12043292 GCGCCTCTGCCCTGCCGCCCCGG + Intergenic
902072243 1:13749695-13749717 GCCCTCCCGCCCTGCCGACCCGG + Intronic
902169018 1:14595653-14595675 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
902331276 1:15732245-15732267 GCCCTTCTGCTCTCCCTCCAGGG - Intronic
902431065 1:16363668-16363690 GGACTCTTGCTCTGTCGCCCAGG + Intronic
902828973 1:18997491-18997513 GCCCTCCTGCTCACCCCTCCTGG + Intergenic
902912116 1:19606718-19606740 GCCTTCTTGTTCTGTCGCCCAGG - Intronic
903046900 1:20571242-20571264 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
903066263 1:20701403-20701425 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
903280921 1:22249339-22249361 GGGCTCCTGCTTTGCAGCCCAGG + Intergenic
903308596 1:22433405-22433427 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
903313745 1:22483051-22483073 GGAGTCCTGCTCTGTCGCCCGGG - Intronic
903510370 1:23870128-23870150 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
903539762 1:24090299-24090321 GCCCTGCTGCTCTCAGGCCCTGG + Intronic
903624940 1:24723969-24723991 GACCTCGTGATCTGCCGCCTCGG + Intergenic
903692292 1:25183176-25183198 CCCCTGCTGCTCTGCCTCCCTGG - Intergenic
903854180 1:26326510-26326532 GTCTTCTTGCTCTGTCGCCCAGG - Intronic
903922104 1:26807198-26807220 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
904034684 1:27552193-27552215 GACCTCCTGCTCTTCCTGCCTGG - Intronic
904173580 1:28609510-28609532 GGGCTACTGCTCTGTCGCCCAGG + Intronic
904210563 1:28884353-28884375 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
904241797 1:29151469-29151491 GGACTCTTGCTCTGTCGCCCAGG - Intronic
904576078 1:31505852-31505874 GCCTCCCTGCTCTGAGGCCCTGG + Intergenic
904585402 1:31577112-31577134 GCCCACCATCTCTGCCCCCCAGG + Exonic
904607129 1:31704107-31704129 GCCCTCCTCCTCCTCCTCCCTGG - Exonic
904766594 1:32853443-32853465 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
904906948 1:33904688-33904710 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
904909562 1:33923793-33923815 CACCTCCTGCTGTGCAGCCCAGG - Intronic
905389502 1:37627132-37627154 GCCCTCCTACCCTGCAGCCGAGG + Intronic
905440554 1:37993945-37993967 GACCTCGTGATCTGCCGCCTCGG - Intergenic
905463078 1:38134021-38134043 CTCCGCCTGCTCCGCCGCCCCGG - Intergenic
905699067 1:39998416-39998438 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
905982999 1:42248506-42248528 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
905990987 1:42336649-42336671 GGAATCCTGCTCTCCCGCCCAGG + Intergenic
906307497 1:44729008-44729030 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
906335888 1:44930664-44930686 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
906503475 1:46359574-46359596 GGCGTCTTGCTCTGGCGCCCAGG + Intronic
907103019 1:51854340-51854362 GGCATCTTGCTCTGTCGCCCAGG - Intronic
907245619 1:53106572-53106594 GGTGTCTTGCTCTGCCGCCCAGG - Intronic
907368347 1:53980932-53980954 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
907432555 1:54421887-54421909 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
907805032 1:57810293-57810315 GCCATCCTCCTCTGTCTCCCAGG - Intronic
908267851 1:62396173-62396195 ACAGTCTTGCTCTGCCGCCCAGG - Intergenic
908493325 1:64668299-64668321 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
909252104 1:73371286-73371308 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
909334831 1:74460297-74460319 GACCTCGTGATCTGCCGCCTCGG + Intronic
909401587 1:75238252-75238274 GCCCCACTGCTCTGCAGCCTGGG + Intronic
909785578 1:79607933-79607955 GCCTTCTTGCTCTGTCGCCCAGG + Intergenic
909899225 1:81111255-81111277 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
909988190 1:82188523-82188545 GCGGTCTTGCTCTGCTGCCCAGG + Intergenic
910597790 1:88997863-88997885 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
911148054 1:94570814-94570836 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
911632170 1:100195688-100195710 GGCGTCTTGCTCTGTCGCCCAGG + Exonic
911747774 1:101459044-101459066 GCAGTCTTGCTCTGCCACCCAGG - Intergenic
911903094 1:103529833-103529855 CACCTCCTGCTGTGCGGCCCAGG - Intronic
912043373 1:105419811-105419833 GGACTCTTGCTCTGCCACCCAGG + Intergenic
912324318 1:108743752-108743774 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
912666080 1:111580819-111580841 ACAGTCTTGCTCTGCCGCCCAGG - Intronic
912693624 1:111823353-111823375 GCCCTCCTGTTCTCCCTCCATGG + Intronic
912820606 1:112864963-112864985 GCAGTCCTGCTCTGTTGCCCAGG + Intergenic
913602517 1:120435608-120435630 GACCTCGTGATCTGCCGCCTCGG - Intergenic
913671057 1:121097661-121097683 GCCCGCCTGCTCTCGGGCCCCGG + Intergenic
914084527 1:144440899-144440921 GACCTCGTGATCTGCCGCCTCGG + Intronic
914190540 1:145406165-145406187 GACCTCGTGATCTGCCGCCTCGG + Intergenic
914198805 1:145466215-145466237 GCCGTCTCGCTCTGTCGCCCAGG + Intergenic
914363689 1:146959240-146959262 GACCTCGTGATCTGCCGCCTCGG - Intronic
914477914 1:148039351-148039373 GCCGTCTCGCTCTGTCGCCCAGG + Intergenic
914487985 1:148127886-148127908 GACCTCGTGATCTGCCGCCTCGG + Intronic
914731784 1:150377570-150377592 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
914737736 1:150434328-150434350 ACAGTCTTGCTCTGCCGCCCAGG - Intronic
914833526 1:151188854-151188876 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
914981049 1:152414623-152414645 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
914999064 1:152571537-152571559 GGAATCTTGCTCTGCCGCCCAGG - Intronic
915094624 1:153452836-153452858 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
915291312 1:154885772-154885794 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
915749039 1:158187432-158187454 GGCATCTTGCTCTGTCGCCCAGG + Intergenic
915835672 1:159173013-159173035 GCCCTCCTCCTCTTCCGACAGGG - Intronic
915974255 1:160374811-160374833 GCCCTTCTGCTCTCCAGCCCAGG - Intergenic
916231493 1:162545269-162545291 GGAGTCATGCTCTGCCGCCCAGG - Intergenic
916405629 1:164495417-164495439 GACATCTTGCTCTGTCGCCCAGG - Intergenic
916649592 1:166822517-166822539 GCCCTCCTCCCCTCCCGTCCCGG + Intergenic
917036222 1:170750000-170750022 AGCCTCCTGATCTGCAGCCCAGG - Intergenic
917341377 1:173981872-173981894 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
917357476 1:174141804-174141826 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
917366005 1:174232733-174232755 GGCGTCTTGCTCTGTCGCCCAGG - Intronic
917423123 1:174885939-174885961 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
917796202 1:178534539-178534561 GATCTCCTCCTCTGCCTCCCAGG + Intronic
918621901 1:186614831-186614853 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
918629540 1:186699519-186699541 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
918995317 1:191751865-191751887 GAAATCCTGCTCTGTCGCCCAGG + Intergenic
919399108 1:197087098-197087120 TCTCTCTTGCTCTGTCGCCCAGG + Intronic
919596130 1:199564989-199565011 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
919616546 1:199815207-199815229 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
919679091 1:200416739-200416761 GCAGTCTTGCTCTGCCGCCCAGG + Intergenic
919826778 1:201508462-201508484 ACACTCTTGCTCTGTCGCCCAGG - Intronic
920121220 1:203660054-203660076 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
920286087 1:204881001-204881023 GCCCTCCTGCCCTCCCTCCTGGG + Intronic
920304669 1:205010875-205010897 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
920419760 1:205824750-205824772 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
920611876 1:207448829-207448851 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
920937631 1:210450263-210450285 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
921177977 1:212609608-212609630 GCCCTCCCCGTCTTCCGCCCCGG - Intronic
921344058 1:214163601-214163623 GCTCTGTTGCTCTGTCGCCCAGG - Intergenic
921796782 1:219354220-219354242 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
921820126 1:219607759-219607781 GGACTCTTGCTCTGCTGCCCAGG + Intergenic
922289097 1:224195571-224195593 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
922564767 1:226594500-226594522 GCCCCTCTGCACTGCCTCCCAGG - Intronic
922652914 1:227356447-227356469 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
922968432 1:229713622-229713644 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
923119629 1:230978506-230978528 GCCCCGCTGCCCCGCCGCCCCGG + Intronic
923272782 1:232372735-232372757 GCCCACCTCCTGTCCCGCCCCGG - Intergenic
923533280 1:234828617-234828639 GTCTTCCTGCTCTGTTGCCCAGG - Intergenic
923688756 1:236173246-236173268 GCACTCCTGCTCTCCAGCCTGGG + Intronic
923800939 1:237207538-237207560 AGCCTCCTGCTCTGTCGCCCAGG - Intronic
924060275 1:240167094-240167116 GGAGTCCTGCTCTGCCACCCAGG - Intronic
924079046 1:240373156-240373178 GGACTCTTGCTCTGTCGCCCAGG - Intronic
924105596 1:240645947-240645969 GACCTCGTGATCTGCCGCCTCGG - Intergenic
924728403 1:246690725-246690747 ACACTCTTGCTCTGTCGCCCAGG - Intergenic
924810749 1:247399861-247399883 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1062788493 10:285290-285312 GCCCTCCTCCTCCTCAGCCCTGG - Intronic
1063297097 10:4817691-4817713 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1063365513 10:5488052-5488074 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1063635542 10:7778711-7778733 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1063774226 10:9242876-9242898 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1064032889 10:11894348-11894370 GCCCTCCTCGTCTGCCGTGCCGG - Intergenic
1064057882 10:12113221-12113243 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1064970735 10:21063842-21063864 GTACTCTTGCTCTGTCGCCCAGG - Intronic
1065479490 10:26177993-26178015 GCTCTCCTGCTCTCTGGCCCTGG + Intronic
1065504441 10:26415152-26415174 ACAGTCCTGCTCTGTCGCCCAGG - Intergenic
1065583485 10:27194584-27194606 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1065699868 10:28414547-28414569 GGCGTCCCGCTCTGTCGCCCAGG + Intergenic
1065834505 10:29644643-29644665 GGAATCTTGCTCTGCCGCCCAGG - Intronic
1065914230 10:30339095-30339117 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1066113825 10:32221870-32221892 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1066385055 10:34934845-34934867 GCAGTCTTGCTCTGTCGCCCGGG - Intergenic
1066561212 10:36671706-36671728 GCCCTGCTGCTCTGTCTCCCAGG - Intergenic
1067030826 10:42878117-42878139 GCCCTCCTGCCCACCCACCCCGG + Intergenic
1067363177 10:45600839-45600861 GCCTGCCGGCCCTGCCGCCCCGG + Intergenic
1067455757 10:46418410-46418432 TCCTTCCTGCTCTTCCGCCACGG + Intergenic
1067464020 10:46480600-46480622 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1067623175 10:47904051-47904073 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1067631445 10:47966229-47966251 TCCTTCCTGCTCTTCCGCCACGG - Intergenic
1067699005 10:48555428-48555450 ACCTTCCAGCTCTGCAGCCCTGG - Intronic
1068598358 10:58928442-58928464 GCTCTCTTGCTCTGTCACCCAGG - Intergenic
1069051136 10:63796059-63796081 GAAGTCCTGCTCTGTCGCCCAGG + Intergenic
1069621620 10:69840900-69840922 CCCTTCCAGCTCTGGCGCCCGGG - Intronic
1069675251 10:70241709-70241731 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1069692839 10:70365083-70365105 GAAGTCTTGCTCTGCCGCCCAGG + Intronic
1069966612 10:72123311-72123333 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1069992955 10:72326051-72326073 GCCCGCCGGCCCTGCCGCCCCGG + Intergenic
1070162459 10:73874352-73874374 CCCTGCCTGCCCTGCCGCCCGGG - Intronic
1070252720 10:74787165-74787187 GCAGCCGTGCTCTGCCGCCCAGG + Intergenic
1070279701 10:75039488-75039510 GCAGTCTTGCTCTGTCGCCCCGG - Intronic
1070302659 10:75215745-75215767 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1070751018 10:78963987-78964009 GCCACCCTGCCCTGCCTCCCAGG + Intergenic
1071583084 10:86791743-86791765 TCCCTCTTGCTCTGTTGCCCAGG + Intronic
1071585327 10:86815014-86815036 GACCTCGTGGTCTGCCGCCTCGG + Intronic
1071865489 10:89725679-89725701 GTCCTCCTGCCCAGCCTCCCAGG + Intronic
1072130299 10:92487820-92487842 ACAGTCTTGCTCTGCCGCCCAGG + Intronic
1072335986 10:94399088-94399110 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1072682551 10:97517411-97517433 GCCCACCAGCTCTGCCCCTCAGG + Intronic
1072846877 10:98841229-98841251 CGTCTCTTGCTCTGCCGCCCAGG - Intronic
1072939341 10:99745829-99745851 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1073137932 10:101229960-101229982 GCCCTCCTGCGCTGGCCCGCAGG + Intergenic
1073304969 10:102495784-102495806 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1074143892 10:110699982-110700004 GCCATCCTGCTCTGTCCACCCGG - Intronic
1074367268 10:112869186-112869208 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1074448820 10:113542368-113542390 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1074498643 10:114002380-114002402 GCCTGCCTGCTCTTCCGCCTGGG + Intergenic
1074666758 10:115736791-115736813 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1074666938 10:115738162-115738184 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1074844356 10:117384214-117384236 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1075155098 10:119969270-119969292 GTCTTCTTGCTCTGTCGCCCAGG + Intergenic
1075334190 10:121597303-121597325 GCCTGCCTGCTCTGCCGCAGCGG - Intronic
1075877333 10:125819008-125819030 GCAGTCCTGCTCTGTCGCCCAGG + Intronic
1075937045 10:126351439-126351461 TCCCTCCTGCTCTGGCCCTCTGG + Intronic
1076083642 10:127606080-127606102 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1076358137 10:129867593-129867615 ACCCCCCTGCCCTGCAGCCCTGG - Intronic
1076456051 10:130597550-130597572 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1076627985 10:131833649-131833671 GCTCTCCTGCTCGGCCTCCAGGG - Intergenic
1076737633 10:132465858-132465880 GTCTTCCTGCTCCGCCCCCCGGG - Intergenic
1076745101 10:132509023-132509045 GCGCACCTGCTCAGCAGCCCTGG - Intergenic
1076790328 10:132773787-132773809 AGCCTCCTGCTCTGTTGCCCGGG + Intronic
1077145913 11:1044540-1044562 AGTCTCGTGCTCTGCCGCCCAGG + Intergenic
1077186342 11:1237041-1237063 CCCCTCCTGCCCGGACGCCCTGG + Exonic
1077333619 11:1994031-1994053 ACCACCCTGCTCTTCCGCCCTGG + Intergenic
1077709773 11:4523976-4523998 ACACTCCTGCTCTGTCACCCAGG - Intergenic
1077864217 11:6209973-6209995 GCCCTCCGGCCCTGCCGACCTGG - Exonic
1077878874 11:6331747-6331769 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
1077881139 11:6351263-6351285 GTCCTCCTGCTCTGTCGCCTAGG - Intergenic
1078230934 11:9442437-9442459 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1078287297 11:9970230-9970252 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1079025606 11:16945562-16945584 GCCCTCCTTCTCTGCCCTTCAGG - Intronic
1079603714 11:22341506-22341528 TCGCCCCTGCTCTGCCGCGCAGG + Exonic
1079708886 11:23655489-23655511 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1080367755 11:31596376-31596398 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1080436761 11:32252103-32252125 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1080642388 11:34165360-34165382 GCCCTCCTCCTCTGTGCCCCTGG - Intronic
1081235870 11:40646630-40646652 GGACTCTTGCTCTGCCGCCCAGG + Intronic
1081401661 11:42649921-42649943 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
1081969816 11:47190172-47190194 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
1083212054 11:61194220-61194242 GCCTTCCTGCCCTCCTGCCCTGG - Intergenic
1083324598 11:61866881-61866903 TCCCTCCCGCTCTGCCTCCCTGG - Exonic
1083437676 11:62653736-62653758 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1083465260 11:62841289-62841311 GTCGTCTTGCTCTGTCGCCCAGG - Intronic
1083621488 11:64051512-64051534 GGCCGACAGCTCTGCCGCCCAGG - Intronic
1083727728 11:64637143-64637165 TCCCTCCTGCCCTTCCTCCCAGG - Intronic
1083786124 11:64948680-64948702 GGCATCTTGCTCTGCCGCCCAGG + Intronic
1083817414 11:65143282-65143304 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1083882590 11:65555804-65555826 GCCCTCCTGCCCTCCTGCCCTGG - Intronic
1084040863 11:66541955-66541977 GCCCTCCTGGTTTGCCACCTTGG - Intronic
1084134309 11:67164644-67164666 GACATCTTGCTCTGTCGCCCAGG + Intronic
1084180745 11:67444497-67444519 GGTCTCTTGCTCTGTCGCCCAGG + Intergenic
1084422096 11:69065588-69065610 GCCATCATGCCCTGCCACCCTGG + Intronic
1084525577 11:69695906-69695928 GGAGTCTTGCTCTGCCGCCCCGG + Intergenic
1084527014 11:69704004-69704026 GCGCTCCTGCTCTGACGGCGCGG + Exonic
1084549925 11:69835090-69835112 CCCCTCCTGCCCAGCAGCCCAGG - Intergenic
1084615724 11:70234561-70234583 GGGGTCCTGCTCTGTCGCCCAGG + Intergenic
1084634316 11:70380549-70380571 ACAGTCCTGCTCTGTCGCCCAGG - Intronic
1084829221 11:71755959-71755981 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1085102421 11:73812687-73812709 GGGATCCTGCTCTGTCGCCCAGG - Intronic
1085426305 11:76407549-76407571 GGAGTCTTGCTCTGCCGCCCAGG - Exonic
1085503448 11:77041929-77041951 GCAGTCTTGCTCTGTCGCCCAGG - Exonic
1085558864 11:77451623-77451645 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1085962305 11:81476644-81476666 GGCCTCTTGCTCTGTCACCCAGG + Intergenic
1086122650 11:83317157-83317179 GCGCCTCTGCCCTGCCGCCCCGG - Intergenic
1086359269 11:86039976-86039998 GGCGTCATGCTCTGTCGCCCAGG - Intronic
1087357683 11:97115885-97115907 GGAGTCCTGCTCTGCCACCCAGG + Intergenic
1087411029 11:97790299-97790321 ACACTCTTGCTCTGTCGCCCAGG + Intergenic
1087775718 11:102254890-102254912 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1088300157 11:108349635-108349657 ACAGTCTTGCTCTGCCGCCCAGG - Intronic
1088374113 11:109121270-109121292 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1088641211 11:111874733-111874755 GGAGTCTTGCTCTGCCGCCCAGG - Exonic
1088661871 11:112055267-112055289 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1089716144 11:120361189-120361211 CACCTCCTGCTGTGCAGCCCTGG - Intronic
1089970344 11:122688287-122688309 TCCCTCTTGCTCTGTTGCCCAGG + Intronic
1090286454 11:125503611-125503633 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1090345582 11:126066767-126066789 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
1090598728 11:128347418-128347440 GACCTCGTGATCCGCCGCCCTGG + Intergenic
1090783516 11:130028331-130028353 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1090824137 11:130371906-130371928 GCCCTCGTGATCTGCCCGCCTGG + Intergenic
1091161211 11:133422524-133422546 GGGGTCCTGCTCTACCGCCCAGG + Intronic
1091292444 11:134448989-134449011 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1091309544 11:134562830-134562852 GGCCTCCAGCTCTGTGGCCCTGG - Intergenic
1202816600 11_KI270721v1_random:49213-49235 ACCACCCTGCTCTTCCGCCCTGG + Intergenic
1091489452 12:920189-920211 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1091559206 12:1597880-1597902 GGTCTCTTGCTCTGTCGCCCAGG - Intronic
1092391801 12:8086586-8086608 GCAGTCCTGCTCTGTCGCCTAGG - Intronic
1092569102 12:9702409-9702431 GCTCTGCTGCTCTGCCACTCTGG + Intergenic
1092798297 12:12136159-12136181 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1092862534 12:12731113-12731135 GGCGTCTTGCTCTGTCGCCCAGG - Intronic
1092912521 12:13159870-13159892 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1092999542 12:13981751-13981773 CCCCTCCTGCTCTCCCTCTCCGG - Intergenic
1093111654 12:15159796-15159818 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1093564851 12:20589841-20589863 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1093591030 12:20903046-20903068 GGAATCCTGCTCTGTCGCCCAGG - Intronic
1094015311 12:25856638-25856660 ACCGTCTTGCTCTGTCGCCCAGG - Intergenic
1094167425 12:27456833-27456855 CACCTCCTGCTGTGCGGCCCAGG - Intergenic
1094204342 12:27824811-27824833 GCCCTCTGTCTCTGCCGTCCCGG + Intergenic
1095190962 12:39257466-39257488 GCCCTCCTGTTCTGCCATCTGGG + Intergenic
1095316483 12:40767657-40767679 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1095600025 12:44003131-44003153 CCCCTCCTCCTCTACTGCCCTGG + Intronic
1095745287 12:45651689-45651711 GCTCTCCTGCTCTGTCATCCAGG + Intergenic
1096126888 12:49126290-49126312 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
1096133298 12:49178444-49178466 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1096156031 12:49342106-49342128 TCCCTCCTGCACTCCCTCCCCGG + Intergenic
1096299620 12:50415176-50415198 GATCTCCTGCTCTGTTGCCCAGG - Intronic
1096971144 12:55667264-55667286 GCTCTCTCGCTCTGTCGCCCAGG - Intergenic
1097138797 12:56881966-56881988 GGCCTCTTGCTCTGTCACCCAGG + Intergenic
1097288445 12:57895149-57895171 GCCCTTCCACTCTGCCTCCCAGG - Intergenic
1097313645 12:58149457-58149479 TTCCTCTTGCTCTGCTGCCCAGG + Intergenic
1097449144 12:59714588-59714610 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1097475593 12:60051671-60051693 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1097894730 12:64813362-64813384 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1098054914 12:66494853-66494875 TCCTTCCTGCTCTGTCACCCTGG - Intronic
1098243130 12:68488382-68488404 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1098265141 12:68710627-68710649 GACGGCCTGCTCTGTCGCCCAGG - Intronic
1098279140 12:68845787-68845809 GCGGTCTTGCTCTGTCGCCCAGG + Exonic
1098303678 12:69080147-69080169 GCACTGCTGCACTCCCGCCCGGG + Intergenic
1098353614 12:69588770-69588792 GCTCACCTGCTGTGCAGCCCAGG - Intronic
1098790066 12:74810757-74810779 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1098925900 12:76349075-76349097 GGACTCCCGCTCTGTCGCCCAGG + Intergenic
1098950681 12:76637583-76637605 GCAGTCCTGCTCTGTTGCCCAGG + Intergenic
1100487457 12:95044291-95044313 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1100854753 12:98749122-98749144 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1101103270 12:101416470-101416492 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1101688277 12:107048104-107048126 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1101806119 12:108065408-108065430 GCCCTCCTGCCAGGCAGCCCTGG - Intergenic
1101808178 12:108083266-108083288 GGCCTCCTCCCCTGCAGCCCAGG + Intergenic
1101935107 12:109050962-109050984 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1102006711 12:109593747-109593769 GTCATCTTGCTCTGTCGCCCAGG + Intronic
1102007169 12:109596322-109596344 GCCTTCCTGCTGTGCCTTCCTGG - Intronic
1102023349 12:109699101-109699123 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1102235854 12:111294140-111294162 GCACTCCAGCTCTGTAGCCCAGG - Intronic
1102268475 12:111508470-111508492 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1102282640 12:111630369-111630391 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1102466876 12:113135299-113135321 GCCCTCCTGCCAACCCGCCCTGG + Intronic
1102745337 12:115244419-115244441 TCCCTCCTGCTCCCCAGCCCTGG - Intergenic
1102946417 12:116993127-116993149 GACGTCTTGCTCTGTCGCCCAGG + Intronic
1103042370 12:117706067-117706089 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1103111057 12:118278830-118278852 GCTGTCTTGCTCTGTCGCCCAGG + Intronic
1103397552 12:120619517-120619539 GTCCTCCTCCTCTTCCTCCCAGG - Intergenic
1103596577 12:122027809-122027831 GGACTCCTGCTCTGTGGCCCAGG - Intronic
1103628658 12:122241329-122241351 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1103814486 12:123642898-123642920 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1103988582 12:124783534-124783556 GACCTCATGATCTGCCGCCTTGG - Intronic
1104121708 12:125806205-125806227 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1104457937 12:128931025-128931047 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1104670070 12:130674448-130674470 GCCATCCTGCTCTGTCCCCCAGG - Intronic
1104746548 12:131214596-131214618 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1104991794 12:132628615-132628637 GCCTCCTTGCTCTGTCGCCCAGG - Intronic
1105220579 13:18322714-18322736 GCCCTCCTGCTCTTTCTCTCTGG + Intergenic
1105371642 13:19806847-19806869 GGCATCTTGCTCTGTCGCCCAGG - Intergenic
1105515000 13:21081563-21081585 GACCTCATGCTCTGCCCACCTGG - Intergenic
1105673323 13:22643915-22643937 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1106038290 13:26065572-26065594 GACCTCCTGATCTGCCCGCCTGG + Intergenic
1106044549 13:26126450-26126472 GCCCCCTTGCCCTGCCTCCCTGG - Intergenic
1106620149 13:31364848-31364870 GGCCTCCTGCTCTGCGGAGCAGG + Intergenic
1106841780 13:33691805-33691827 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1107005212 13:35601734-35601756 GGAGTCCTGCTCTGCCACCCAGG - Intronic
1107786797 13:43965574-43965596 AGCGTCCTGCTCTGCCGCCTAGG - Intergenic
1107836098 13:44413672-44413694 GCCGGCCGGCCCTGCCGCCCCGG + Intergenic
1107937280 13:45355857-45355879 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1108352313 13:49598629-49598651 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1108361182 13:49669224-49669246 GGACTCTTGCTCTGTCGCCCGGG + Intronic
1108544006 13:51472709-51472731 GACCTCCTGATCTGCCCGCCTGG + Intergenic
1108683694 13:52800870-52800892 GGAGTCCTGCTCTGCCACCCAGG - Intergenic
1109898194 13:68723526-68723548 CTCCTCTCGCTCTGCCGCCCAGG + Intergenic
1109898542 13:68729787-68729809 ACCCTGCTGCTCTGCCCCTCTGG + Intergenic
1110295973 13:73866227-73866249 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1110444807 13:75567571-75567593 GCAGTCTCGCTCTGCCGCCCAGG + Intronic
1110940311 13:81341034-81341056 GCCGGCCCGCCCTGCCGCCCCGG - Intergenic
1110959730 13:81606492-81606514 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1111824119 13:93246764-93246786 ACAGTCTTGCTCTGCCGCCCAGG - Intronic
1111943603 13:94639794-94639816 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1111982330 13:95030044-95030066 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1112097560 13:96151376-96151398 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1112282830 13:98077528-98077550 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
1113473111 13:110561062-110561084 GCGTTCCTGCTCTGCCGCCCTGG - Intronic
1113657750 13:112079407-112079429 TCCCACCTGCTCTGCCTCCGGGG + Intergenic
1113678907 13:112228659-112228681 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1113739548 13:112701805-112701827 GACAGCCTGCTCTGTCGCCCAGG - Intronic
1113803736 13:113101157-113101179 GACCTCGTGATCTGCCGCCTCGG - Intergenic
1113942381 13:114024983-114025005 GGCCTCCTGCTCTGCTGCAAGGG - Intronic
1114039599 14:18664552-18664574 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1114263146 14:21053599-21053621 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1114371331 14:22092228-22092250 GGCATCTTGCTCTGTCGCCCAGG + Intergenic
1114525558 14:23365392-23365414 GCCCGCCTGCTCACCCGCCCCGG - Exonic
1115014428 14:28593178-28593200 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1115728192 14:36239633-36239655 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1115856760 14:37638278-37638300 GGATTCTTGCTCTGCCGCCCAGG + Intronic
1116114516 14:40629902-40629924 GCCGGCCCGCTCTGCCGCCCCGG - Intergenic
1116266551 14:42698582-42698604 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1116270723 14:42762087-42762109 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1116842984 14:49838608-49838630 GGCATCTTGCTCTGTCGCCCAGG + Intronic
1116904438 14:50391406-50391428 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1117085027 14:52191261-52191283 GGAGTCCTGCTCTGCCACCCAGG - Intergenic
1117554412 14:56869854-56869876 CACCTCCTGCTGTGCGGCCCAGG - Intergenic
1117584525 14:57186505-57186527 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1117663091 14:58028683-58028705 GGCCTCCTGCACTGCAGCCATGG - Intronic
1117943398 14:60992871-60992893 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1118171492 14:63393684-63393706 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1118360265 14:65050563-65050585 GCTATCTTGCTCTGTCGCCCAGG - Intronic
1118374008 14:65161312-65161334 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1118591486 14:67405197-67405219 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1118638712 14:67772210-67772232 GACCTCTGGCTCTGCCTCCCAGG - Exonic
1118800139 14:69182368-69182390 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1118972677 14:70650395-70650417 GGTGTCCTGCTCTGTCGCCCAGG - Intronic
1119239097 14:73043933-73043955 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1119284965 14:73446020-73446042 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1119314088 14:73676994-73677016 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1119385349 14:74254803-74254825 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1119526668 14:75328125-75328147 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1119626233 14:76178781-76178803 CACCTCCTGCTGTGCGGCCCCGG + Intronic
1119707933 14:76798165-76798187 GCCCTACTGCACTCCCGCCTGGG - Intronic
1119709364 14:76810373-76810395 GCCCTTCTGCACTCCCGCCTGGG + Intronic
1119746547 14:77048737-77048759 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1119854763 14:77891238-77891260 GCAATCCTGCTCTCCTGCCCTGG - Intronic
1119880732 14:78097430-78097452 GCCCTCCTGCTGTGTAGCCTAGG - Intergenic
1120209884 14:81624030-81624052 GCCGGCCAGCCCTGCCGCCCCGG - Intergenic
1120427286 14:84364301-84364323 GGCTTCTTGCTCTGTCGCCCAGG - Intergenic
1120865348 14:89291590-89291612 GCCATTCTGCTTTGCTGCCCTGG + Intronic
1120876662 14:89381832-89381854 CCCCTCCTTCTCTGTTGCCCAGG - Intronic
1120948996 14:90023715-90023737 AGGCTCTTGCTCTGCCGCCCAGG + Intronic
1121284884 14:92727402-92727424 GCAGTCTTGCTCTGCCACCCAGG - Intronic
1121378915 14:93443447-93443469 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1121750612 14:96351708-96351730 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1121973341 14:98379512-98379534 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1122348233 14:101073465-101073487 GCCTTCCTGCTCCACCGCCTGGG + Intergenic
1122390882 14:101382628-101382650 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1122456998 14:101861937-101861959 GCCGTCTTGCTCTGTTGCCCAGG + Intronic
1122540660 14:102496121-102496143 GCCCTCCTGGTCGGCCTCCATGG - Intronic
1122550568 14:102546927-102546949 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1122635365 14:103127236-103127258 GCGCTCCTGCTCCGCCACCACGG - Exonic
1122782540 14:104149744-104149766 TGCCTCCTGCTGTGCAGCCCTGG + Intronic
1122941707 14:104984470-104984492 GCCCGGCTGCTCTGCCCCTCAGG + Intergenic
1122944785 14:105002479-105002501 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1122992452 14:105243422-105243444 GTCTTGCTGCTCTGTCGCCCAGG - Intronic
1123464321 15:20503580-20503602 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1123500551 15:20877781-20877803 GCCCTCCCGCTCAGCCGAGCGGG + Intergenic
1123557796 15:21451474-21451496 GCCCTCCCGCTCAGCCGAGCGGG + Intergenic
1123594023 15:21888755-21888777 GCCCTCCCGCTCAGCCGAGCGGG + Intergenic
1123653742 15:22496841-22496863 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1123684713 15:22788471-22788493 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1123689177 15:22822942-22822964 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1123867135 15:24532477-24532499 GACCTCGTGATCTGCCGCCTCGG - Intergenic
1123909291 15:24950885-24950907 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1124118455 15:26868072-26868094 GCCCACCTGCCCTGGCGCGCCGG + Intronic
1124275049 15:28319557-28319579 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1124307649 15:28592038-28592060 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1124366912 15:29078583-29078605 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1124402120 15:29357811-29357833 GCTCTCTTGCTCTGTCGCCCAGG - Intronic
1124899018 15:33805501-33805523 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1124957465 15:34368695-34368717 GCGCTCTTGCTCTGTTGCCCAGG + Intergenic
1125244646 15:37620965-37620987 GACCTCATGATCTGCCGCCCTGG + Intergenic
1125365986 15:38916833-38916855 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1125366822 15:38926539-38926561 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1125694554 15:41624271-41624293 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1125701965 15:41694501-41694523 GGCATCCTGCTCTGTTGCCCAGG + Intronic
1125722229 15:41850848-41850870 GCCCACCTGCAGTGCTGCCCAGG + Exonic
1125799074 15:42428787-42428809 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1125923850 15:43545150-43545172 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1126003079 15:44230287-44230309 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1126182369 15:45798113-45798135 GGAATCCTGCTCTGTCGCCCAGG + Intergenic
1126466297 15:48964177-48964199 GCTCTTCTGCTCTGCCCTCCCGG - Intergenic
1127668662 15:61173679-61173701 GGGGTCCTGCTCTGCCACCCAGG + Intronic
1127729110 15:61781807-61781829 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1127766080 15:62186826-62186848 GCCCGCTGGCCCTGCCGCCCCGG - Intergenic
1128345883 15:66852222-66852244 GCCGTCTGGCTCTGCCTCCCTGG + Intergenic
1128441450 15:67712889-67712911 GACAGCCTGCTCTGTCGCCCAGG - Intronic
1128778712 15:70343353-70343375 GCCCTCCAGCTCTGCAGCTGTGG - Intergenic
1128981779 15:72193546-72193568 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1129248975 15:74297834-74297856 CCTCTCCTGCTCAGCTGCCCCGG + Intronic
1129640204 15:77368490-77368512 GGCATCTTGCTCTGTCGCCCAGG - Intronic
1129801072 15:78414785-78414807 TGCCTCCTGCTCTGCTCCCCAGG - Intergenic
1131020603 15:89094680-89094702 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1131126194 15:89859417-89859439 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1131214136 15:90522898-90522920 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1131215312 15:90530603-90530625 GCCCTGCTGTTCTGCCGGCGTGG + Intronic
1131254673 15:90854260-90854282 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1131303858 15:91224092-91224114 GCCCTCCTGGTCTTCAGCCCTGG - Intronic
1131637964 15:94257903-94257925 GGAATCATGCTCTGCCGCCCAGG + Intronic
1131648381 15:94371712-94371734 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1131785144 15:95904480-95904502 ACACTCTTGCTCTGTCGCCCTGG - Intergenic
1132249011 15:100319314-100319336 TCCCTCCTGCCCTGCTTCCCTGG - Intronic
1132252150 15:100341928-100341950 GCGCTCCTGCTTCGCCGCCACGG - Exonic
1202966146 15_KI270727v1_random:178646-178668 GCCCTCCCGCTCAGCCGAGCGGG + Intergenic
1132505500 16:306484-306506 GCCTTCCTGCCCTCCCGCCGTGG + Intronic
1132528359 16:429523-429545 TCTCGCCTGCTCTGTCGCCCAGG + Intronic
1132530611 16:446719-446741 GCACTCTCGCTCTGTCGCCCAGG + Intronic
1132573509 16:654404-654426 GGCATCTTGCTCTGTCGCCCAGG + Intronic
1132581928 16:688754-688776 ACCCACCTCCTCTGCCTCCCTGG + Intronic
1132783024 16:1638889-1638911 GCCCTCCTGCACTTCCCCACTGG + Intronic
1132848811 16:2014589-2014611 GGTCTCTTGCTCTGTCGCCCTGG + Intronic
1132895048 16:2224755-2224777 GGAGTCCGGCTCTGCCGCCCAGG - Intronic
1132905494 16:2280596-2280618 GCCCTCCTGCACCTCTGCCCGGG - Intronic
1133055621 16:3144214-3144236 GCCCTGATGCTCAGCAGCCCTGG + Intronic
1133065124 16:3200570-3200592 GACGTCTTGCTCTGTCGCCCAGG - Intergenic
1133209614 16:4256226-4256248 GGGGTCCTGCTCTGTCGCCCAGG - Intergenic
1133288918 16:4705104-4705126 GCCGTGGGGCTCTGCCGCCCAGG + Exonic
1133796908 16:9053502-9053524 GCCCTCCTCCTCTGTCCACCTGG + Intergenic
1134079511 16:11315443-11315465 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1134111176 16:11516297-11516319 GCCCTCCTGCAGTGCCACCCTGG - Exonic
1134484751 16:14648884-14648906 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1134602201 16:15542293-15542315 GACCTCGTGATCTGCCGGCCTGG + Intronic
1134603234 16:15549973-15549995 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1135402750 16:22177600-22177622 GGAATCTTGCTCTGCCGCCCAGG - Intronic
1135696719 16:24594395-24594417 ACAGTCCTGCTCTGCCCCCCAGG + Intergenic
1135732437 16:24906313-24906335 AGCCTCTTGCTCTGTCGCCCAGG - Intronic
1135809381 16:25573766-25573788 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1135844792 16:25909212-25909234 GGGCTCTTGCTCTGCAGCCCAGG + Intronic
1136192039 16:28622587-28622609 TTCCACCTGCTCTGCCCCCCAGG + Intronic
1136302059 16:29341907-29341929 GGCATCTTGCTCTGTCGCCCAGG - Intergenic
1136347652 16:29686520-29686542 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1136381765 16:29899333-29899355 ACCCTCCTGCTCAGGCGCCTGGG + Exonic
1136500412 16:30667350-30667372 GACCTCCTGCCCTGCCTTCCGGG + Exonic
1136590996 16:31217638-31217660 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1136592937 16:31228595-31228617 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1136605906 16:31333547-31333569 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1136614654 16:31390508-31390530 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1136696544 16:32085595-32085617 GGCTTCTTGCCCTGCCGCCCCGG - Intergenic
1136797045 16:33028879-33028901 GGCTTCTTGCCCTGCCGCCCCGG - Intergenic
1137084488 16:36102447-36102469 GGCTTCTTGCCCTGCCGCCCCGG - Intergenic
1137295247 16:47086078-47086100 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1137315010 16:47309092-47309114 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1137541995 16:49369919-49369941 GCCCTCCTGCTTTTCTGCCTTGG - Intergenic
1137621901 16:49881696-49881718 TGCCTCCTGCTCTGCTTCCCAGG - Intergenic
1137641434 16:50033836-50033858 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1138547350 16:57727753-57727775 GCTCTCCTGCTCTCCAGCACAGG + Intronic
1138592505 16:58009697-58009719 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1138603742 16:58073804-58073826 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1138982863 16:62292282-62292304 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1139235812 16:65337592-65337614 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1139562739 16:67754105-67754127 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1139626359 16:68192180-68192202 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1139705044 16:68735534-68735556 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1139822839 16:69734340-69734362 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1140470511 16:75211534-75211556 GGAGTCCTGCTCTGCCACCCAGG - Intergenic
1141025749 16:80545749-80545771 GCTCTGCAGCTCTGCCTCCCTGG + Intronic
1141607424 16:85162627-85162649 GCCCTCCTGTTCGGCAGCTCGGG + Intergenic
1141867151 16:86758301-86758323 GGAATCTTGCTCTGCCGCCCAGG + Intergenic
1141983950 16:87567576-87567598 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1142321487 16:89385985-89386007 GGCCTCCCGCTCAGCCTCCCAGG + Intronic
1142342345 16:89531949-89531971 GCACTGCTGCTCGGCCCCCCCGG + Exonic
1142386325 16:89767391-89767413 ACAGTCTTGCTCTGCCGCCCAGG + Intronic
1142403594 16:89873810-89873832 GCCCTCCTTCCCTGCGCCCCCGG - Exonic
1203146022 16_KI270728v1_random:1800786-1800808 GGCATCTTGCTCTGTCGCCCAGG + Intergenic
1142479491 17:209779-209801 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1142635474 17:1254413-1254435 GGACTCCCGCTCTGTCGCCCAGG - Intergenic
1142649023 17:1334399-1334421 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1142729778 17:1845508-1845530 GGCCTCTTGCTGTGCTGCCCAGG - Intronic
1142758632 17:2030189-2030211 GCCGCCCTGCTCCGCTGCCCCGG - Exonic
1143080990 17:4381198-4381220 GCTCTCCCGCTCTGTTGCCCAGG - Intergenic
1143129757 17:4670692-4670714 GGACTCCTGCTCTGTCGCCCAGG - Intergenic
1143183359 17:4997413-4997435 GCCCTCAAGTTCGGCCGCCCTGG - Intronic
1143488927 17:7272370-7272392 GACAGCCTGCTCTGTCGCCCAGG - Intergenic
1143573227 17:7774328-7774350 ACCATCCTGCTCTGTCCCCCAGG - Intronic
1143659882 17:8318338-8318360 GGCCCCCTGCTCTGTGGCCCTGG - Intronic
1143679731 17:8467435-8467457 GCCCTCCTGAGCTCCCACCCAGG + Exonic
1143681413 17:8478754-8478776 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1143759291 17:9089387-9089409 GGAATCTTGCTCTGCCGCCCAGG - Intronic
1143971493 17:10799221-10799243 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1144794681 17:17882977-17882999 GCCCTGCTCCACTGCTGCCCGGG + Intronic
1144845367 17:18215241-18215263 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1144854255 17:18259191-18259213 GTCTTCTTGCTCTGCTGCCCAGG + Intergenic
1145951496 17:28821937-28821959 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1146201127 17:30859755-30859777 GGCGTCTTGCTCTGCCGCCCAGG + Intronic
1146439336 17:32880200-32880222 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1146740482 17:35279177-35279199 GCCGGCTGGCTCTGCCGCCCGGG - Intergenic
1146787355 17:35731782-35731804 GCCCCCCGGCTCCCCCGCCCGGG - Exonic
1147113365 17:38280233-38280255 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1147141205 17:38461495-38461517 GCCTTCCTGCTCTGCCACTGGGG + Intronic
1147165348 17:38590259-38590281 ACAGTCCTGCTCTGTCGCCCAGG + Intronic
1147289891 17:39433175-39433197 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1147290490 17:39438367-39438389 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1147303218 17:39546203-39546225 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1147379840 17:40047617-40047639 GCCCTACTGCACTCCAGCCCAGG + Intronic
1147423848 17:40336099-40336121 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1147428728 17:40358342-40358364 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1147573036 17:41583066-41583088 ACCCTCCTCCTCTGCAGGCCTGG - Intronic
1147590673 17:41681390-41681412 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1147593155 17:41698563-41698585 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1147607188 17:41780667-41780689 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1147622039 17:41874597-41874619 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1147643687 17:42020759-42020781 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1147696657 17:42360032-42360054 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1147820447 17:43238398-43238420 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147822559 17:43250290-43250312 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147825076 17:43265085-43265107 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147828196 17:43282605-43282627 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147829306 17:43288769-43288791 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147830396 17:43294904-43294926 GGGCTCCGGCTCTGCCGCCGGGG + Intergenic
1147971267 17:44219982-44220004 TCCCTCCGCCTCGGCCGCCCGGG - Intronic
1147980033 17:44268498-44268520 GCCCTTCTGCTCTGGCCCCAAGG + Intergenic
1147982132 17:44281164-44281186 GGACTCTTGCTCTGCCGCCCAGG - Intergenic
1148076216 17:44936663-44936685 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1148096981 17:45059212-45059234 GCTCTCTTGCTCTGTCGCCCAGG - Intronic
1148100666 17:45088726-45088748 GCATTCTTGCTCTGCTGCCCAGG - Intronic
1148149363 17:45387324-45387346 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1148178144 17:45585060-45585082 CCCCTCCTGCCCTGCCCCTCTGG - Intergenic
1148433505 17:47662548-47662570 GTCTTCTTGCTCTGTCGCCCTGG - Intronic
1148636869 17:49155747-49155769 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1148640562 17:49184129-49184151 GCCCTCCTGCTCTACAGAGCAGG - Intergenic
1148674895 17:49439414-49439436 GTCCTCCTGATCTTCCCCCCAGG + Intronic
1148684741 17:49495188-49495210 GCCCGCCCGCCCTGCCGCCTCGG - Intergenic
1148928152 17:51105842-51105864 GACAGCCTGCTCTGTCGCCCAGG - Intronic
1149316917 17:55447412-55447434 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1149548283 17:57520677-57520699 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1149712861 17:58758295-58758317 GACCTCATGATCTGCCACCCCGG - Intronic
1149876971 17:60244655-60244677 GTCATCTTGCTCTGTCGCCCAGG + Intronic
1149886674 17:60347377-60347399 GGCATCTTGCTCTGTCGCCCAGG + Intronic
1149992353 17:61390130-61390152 GCCCTCATGCGCGGCCGGCCCGG - Intronic
1149992587 17:61391208-61391230 CTCCTCCTCCTCTGCCTCCCTGG - Intronic
1150139687 17:62717472-62717494 CCCCTCCTGCTCTGTGGCCCAGG + Intronic
1150150288 17:62803543-62803565 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1150228015 17:63534279-63534301 GACCTCCTGATCTTCCGCACTGG + Exonic
1150239028 17:63617243-63617265 GACCTCGTGATCTGCCGCCTCGG - Intergenic
1150262250 17:63803670-63803692 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1150312407 17:64139492-64139514 GCTCTCTTGCTCTGTTGCCCAGG - Intergenic
1150408041 17:64919350-64919372 CCCCTCCTGCCCTGCCCCTCTGG - Intronic
1150768481 17:68021199-68021221 ACCGTCTTGCTCTGTCGCCCAGG - Intergenic
1151113179 17:71703407-71703429 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1151131038 17:71896110-71896132 CACCTCCTGCTGTGCGGCCCCGG - Intergenic
1151211295 17:72546458-72546480 GCTGTCTTGCTCTGTCGCCCAGG + Intergenic
1151585144 17:75004237-75004259 GCCCACCTGTCCTGCCTCCCAGG + Exonic
1151614621 17:75201307-75201329 GGAGTCGTGCTCTGCCGCCCAGG + Intergenic
1151713890 17:75821753-75821775 GTCCCCCTGCTCTGGCCCCCAGG - Intronic
1151732604 17:75920277-75920299 GGCCTCCAGCTCTGCCAGCCGGG + Exonic
1151745355 17:76008942-76008964 GCCCTCCTGCTCCTCCACGCCGG + Exonic
1151769113 17:76148290-76148312 GGTCTCTTGCTCTGTCGCCCAGG + Intronic
1151913574 17:77101208-77101230 GCCCTGTTGCTCTGTTGCCCAGG + Intronic
1151979651 17:77500958-77500980 GGCATCTTGCTCTGTCGCCCAGG - Intergenic
1152094851 17:78267048-78267070 GCCCTTCTCCTCTGCAGCACGGG - Intergenic
1152112605 17:78365582-78365604 GCCCTCCTCGGCTGCAGCCCTGG + Intergenic
1152114749 17:78378720-78378742 GGCCTCCTGCCTGGCCGCCCAGG + Exonic
1152183764 17:78841213-78841235 GCCCTCCCGCGCTGTCTCCCGGG + Intronic
1152391400 17:80006004-80006026 GCCTACCTGCTCTGCCCTCCGGG + Intronic
1152440195 17:80303587-80303609 ACAGTCCTGCTCTGTCGCCCAGG + Intronic
1152543919 17:80991390-80991412 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1152556400 17:81055279-81055301 GCCCTCCTTCTCAGCTCCCCAGG + Intronic
1152599445 17:81254471-81254493 GGACTCCTGCTGTGTCGCCCAGG + Intronic
1152626054 17:81388443-81388465 GCCCACCTGCCCTCCAGCCCTGG - Intergenic
1152657982 17:81528764-81528786 GCCCGGCTGCTCTGCCTCACAGG - Exonic
1152699722 17:81812956-81812978 GCCCGCCGGCTCCCCCGCCCGGG + Intronic
1152868375 17:82737361-82737383 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1153900608 18:9614496-9614518 CCCCTCCTCCGCGGCCGCCCGGG + Exonic
1153945644 18:10014817-10014839 ACGGTCTTGCTCTGCCGCCCAGG - Intergenic
1154245288 18:12691739-12691761 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1154246245 18:12702414-12702436 TCCCTCCTGCCCGGCGGCCCCGG - Exonic
1154275179 18:12952805-12952827 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1155019019 18:21877695-21877717 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1155261139 18:24043586-24043608 GCCCTTCTCGTCTGCCGCCTGGG + Intronic
1155507750 18:26548914-26548936 GCCCTCCCTCTCTCCCGCCCGGG - Exonic
1156038654 18:32794672-32794694 GCCGGCCGGCCCTGCCGCCCCGG + Intergenic
1156499837 18:37550706-37550728 GGCCTCCAGCTCTGTTGCCCAGG - Intronic
1156748892 18:40426274-40426296 GCGCTACTGCTCTCCAGCCCGGG - Intergenic
1157195910 18:45619963-45619985 GCCTCCCTGCTCTGCCACTCGGG - Intronic
1157228011 18:45885311-45885333 GGCATCTTGCTCTGTCGCCCAGG - Intronic
1157822421 18:50782810-50782832 ACCGTCTTGCTCTGTCGCCCAGG - Intergenic
1158396359 18:57081169-57081191 GCCCACTTGCTCTGGGGCCCAGG + Intergenic
1158537976 18:58325054-58325076 CTCCTCCTCCTCTGCCTCCCGGG + Exonic
1158628167 18:59089541-59089563 GGACTCCTGTTCTGTCGCCCAGG - Intergenic
1158649472 18:59273130-59273152 GGCCACCTGCTCCGCAGCCCGGG - Exonic
1158809480 18:61015617-61015639 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1158991116 18:62869911-62869933 GGGCTCTTGCTCTGTCGCCCAGG + Intronic
1159333057 18:67026838-67026860 GGTGTCTTGCTCTGCCGCCCAGG + Intergenic
1160070989 18:75627576-75627598 GCCCTTCTGCTCTGCCTGCTGGG + Intergenic
1160167742 18:76529025-76529047 GCTCCCCGGCTCTCCCGCCCTGG + Intergenic
1160335053 18:78031452-78031474 CCCCACCTGCTGTGCCCCCCCGG + Intergenic
1160495216 18:79369505-79369527 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1160532316 18:79572604-79572626 GCTCTCCTGCACTGTCACCCAGG - Intergenic
1160752250 19:739935-739957 GCCGCCTTGCTCTGTCGCCCCGG - Intronic
1160769555 19:824235-824257 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1160807264 19:997613-997635 GCCCCCCTGCACTCCAGCCCAGG + Intronic
1160835063 19:1120932-1120954 GCCCCACTGCTCTCCAGCCCAGG - Intronic
1160862114 19:1241860-1241882 GCCGCGCTGCTCCGCCGCCCGGG + Exonic
1160977237 19:1799115-1799137 GGGGTCTTGCTCTGCCGCCCAGG - Intronic
1161086399 19:2337577-2337599 GCCCGCGTGCTCCGCTGCCCTGG - Exonic
1161129420 19:2579341-2579363 GCCCTCCTGCCCGCCCGCCCTGG - Intronic
1161148114 19:2691839-2691861 GCAATCTTGCTCTGCTGCCCAGG - Intronic
1161159971 19:2756428-2756450 ACCGTCCTGCTCTGTCCCCCCGG - Intronic
1161246198 19:3253613-3253635 CCCCCCCTGCTCTGCACCCCTGG - Intronic
1161249005 19:3270603-3270625 GCCCGCCCGCCCGGCCGCCCCGG - Intronic
1161265331 19:3361015-3361037 GCGCTCTTCCTCCGCCGCCCAGG - Intronic
1161274136 19:3405944-3405966 GTCCTCCTGCTCTGTCACCCAGG + Intronic
1161306266 19:3570463-3570485 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1161329656 19:3680328-3680350 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1161629453 19:5345094-5345116 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1161723595 19:5916451-5916473 GACCTCCTCCTCGGCCTCCCAGG + Exonic
1161778745 19:6278225-6278247 TTCCTCCTCCTCTGCTGCCCTGG - Intronic
1161969400 19:7568419-7568441 GGTGTCCTGCTCTGTCGCCCAGG - Intergenic
1162052058 19:8040525-8040547 GTCCTGTTGCTCTGTCGCCCAGG + Intronic
1162129461 19:8516925-8516947 GGCGTCCTGCTCTGTTGCCCAGG - Intergenic
1162318920 19:9959466-9959488 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1162427794 19:10607304-10607326 TCCCTCTTGCTCTCCCACCCCGG + Intronic
1162465689 19:10838382-10838404 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1162585592 19:11556323-11556345 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1162675502 19:12295176-12295198 GCCCTCCTGCTCTGAGGCCAAGG - Intergenic
1162768713 19:12936514-12936536 GGCCTCCTGCTATGTTGCCCAGG + Intergenic
1162826709 19:13256998-13257020 GCTCTGCTGCTCTGCCAGCCTGG + Intronic
1162896031 19:13765061-13765083 GCCCTCCCGTTCGGCCTCCCGGG - Exonic
1163014756 19:14447748-14447770 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1163210845 19:15839018-15839040 CCCCTCCTGCTCTGACGCCACGG - Intergenic
1163352839 19:16789741-16789763 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1163429228 19:17257044-17257066 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1163606169 19:18276738-18276760 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1163660129 19:18571959-18571981 GGCCGCCTCTTCTGCCGCCCAGG - Intronic
1163665253 19:18600392-18600414 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1163716129 19:18873370-18873392 GCACTCCTGCTCTGTCTCTCTGG - Intronic
1163744618 19:19037925-19037947 TGCCTCCTGCTGTGCAGCCCAGG - Intronic
1163759563 19:19128255-19128277 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1163780866 19:19247277-19247299 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1164263139 19:23586290-23586312 TCTCTCTTGCTCTGTCGCCCAGG + Intronic
1164263148 19:23586448-23586470 TCTCTCTTGCTCTGTCGCCCAGG + Intronic
1165072748 19:33265030-33265052 GGCCTCCTGCACTGCAGCCCTGG + Intergenic
1165386402 19:35512896-35512918 GCCCCCCTCCTATGCCACCCTGG - Intronic
1165427115 19:35752378-35752400 GCCTTCCTTCTCTGGGGCCCTGG + Intronic
1165529014 19:36380718-36380740 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
1165540330 19:36488106-36488128 AGCCTCCTGCTCTGTTGCCCAGG + Intronic
1165589690 19:36957255-36957277 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1165697780 19:37913997-37914019 GGCCTCTCACTCTGCCGCCCAGG - Intronic
1165794049 19:38508442-38508464 GACCTCGTGATCTGCCGCCTCGG + Intronic
1165861428 19:38911464-38911486 GCCCACATGCTCTCCCACCCAGG - Intronic
1166032406 19:40142368-40142390 ACAGTCTTGCTCTGCCGCCCAGG + Intergenic
1166131213 19:40746830-40746852 GCAGTCTTGCTCTGTCGCCCGGG + Intronic
1166142076 19:40810632-40810654 GCCCTTCCGCTCTCCCGGCCAGG + Intronic
1166157532 19:40925146-40925168 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1166185444 19:41136162-41136184 GCCCTTCCGCTCTCCCGGCCAGG - Intergenic
1166261333 19:41643513-41643535 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1166364781 19:42272884-42272906 GCCACCCTGCCCTGCTGCCCTGG + Intronic
1166531459 19:43545939-43545961 TTCCTTCTGCTCTGCCACCCTGG + Exonic
1166586893 19:43957204-43957226 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1166697686 19:44862914-44862936 GACCTCGTGATCTGCCGCCTCGG - Intronic
1166723357 19:45010287-45010309 ACGGTCTTGCTCTGCCGCCCAGG - Intronic
1166770103 19:45276649-45276671 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1166807661 19:45496858-45496880 CCACTCCGGCTGTGCCGCCCTGG + Exonic
1167067714 19:47199357-47199379 TCCCTCTCGCTCTGTCGCCCAGG - Intronic
1167088721 19:47328647-47328669 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1167678478 19:50904388-50904410 GCGCTCTGGCTCTGTCGCCCAGG - Intergenic
1167699879 19:51036362-51036384 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1167894242 19:52568346-52568368 GGCGTCCTGCTCTGTCGCCCAGG - Intronic
1168083290 19:54026454-54026476 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1168112068 19:54198504-54198526 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1168538147 19:57189174-57189196 ACAGTCTTGCTCTGCCGCCCAGG - Intergenic
1168577419 19:57524925-57524947 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
1168579395 19:57541202-57541224 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1202681423 1_KI270712v1_random:7112-7134 GCCCTCCGCCGCCGCCGCCCCGG - Intergenic
925080409 2:1058937-1058959 GCCATCCTGCTCTCCCTCCTGGG - Intronic
925173535 2:1767180-1767202 GCCCTTCTGCCCTCCTGCCCTGG + Intergenic
925306061 2:2848970-2848992 CCTCTCCTGCTCTCCCTCCCTGG - Intergenic
925385951 2:3461808-3461830 GCCCTCCTGCTCCCCTGCCCTGG + Intronic
925978013 2:9154742-9154764 GGCATCTTGCTCTGCGGCCCAGG + Intergenic
926095797 2:10080128-10080150 GCCCTCCAGGGCTGCCGCTCCGG + Exonic
926247523 2:11132113-11132135 GCCCTGCTGCCCTGCACCCCGGG + Intergenic
926270426 2:11361597-11361619 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
926362842 2:12106401-12106423 GACCTCCTGGGCTGCCTCCCTGG - Intergenic
926535845 2:14111207-14111229 GCCCTCATGATCTGCCTGCCTGG - Intergenic
926541144 2:14182746-14182768 GCTCTGCTGCAGTGCCGCCCAGG + Intergenic
927178218 2:20424971-20424993 GGCCTCCTGCTCTTCCTGCCAGG - Intergenic
927550790 2:23997475-23997497 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
927802751 2:26116580-26116602 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
927871867 2:26629048-26629070 GCCCTGCTGCTCAGCCTCCGAGG - Intronic
927890931 2:26748463-26748485 GGCGTCTTGCTCTGCTGCCCAGG - Intergenic
927977266 2:27348239-27348261 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
927984218 2:27396244-27396266 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
928056577 2:28062230-28062252 GGACTCCTGCTCTGTCACCCAGG - Intronic
928303692 2:30147858-30147880 GCCGCCGCGCTCTGCCGCCCCGG + Intronic
928414313 2:31078970-31078992 GCTCCCCTGCTCTCCCTCCCAGG - Intronic
928518644 2:32066640-32066662 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
928551540 2:32375951-32375973 GACCTCCTGATCTGCCCGCCTGG - Intronic
928936059 2:36679614-36679636 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
929120434 2:38479642-38479664 GGAATCTTGCTCTGCCGCCCAGG - Intergenic
929120441 2:38479807-38479829 GGAATCTTGCTCTGCCGCCCAGG - Intergenic
929609682 2:43261484-43261506 GGACTGCTGCTCTGTCGCCCAGG + Intronic
929848249 2:45555514-45555536 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
929860509 2:45672999-45673021 GCTCTGTTGCTCTGCTGCCCAGG - Intronic
930081425 2:47452239-47452261 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
930091946 2:47537354-47537376 GGCATCTTGCTCTGTCGCCCAGG + Intronic
930561920 2:52970105-52970127 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
930599625 2:53428100-53428122 GGGATCCTGCTCTGTCGCCCAGG - Intergenic
930730482 2:54723850-54723872 GCCCGCGCGCACTGCCGCCCTGG - Intronic
930819727 2:55633434-55633456 GGCATCTTGCTCTGTCGCCCAGG - Intergenic
931350095 2:61479888-61479910 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
931407046 2:61989202-61989224 GCCATCTTGCTCTGCCTCCCAGG + Intronic
931506429 2:62932149-62932171 GCCGTCTCGCTCTGCCACCCAGG - Intronic
931561365 2:63565007-63565029 GACCTCATGATCTGCCGCCTTGG + Intronic
931867326 2:66426525-66426547 GCGCTCCTGCTCCGGCTCCCGGG + Intergenic
932158353 2:69438293-69438315 GCACTCCTGCTCTCCAGCCTGGG - Intergenic
932239063 2:70142782-70142804 TGCCTCCTGCGCAGCCGCCCTGG - Intergenic
933321133 2:80776963-80776985 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
933726371 2:85429844-85429866 AGCCTCCTTCTCTGCTGCCCTGG + Intronic
933744874 2:85563154-85563176 GGCGTCTTGCTCTGTCGCCCAGG - Intronic
933795114 2:85913436-85913458 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
934521408 2:95022431-95022453 CCCCTCCTGCGCTGACGCCATGG + Intergenic
934665531 2:96167085-96167107 GACCTCATGATCTGCCGCCTTGG - Intergenic
934690064 2:96351640-96351662 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
934783412 2:96987151-96987173 GGCGTCTTGCTCTGCTGCCCAGG - Intronic
934901595 2:98164016-98164038 GCTCTCCTGCTCCTCCTCCCTGG - Intronic
934931341 2:98427350-98427372 GGTCTCTTGCTCTGTCGCCCAGG - Intergenic
935262749 2:101369281-101369303 GCTCACCTGCTCTACCTCCCAGG - Intronic
935276472 2:101480002-101480024 GCCCTCCAGCTCTTCCGACTCGG - Intergenic
935513140 2:104001143-104001165 GGCGTCTCGCTCTGCCGCCCAGG - Intergenic
935571884 2:104670609-104670631 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
936110310 2:109659495-109659517 GACCACCTGCACTGCAGCCCTGG - Intergenic
936374319 2:111927641-111927663 GCCTTCTTGCTCTGTCACCCAGG - Intronic
936450862 2:112633076-112633098 ACACTCTTGCTCTGTCGCCCAGG - Intergenic
936511485 2:113150987-113151009 GCCATCCTCCTCTGCCTCCCAGG + Intergenic
936645065 2:114359205-114359227 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
937087939 2:119184132-119184154 ACCCTTCTGCTCTGCCCCCTCGG + Intergenic
937206923 2:120242710-120242732 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
937788343 2:125928807-125928829 GCCGTCCTGCTCAGCAGCCCAGG - Intergenic
937903824 2:127042021-127042043 GCCCACCTGCTCTCAGGCCCTGG - Intergenic
937990365 2:127658876-127658898 CTCCGCCTGCTCTGCCTCCCAGG + Intronic
938075203 2:128328666-128328688 GCAGTCTTGCTCTGTCGCCCTGG + Intergenic
938538305 2:132264035-132264057 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
939593844 2:144100893-144100915 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
941325740 2:164111622-164111644 CACCTCCTGCTGTGCGGCCCAGG + Intergenic
942155252 2:173121411-173121433 GGACTCTTGCTCTGTCGCCCAGG + Intronic
942494567 2:176526310-176526332 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
942565283 2:177259904-177259926 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
942738556 2:179146018-179146040 CACCTCCTGCTCTGTGGCCCAGG - Intronic
943683957 2:190796878-190796900 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
944224590 2:197337401-197337423 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
944293182 2:198031340-198031362 GGCCTCTTGCTCTGTTGCCCAGG - Intronic
944612252 2:201423098-201423120 GCTCTGCTGCTCTGTCACCCAGG + Intronic
944703053 2:202262582-202262604 GCAGTCTTGCTCTGCTGCCCAGG - Intergenic
944721169 2:202424346-202424368 GAAGTCCTGCTCTGTCGCCCAGG - Intronic
944739268 2:202595721-202595743 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
944835316 2:203573354-203573376 GGACTCTTGCTCTGCTGCCCAGG - Intergenic
945107876 2:206333543-206333565 GCAGTCTTGCTCTGCTGCCCAGG + Intergenic
945403977 2:209423718-209423740 GCCCGCCTGTCCCGCCGCCCGGG + Intergenic
946026569 2:216675272-216675294 TCCCTCCTGCTCTGCCAGCATGG + Exonic
946256416 2:218445373-218445395 GTCCTCCTGCTCTGTCACCCAGG - Intronic
946356425 2:219188401-219188423 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
946683289 2:222240174-222240196 GCCCTCCTGTACTGCCCCCGTGG - Intronic
946877880 2:224148128-224148150 GCCCTCGTGATCTGCCCACCTGG - Intergenic
947481170 2:230501215-230501237 GCCCTCTTGCTCTGTTGCTCAGG - Intronic
947546041 2:231011152-231011174 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
947626766 2:231624158-231624180 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
947699241 2:232218566-232218588 CCCCTCCAGCTCTCCCTCCCAGG - Intronic
947837736 2:233187814-233187836 GTCCTCCTGCTCCTCCTCCCTGG + Intronic
948033312 2:234837297-234837319 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948118766 2:235513493-235513515 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
948151930 2:235751383-235751405 GTCCCCCTGCTCTGGTGCCCAGG + Intronic
948337324 2:237219825-237219847 GGAGTCTTGCTCTGCCGCCCGGG - Intergenic
948840326 2:240645519-240645541 GCCCGCCCACTCTGCCACCCAGG - Intergenic
948877528 2:240837595-240837617 CTCCTCCTGCTCTCCAGCCCTGG - Intergenic
948915233 2:241031188-241031210 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
948916014 2:241035427-241035449 GCCCTGCTGCTGTGCGGCCTTGG + Intronic
949081511 2:242104259-242104281 CACCTCCTGCTCTGTGGCCCAGG - Intergenic
949083847 2:242130273-242130295 GGGGTCCTGCTCTGTCGCCCAGG - Intergenic
1169117324 20:3073999-3074021 GCTCTCTGGCTCTGTCGCCCAGG + Intergenic
1169132324 20:3172768-3172790 CCCCTCCTGCTCTCCCTGCCCGG - Intronic
1169167639 20:3438056-3438078 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1169365365 20:4987818-4987840 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1169370080 20:5022058-5022080 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1169426819 20:5503489-5503511 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1169546855 20:6659248-6659270 GTCTTGCTGCTCTGTCGCCCAGG - Intergenic
1169726135 20:8734100-8734122 GCTCTCTCGCTCTGTCGCCCAGG - Intronic
1170150915 20:13224869-13224891 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1170695053 20:18650455-18650477 GCCCTCCTGCTCTGTACTCCTGG + Intronic
1170792267 20:19517853-19517875 GCCCTGCTGCTCTGCCCACCTGG - Intronic
1170821548 20:19758891-19758913 ACCCTCCTGCTTTTCCACCCGGG - Intergenic
1170923517 20:20701702-20701724 GAAGTCCTGCTCTGTCGCCCAGG - Intronic
1171464279 20:25316899-25316921 GTCCTCCTCCTCTGTTGCCCAGG - Intronic
1171483766 20:25472553-25472575 TCCCTTTTGCTCTGCCGCCCAGG + Intronic
1172248995 20:33465767-33465789 GCCCACCTGCTCTGCCTCCTGGG + Intergenic
1172383446 20:34515918-34515940 GGTCTCTTGCTCTGTCGCCCAGG + Intergenic
1172403715 20:34672012-34672034 ACCCTCCACCTCTGCCTCCCGGG + Intronic
1172471600 20:35201660-35201682 GGAATCTTGCTCTGCCGCCCAGG - Intergenic
1172499152 20:35412585-35412607 CCAGTCCTGCTCTGTCGCCCAGG - Intergenic
1172543635 20:35742141-35742163 GCCGTCCTGCTCTCCCGCGTGGG - Intronic
1172790453 20:37501600-37501622 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1173383208 20:42565058-42565080 GCCCTGGTGTTCTGGCGCCCCGG + Intronic
1173484148 20:43428095-43428117 GGACTCGTGCTCTGTCGCCCAGG - Intergenic
1173649339 20:44653016-44653038 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1173805628 20:45923046-45923068 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1174236758 20:49100244-49100266 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1174258796 20:49278262-49278284 GCCCGCCGGCTCCGCCGCCGGGG - Intronic
1174775501 20:53339742-53339764 CCCCTCCTGCACTGGAGCCCAGG + Intronic
1174799129 20:53548240-53548262 GACCTCGTGATCTGCCGCCTCGG - Intergenic
1174821904 20:53733684-53733706 GACCTCGTGATCTGCCGCCTCGG - Intergenic
1175166890 20:57050389-57050411 GCCATCCTGCTCTGTCCCACCGG + Intergenic
1175264799 20:57696094-57696116 TCCCTCCTGCTCTGAGCCCCAGG + Intronic
1175331174 20:58165517-58165539 GCCCTGGTGCTCTGCCTACCTGG - Intergenic
1175466251 20:59192637-59192659 GCCCGCCTGGGCTGCCGCTCGGG + Exonic
1175734118 20:61373326-61373348 GCCCTCCTGCTCGGGATCCCTGG - Intronic
1175756143 20:61531445-61531467 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1175857473 20:62130099-62130121 AGCCTCCTGCGGTGCCGCCCTGG + Intronic
1175906994 20:62385838-62385860 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1176052122 20:63125378-63125400 GCCCTTCTGCTCTGCTGGACAGG + Intergenic
1176151561 20:63593992-63594014 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1176153445 20:63605495-63605517 GGCATCTTGCTCTGTCGCCCAGG - Intronic
1177034711 21:16027301-16027323 GGCGTCTCGCTCTGCCGCCCAGG - Intergenic
1177326675 21:19599859-19599881 GGCCTCTTGCTCTGTTGCCCAGG + Intergenic
1177369902 21:20188760-20188782 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
1177400347 21:20595332-20595354 GCACTCTTACTCTGTCGCCCAGG + Intergenic
1177828545 21:26110418-26110440 GACATCTTGCTCTGTCGCCCAGG - Intronic
1177883934 21:26725748-26725770 GGAGTCTTGCTCTGCCGCCCTGG - Intergenic
1178249525 21:30989076-30989098 GCACTCCTGTTCTGGGGCCCAGG - Intergenic
1178259568 21:31086274-31086296 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1178322611 21:31616884-31616906 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1178876158 21:36415776-36415798 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1178878660 21:36431630-36431652 GGCATCTTGCTCTGTCGCCCAGG + Intergenic
1178881154 21:36451119-36451141 GACCTCGTGATCTGCCGCCTTGG + Intergenic
1179539002 21:42072020-42072042 GGGCTTTTGCTCTGCCGCCCAGG - Intronic
1179631384 21:42680584-42680606 GCCCTCCTGCACTGCCTGACAGG + Intronic
1179925498 21:44531893-44531915 GCACCCCTGCTCTTCCGCCCAGG - Intronic
1180096231 21:45556319-45556341 GCCCCGCTGCCCTGCCGCCAGGG - Intergenic
1180190631 21:46160972-46160994 GCCCACCCGCTTTCCCGCCCGGG - Intergenic
1180253346 21:46605073-46605095 GCCCACCAGTCCTGCCGCCCAGG - Exonic
1180882092 22:19211739-19211761 GCAATCTTGCTCTGTCGCCCAGG - Intronic
1180931426 22:19594774-19594796 GGGCTCCTGCTATGCTGCCCAGG - Intergenic
1181061484 22:20284105-20284127 GCCCTTCTCCTCTGCCTCCTAGG + Intergenic
1181324041 22:22031194-22031216 GCCCTCTGCCTCTGCCTCCCTGG + Intergenic
1181390666 22:22578708-22578730 GCTCTCTTGCTCTGTCACCCAGG + Intergenic
1181482341 22:23208228-23208250 GCTCTCCTGCACTGCCAGCCGGG - Intronic
1181495882 22:23287299-23287321 CCCCTCCTGCTCTCCTGGCCTGG + Intronic
1181749649 22:24980295-24980317 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1181816046 22:25437604-25437626 GCCCTCCCTCTCTGCAACCCCGG - Intergenic
1181869870 22:25889477-25889499 TCCCTCCTGCTCTGGAGCCTTGG - Intronic
1181978552 22:26750225-26750247 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1182185330 22:28395587-28395609 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1182335279 22:29580027-29580049 TCCCTCCTGCCCTGCAGCCCAGG - Intronic
1182932538 22:34188897-34188919 GCCCTCCTGCTCTTCTGCCATGG - Intergenic
1183036589 22:35145253-35145275 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1183436951 22:37801929-37801951 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
1183446243 22:37857342-37857364 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1183704801 22:39469842-39469864 GCCGCCCTGCCCTGCAGCCCCGG - Intronic
1184168782 22:42746302-42746324 GGCGTCTTGCTCTGCTGCCCAGG - Intergenic
1184218699 22:43084991-43085013 GGCATCTTGCTCTGTCGCCCAGG + Intronic
1184278625 22:43425034-43425056 GCCCTCCTCCCCTGCGGCCTGGG + Exonic
1184371092 22:44082491-44082513 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1184471069 22:44696760-44696782 GCAGTCCTGCTCTGTCGCCCAGG + Intronic
1184557805 22:45242450-45242472 TCCTTCCTGCTGTGCCTCCCAGG - Intergenic
1184647084 22:45902133-45902155 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1185000669 22:48243556-48243578 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1185001224 22:48247358-48247380 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1185272692 22:49936086-49936108 GCGCTCCTCCCCCGCCGCCCCGG + Intergenic
1185348817 22:50323313-50323335 GCACTCCAGCTCTGTCACCCAGG + Intronic
949616625 3:5760724-5760746 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
950001933 3:9663537-9663559 GACATCTTGCTCTGCTGCCCAGG + Intronic
950068651 3:10134548-10134570 GTGCTCCTGCTCTGTCACCCAGG - Intergenic
950070187 3:10145678-10145700 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
950172990 3:10852258-10852280 GCTCTCCTGTTTGGCCGCCCAGG - Intronic
950233120 3:11293990-11294012 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
950514077 3:13452691-13452713 GCGGTCTTGCTCTGTCGCCCAGG + Intergenic
950741817 3:15058213-15058235 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
950885274 3:16357087-16357109 GGCATCTTGCTCTGTCGCCCAGG - Intronic
951240501 3:20281080-20281102 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
951718558 3:25674259-25674281 GCCCTCCTTTTATGCCCCCCAGG - Intergenic
951879481 3:27465926-27465948 GGACTCTTGCTCTGTCGCCCAGG - Intronic
951895725 3:27608140-27608162 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
952149843 3:30577579-30577601 GCCCTCCTCCTCTTTCACCCAGG + Intergenic
952159392 3:30678520-30678542 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
952165660 3:30746012-30746034 GCACTCCAGCTCTGTTGCCCAGG + Intronic
952373862 3:32748854-32748876 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
952625419 3:35397046-35397068 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
953306313 3:41833319-41833341 GCCATCTTGCTCTGTCGCCCAGG + Intronic
953418377 3:42735913-42735935 GCCCTCCTGCCTGGCCCCCCAGG - Exonic
953615011 3:44482115-44482137 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
953768892 3:45763869-45763891 GCCCTCCTGCTATCCCGACGGGG + Intronic
953907810 3:46877067-46877089 GCCCTCCCTATCTGCCTCCCAGG - Intronic
953941372 3:47100982-47101004 GGACTCTTGCTCTGTCGCCCAGG - Intronic
954021511 3:47746401-47746423 GCCCTACTGCACTCCAGCCCTGG + Intronic
954208937 3:49082867-49082889 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
954250710 3:49365166-49365188 GGACTCTTGCTCTGTCGCCCAGG + Intronic
954383867 3:50234290-50234312 GACCTCGTGATCTGCCGCCTCGG + Intronic
954423714 3:50432326-50432348 GCACCCCTGCTGTGCCGGCCTGG + Intronic
954444008 3:50536875-50536897 GCACTCCTCTTCTGCTGCCCTGG - Intergenic
954752398 3:52821077-52821099 CGCCTCCTGCTCTGCCACACTGG + Exonic
954791845 3:53139203-53139225 CCTCCCCTGCTCTGCCTCCCAGG + Intergenic
954862703 3:53703859-53703881 GCCCTGCAGCTCTGCTCCCCAGG - Intronic
955194534 3:56793044-56793066 GCACTACTGCACTGCCGCCTGGG - Intronic
956411890 3:68987938-68987960 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
956439202 3:69263434-69263456 GCTCTCTTGCTCTGTCACCCAGG + Intronic
956761728 3:72449583-72449605 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
957059037 3:75466586-75466608 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
957150155 3:76476125-76476147 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
957151541 3:76492089-76492111 GGCGTCTTGCTCTGTCGCCCAGG - Intronic
957630932 3:82715427-82715449 GCCGGCCCGCCCTGCCGCCCGGG + Intergenic
958562658 3:95766946-95766968 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
958779586 3:98524349-98524371 GACCTCGTGATCTGCCGCCTCGG - Intronic
959787728 3:110320730-110320752 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
960093601 3:113666595-113666617 AGACTCCTGCTCTGTCGCCCGGG + Intronic
960537871 3:118833141-118833163 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
960619445 3:119624654-119624676 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
961006419 3:123408628-123408650 GCAATCTTGCTCTGTCGCCCAGG - Intronic
961025895 3:123557103-123557125 GCTCTCCTGCTGCGCAGCCCAGG - Intronic
961029371 3:123588506-123588528 GACCTCCTGATCTGCCTGCCTGG - Intergenic
961056959 3:123797536-123797558 GCCCTCCTCCTCTGCCACAGAGG + Intronic
961294410 3:125873145-125873167 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
961318016 3:126053845-126053867 TCCTTCCTGCTCTGCCAGCCAGG + Intronic
961371673 3:126435322-126435344 GCCCTGCTGCTCCGAGGCCCTGG - Intronic
961394583 3:126578219-126578241 GCCCCCCTGCTCCACAGCCCCGG - Intronic
961404769 3:126670404-126670426 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
961757626 3:129138958-129138980 GGAGTCCTGCTCTGCTGCCCAGG + Intronic
961769307 3:129237034-129237056 GACCTCGTGATCTGCCGCCTTGG + Intergenic
962182677 3:133225068-133225090 GGAGTCCTGCTCTGCCGCCTAGG + Intronic
962755931 3:138465413-138465435 GCCCTCCTCCTCACCTGCCCAGG - Exonic
962795343 3:138845077-138845099 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
963138881 3:141931597-141931619 GACCTCCTGATCTGCCCACCTGG - Intergenic
963872902 3:150437780-150437802 GGAGTCCCGCTCTGCCGCCCAGG - Intronic
964051203 3:152395923-152395945 CACCTCCTGCTGTGCAGCCCAGG - Intronic
964589048 3:158340513-158340535 GGACTCTTGCTCTGTCGCCCAGG - Intronic
964610321 3:158607203-158607225 GGACTCCTGCTCTGTTGCCCAGG - Intronic
965588825 3:170343321-170343343 GACCTCGTGATCTGCCGCCTCGG + Intergenic
965723373 3:171686079-171686101 GCCCTACTGCACTGCAGCCTGGG + Intronic
966201081 3:177359913-177359935 GAGCTCCGGCTCTGCCGCCGCGG - Intergenic
966376678 3:179303143-179303165 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
966688690 3:182722896-182722918 GCCATCATGCTCAGCAGCCCTGG - Intergenic
966787076 3:183631485-183631507 TCGCTCTTGCTCTGTCGCCCAGG - Intergenic
966852769 3:184174926-184174948 GGCCCCCTGCTCTGCCGGCCCGG - Exonic
966874516 3:184314753-184314775 GCCACCCTGCGCCGCCGCCCCGG + Intronic
966919320 3:184601908-184601930 GACCTCCCAGTCTGCCGCCCGGG + Intronic
967043254 3:185713724-185713746 GGACTCCTGCTCTGTTGCCCAGG + Intronic
967047108 3:185747651-185747673 GGACTCTTGCTCTGTCGCCCAGG - Intronic
967329038 3:188272034-188272056 CCCCTCCTTCTCTTCCTCCCAGG - Intronic
967619808 3:191618918-191618940 GGAGTCTTGCTCTGCCGCCCGGG - Intergenic
967621264 3:191637027-191637049 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
967686851 3:192427351-192427373 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
967738536 3:192980160-192980182 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
967755786 3:193167012-193167034 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
968081015 3:195847174-195847196 GCCCTCTTCCTCCCCCGCCCTGG + Intergenic
968084775 3:195869397-195869419 CCCCTCCGGCCCAGCCGCCCAGG + Intronic
968120911 3:196125357-196125379 GGACTCCTGCTCTGTCACCCAGG + Intergenic
968191146 3:196668250-196668272 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
968413949 4:412765-412787 GGACTCCTGCTCTGTCGTCCAGG + Intergenic
968464505 4:743786-743808 GCCCTCCTGCTCTCCCCTGCTGG - Intronic
968491106 4:890990-891012 GCCCTCCAGCACTGCAGCCTGGG - Intronic
968583394 4:1405104-1405126 GCCCTCCATCTCGGCCGACCCGG + Intronic
968697371 4:2039386-2039408 GCAATCTTGCTCTGTCGCCCAGG - Intronic
968925903 4:3548006-3548028 GCCCTACTGCGCTGCAGCCTGGG - Intergenic
969002950 4:3996778-3996800 GCAATCTTGCTCTGTCGCCCAGG - Intergenic
969111233 4:4845665-4845687 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
969171799 4:5369899-5369921 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
969400359 4:6951264-6951286 GCAGTCTTGCTCTGCCGCCCAGG - Intronic
969698117 4:8747484-8747506 GCCCTGCGGCTCTGCCTCCACGG + Intergenic
970571176 4:17384361-17384383 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
971238240 4:24863264-24863286 GACGTCTTGCTCTGTCGCCCAGG - Intronic
971314242 4:25553986-25554008 GGCATCTTGCTCTGTCGCCCAGG + Intergenic
971372405 4:26029261-26029283 GCTCTGCTGCTCTGCCTCCCTGG - Intergenic
971922276 4:32956708-32956730 GCCTTCTAGCTCTGCTGCCCAGG - Intergenic
972348985 4:38218459-38218481 GCCGTCTTGCTCTGTTGCCCAGG + Intergenic
972608434 4:40635055-40635077 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
972810243 4:42576448-42576470 GGCGTCTTGCTCTGTCGCCCAGG - Intronic
973091931 4:46147729-46147751 GCCCTCCCTCTCTGCCTCCAAGG + Intergenic
973242620 4:47973091-47973113 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
973777425 4:54256259-54256281 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
974037712 4:56831455-56831477 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
975055389 4:69923989-69924011 GCCAGCCTGCCCTGCCGGCCTGG + Intergenic
976212234 4:82682839-82682861 GGACTCTTGCTCTGTCGCCCAGG + Intronic
976765412 4:88592902-88592924 GCCCTCCCGCCCTGCCGCCCGGG + Intronic
977039195 4:91993703-91993725 GTCTTCTTGCTCTGTCGCCCAGG - Intergenic
977167685 4:93721942-93721964 GGAATCTTGCTCTGCCGCCCAGG + Intronic
977408540 4:96632137-96632159 GACCTCCTGCTGTGCAGCCTGGG - Intergenic
977901427 4:102426646-102426668 GCTCTGCTGCTCTGTCACCCAGG + Intronic
977931485 4:102754786-102754808 GACCTCGTGATCTGCCGCCTTGG + Intronic
978080235 4:104582080-104582102 GCCGGCCGGCCCTGCCGCCCCGG + Intergenic
978290729 4:107136724-107136746 GCTCTCCTGCTCTCCAGCCTGGG - Intronic
979489725 4:121311530-121311552 GCCCTACTGCACTCCGGCCCAGG + Intergenic
980061683 4:128137201-128137223 GGACTCTTGCTCTGTCGCCCAGG - Intronic
980408475 4:132383413-132383435 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
980913716 4:139015812-139015834 CCTCTCCGGCTCTGCTGCCCGGG + Exonic
980959399 4:139459862-139459884 GACCTCGTGATCTGCCGCCTCGG + Intronic
980983200 4:139671489-139671511 GACCTACTGCTCTGTCGCCCGGG + Intronic
981089601 4:140719087-140719109 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
981323213 4:143416746-143416768 GGCATCTTGCTCTGTCGCCCAGG - Intronic
982059098 4:151585200-151585222 GCACTCCAGCTCTGTCGGCCAGG + Intronic
982073476 4:151716306-151716328 GTCATCTTGCTCTGCTGCCCAGG + Intronic
982566550 4:156993903-156993925 GACGTCTTGCTCTGCCACCCAGG - Intergenic
983106019 4:163687251-163687273 GCCGTCTTGCTCTGTCACCCAGG + Intronic
983562927 4:169119127-169119149 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
983943754 4:173563882-173563904 GCTGTCTTGCTCTGTCGCCCAGG - Intergenic
984174065 4:176394868-176394890 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
984987194 4:185342914-185342936 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
985240538 4:187927034-187927056 GGAGTCTTGCTCTGCCGCCCTGG + Intergenic
985274929 4:188229135-188229157 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
986884493 5:12216567-12216589 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
987089758 5:14500343-14500365 GCCCTCATTCTCTCCAGCCCTGG + Intronic
987354622 5:17052455-17052477 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
987371168 5:17194391-17194413 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
987970763 5:24940755-24940777 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
988073488 5:26324558-26324580 GCCGGCCGGCTCTGCCGGCCCGG + Intergenic
988895979 5:35675564-35675586 TCGCTCTTGCTCTGTCGCCCAGG + Intronic
989138350 5:38177426-38177448 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
989219253 5:38937058-38937080 GGACTCTTGCTCTGTCGCCCAGG + Intronic
989543702 5:42647546-42647568 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
990247599 5:53878893-53878915 GACCTCGTGATCTGCCGCCTCGG - Intergenic
990450000 5:55925032-55925054 GCCTTCATGCTGTGCAGCCCAGG - Intergenic
991045088 5:62213914-62213936 GCAGTCTTGCTCTGCTGCCCAGG - Intergenic
991327335 5:65449593-65449615 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
991424223 5:66474020-66474042 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
991479547 5:67062370-67062392 ACCATCTTGCTCTGTCGCCCAGG - Intronic
991699892 5:69307654-69307676 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
991761303 5:69919171-69919193 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
991772480 5:70052694-70052716 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
991786026 5:70198929-70198951 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
991840531 5:70794222-70794244 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
991851773 5:70928113-70928135 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
991878470 5:71199317-71199339 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
992074467 5:73177896-73177918 TCCCTTCTGCTCTGCAGGCCAGG + Intergenic
992213451 5:74503676-74503698 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
992680754 5:79150654-79150676 GGCATCTTGCTCTGTCGCCCAGG + Intronic
992826637 5:80555688-80555710 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
992955593 5:81905031-81905053 TCTTTCCTGCTCTGTCGCCCAGG - Intergenic
993079571 5:83278973-83278995 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
993647670 5:90479445-90479467 GGACTCTTGCTCTGTCGCCCAGG - Intronic
993822019 5:92631431-92631453 GCCGGCCGGCCCTGCCGCCCCGG + Intergenic
994614267 5:102083783-102083805 GGCTTCTTGCTCTGTCGCCCAGG + Intergenic
995032308 5:107494343-107494365 GCCGGCCGGCCCTGCCGCCCGGG + Intronic
995111586 5:108435068-108435090 GCACTCCTGCTCTTCAGCCTGGG - Intergenic
995511124 5:112910274-112910296 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
995700204 5:114927315-114927337 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
995767395 5:115633832-115633854 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
996055631 5:118979276-118979298 GGACTCTTGCTCTGTCGCCCAGG - Intronic
996584276 5:125067175-125067197 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
996614346 5:125422499-125422521 CACCTCCTGCTGTGCGGCCCCGG - Intergenic
996706147 5:126500641-126500663 GTCTTCTTGCTCTGCTGCCCAGG - Intergenic
996707083 5:126508332-126508354 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
996733585 5:126738644-126738666 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
996756216 5:126938191-126938213 ACAGTCTTGCTCTGCCGCCCAGG + Intronic
997054821 5:130429343-130429365 GACCTCGTGATCTGCCGCCTTGG - Intergenic
997321056 5:132978903-132978925 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
997361602 5:133298844-133298866 GGCCTCCTGGTCTCCAGCCCCGG - Intronic
997480400 5:134180117-134180139 GGACTCTTGCTCTGCCGCCCAGG - Intronic
997676880 5:135719797-135719819 GCCCTCCTGCAGTCCAGCCCTGG + Intergenic
997678802 5:135734789-135734811 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
997938231 5:138133336-138133358 GACCTCATGATCTGCCGCCTCGG + Intronic
998077704 5:139249783-139249805 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
998096618 5:139399289-139399311 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
998344422 5:141448917-141448939 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
998347631 5:141478147-141478169 CCCCTCTGGCTCTGCCCCCCGGG + Exonic
998395229 5:141814028-141814050 TCCCTCCTTCTCAGCTGCCCAGG - Intergenic
998491680 5:142552052-142552074 GGGCTCCTGCTCTCCAGCCCAGG - Intergenic
998504612 5:142661972-142661994 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
998535178 5:142923885-142923907 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
999244709 5:150147649-150147671 GCCCTCCTGCTCTGCCGCCCAGG - Intronic
999462232 5:151767663-151767685 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1001552375 5:172612258-172612280 GCCCTCCTTCTCAGCCACTCTGG + Intergenic
1001656332 5:173353725-173353747 ACATTCTTGCTCTGCCGCCCAGG + Intergenic
1001817762 5:174684538-174684560 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1002017089 5:176333276-176333298 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1002141916 5:177147129-177147151 AGCGTCTTGCTCTGCCGCCCAGG + Intronic
1002371817 5:178760891-178760913 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1002372132 5:178763323-178763345 GTCTTGCTGCTCTGCCGCCCAGG + Intergenic
1002486734 5:179543585-179543607 GACCTCATGATCTGCCGCCTCGG + Intergenic
1002545816 5:179944487-179944509 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1002845478 6:940842-940864 GCCCAGCTGCTCTACCTCCCAGG + Intergenic
1003174822 6:3746660-3746682 GTGCCCCTGCTCTGCTGCCCGGG + Intronic
1003278126 6:4669723-4669745 GACCTCCTGATCCGCCGCCTCGG + Intergenic
1003448683 6:6210368-6210390 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1003906291 6:10702830-10702852 GTCTCCCTGCTCTGTCGCCCAGG + Intronic
1004106972 6:12674755-12674777 GAAGTCTTGCTCTGCCGCCCAGG - Intergenic
1004129018 6:12901518-12901540 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1004495462 6:16158842-16158864 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1004499498 6:16197390-16197412 GCCAGCCTGCTCTGCCACCCCGG - Intergenic
1004665539 6:17745569-17745591 GCCGGCCAGCTCTGCCGGCCCGG - Intergenic
1005194443 6:23266596-23266618 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1005586045 6:27277451-27277473 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1006003500 6:30984947-30984969 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1006306810 6:33226737-33226759 GGAATCCTGCTCTGTCGCCCAGG - Intergenic
1006413718 6:33891229-33891251 GCCTTCCTTCTCTGGCTCCCTGG + Intergenic
1006447210 6:34086345-34086367 GACCTCCTGCTCCGACTCCCAGG - Intronic
1006529724 6:34641051-34641073 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1006596414 6:35195768-35195790 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1006677763 6:35776593-35776615 CCGCCGCTGCTCTGCCGCCCAGG + Exonic
1007457974 6:41995281-41995303 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1007553927 6:42750599-42750621 GACGTCTTGCTCTGTCGCCCAGG + Intronic
1007555404 6:42761421-42761443 GCACTCCAGCTCTGCTGCCCAGG - Intronic
1007627310 6:43253840-43253862 CCCCTCCTGCTCTCCTTCCCAGG + Intronic
1007657677 6:43461680-43461702 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1007685895 6:43667258-43667280 GCCCTCCTCCTTTACCTCCCAGG - Intronic
1007724912 6:43909855-43909877 GTCCTTCTCCTCTGCAGCCCTGG + Intergenic
1007734284 6:43970984-43971006 AGCTTCCTGCTCTGCCCCCCAGG + Intergenic
1007759138 6:44122106-44122128 GGAGTCCTGCTCTGTCGCCCTGG + Intronic
1007793153 6:44325437-44325459 GCCCTACTGCTCTCCAGCCTGGG - Intronic
1008180990 6:48328657-48328679 GCTCTGTTGCTCTGTCGCCCAGG - Intergenic
1008294647 6:49760917-49760939 GGCCTCCTGCTCCTCCTCCCTGG + Intergenic
1008374611 6:50777707-50777729 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
1008648267 6:53538350-53538372 GCAGTCTCGCTCTGCCGCCCAGG + Intronic
1008689252 6:53959393-53959415 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1009199838 6:60730826-60730848 GACCTCATGATCTGCCGCCTCGG - Intergenic
1009565512 6:65306805-65306827 GGACTCTTGCTCTGCTGCCCAGG - Intronic
1009748174 6:67847389-67847411 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1009778961 6:68243844-68243866 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1009952066 6:70409895-70409917 GCAGTCTTGCTCTGCCGCCCAGG + Intergenic
1010130404 6:72486184-72486206 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
1010194423 6:73225055-73225077 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1010257105 6:73770899-73770921 GCCCTCATGCTCTGTCTCCATGG - Intronic
1010770478 6:79822778-79822800 GCTCTCCTGCTCTCCAGCCTGGG + Intergenic
1011061808 6:83278465-83278487 GAGCTCTTGCTCTGTCGCCCAGG + Intronic
1011756257 6:90501301-90501323 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
1012626841 6:101415394-101415416 GGCGTCTTGCTCTGTCGCCCAGG + Intronic
1012883859 6:104822355-104822377 GGAGTCCTGCTCTGCCTCCCAGG - Intronic
1013060753 6:106631198-106631220 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1013250735 6:108330404-108330426 GACCTCGTGCTCTGCCTGCCTGG + Intronic
1013329664 6:109087103-109087125 GCTGTCTTGCTCTGTCGCCCAGG - Intronic
1014266350 6:119282039-119282061 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1014435076 6:121411723-121411745 GACCTCGTGATCTGCCGCCTCGG - Intergenic
1015442897 6:133269231-133269253 GAAGTCCTGCTCTGTCGCCCAGG - Intronic
1015504141 6:133964013-133964035 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1015720940 6:136241063-136241085 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1015880181 6:137864309-137864331 GTCGTCTTGCTCTGTCGCCCAGG - Intergenic
1015979591 6:138825555-138825577 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1015981318 6:138842433-138842455 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1016065384 6:139677561-139677583 GTCCTCTCGCTCTGTCGCCCAGG + Intergenic
1016390653 6:143571430-143571452 ACCCTCCAGCTCTGTCACCCAGG + Intronic
1016430624 6:143981534-143981556 GCCTTCCTGCACTGCAGCCTGGG + Intronic
1016563558 6:145425197-145425219 GTAGTCTTGCTCTGCCGCCCAGG + Intergenic
1016808397 6:148236238-148236260 GGACTCTTGCTCTGCCACCCAGG + Intergenic
1017103258 6:150866260-150866282 GCCCACCTGCGCTGCGGGCCCGG - Intronic
1017128402 6:151087221-151087243 GGCCTCTGGCTCTGTCGCCCAGG - Intronic
1017639169 6:156473928-156473950 GACGTCTTGCTCTGTCGCCCAGG - Intergenic
1017842490 6:158232727-158232749 GCGCTCCTCCTCTTCCTCCCCGG + Intronic
1017954629 6:159168342-159168364 TCCCTCTGCCTCTGCCGCCCAGG - Intergenic
1017990641 6:159485725-159485747 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1018638613 6:165886398-165886420 GCCCTGCAGCTCTGCAGCCCTGG + Intronic
1019460148 7:1153913-1153935 GAACTCTTGCTCTGTCGCCCAGG - Intronic
1019487412 7:1295795-1295817 GGCCCCTTCCTCTGCCGCCCTGG + Intergenic
1019791602 7:3017648-3017670 AGACTCTTGCTCTGCCGCCCAGG + Intronic
1019799194 7:3075583-3075605 GCACTCCTGCTCTGCAGCCCCGG - Intergenic
1019988102 7:4672915-4672937 GCAGTCTTGCTCTGCTGCCCAGG - Intergenic
1020230821 7:6317307-6317329 ACGGTCTTGCTCTGCCGCCCAGG + Intergenic
1020249961 7:6459762-6459784 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1020265816 7:6559340-6559362 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1020346545 7:7170754-7170776 GGACTCCTGCTCTGTCACCCAGG - Intronic
1020681106 7:11237810-11237832 GGACTCCTGCTCTGTTGCCCTGG + Intergenic
1020978675 7:15040058-15040080 GTATTCCTGCTCTGTCGCCCAGG - Intergenic
1021456829 7:20838884-20838906 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1021832829 7:24634254-24634276 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1021990238 7:26134279-26134301 GCAGTCTTGCTCTGCCACCCAGG - Intergenic
1022175696 7:27869932-27869954 GCTCTGTTGCTCTGTCGCCCAGG + Intronic
1022444135 7:30455993-30456015 GCCCTCCTACTGTGTGGCCCAGG - Intronic
1022482172 7:30751560-30751582 GCCATTCTGCTCTGCCTCCTGGG + Intronic
1022539829 7:31125343-31125365 TCCCTCCTGCTGCGCAGCCCAGG + Intergenic
1022697116 7:32718038-32718060 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1022733902 7:33058370-33058392 GACATCCTGCTCTGTCACCCAGG + Intronic
1023409862 7:39879473-39879495 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1023430419 7:40085333-40085355 GCTCTCGTGCTCTGTCACCCAGG - Intronic
1023927791 7:44682662-44682684 AGACTCCTGCTCTGTCGCCCAGG - Intronic
1024652964 7:51424493-51424515 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1024761532 7:52602721-52602743 CACCTCCTGCTGTGCCGCCCAGG - Intergenic
1025038136 7:55615130-55615152 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1025043002 7:55664114-55664136 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1025135924 7:56412642-56412664 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1025191749 7:56900824-56900846 GTCTTCTTGCTCTGTCGCCCAGG - Intergenic
1025195289 7:56927780-56927802 GGGCTCTTGCTCTGCTGCCCAGG + Intergenic
1025676663 7:63649163-63649185 GGGCTCTTGCTCTGCTGCCCAGG - Intergenic
1025680199 7:63676110-63676132 GTCTTCTTGCTCTGTCGCCCAGG + Intergenic
1025978002 7:66384831-66384853 ACGGTCCTGCTCTGTCGCCCAGG + Intronic
1026198030 7:68189777-68189799 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1026216782 7:68356603-68356625 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1026662774 7:72316917-72316939 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1026770213 7:73191920-73191942 GGACTCTTGCTCTGTCGCCCAGG + Intergenic
1027011080 7:74745307-74745329 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1027076961 7:75200733-75200755 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1027661989 7:80998405-80998427 GACCTCTCGCTCTGTCGCCCAGG + Intergenic
1027808797 7:82865460-82865482 GGCATCTTGCTCTGTCGCCCAGG - Intronic
1027997916 7:85449646-85449668 GGCCTCTTGCTCTGTAGCCCAGG - Intergenic
1028224001 7:88228272-88228294 GGAGTCTTGCTCTGCCGCCCGGG - Intergenic
1028938161 7:96488944-96488966 GCCCTCCTTCTCTGCCTGCTGGG + Intronic
1029096628 7:98090072-98090094 GTCTTCTTGCTCTGTCGCCCAGG - Intergenic
1029114943 7:98231999-98232021 GCCCTCCTCCCCTGGCACCCCGG - Intronic
1029122893 7:98280584-98280606 GCTCTCTTGCTCTGTCACCCAGG - Intronic
1029889030 7:103906779-103906801 GCCCTCCTTTTCTGCCACTCAGG - Intronic
1030032462 7:105382140-105382162 GGCATCTTGCTCTGTCGCCCAGG - Intronic
1030070347 7:105692761-105692783 GACCTTTTGCTCTGCCACCCAGG + Intronic
1030092871 7:105873126-105873148 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1030112515 7:106038790-106038812 GTCCTCCACCTCTGCCCCCCTGG - Intergenic
1030210761 7:106993572-106993594 GACCTCATGATCTGCCGCCTTGG + Intergenic
1030460786 7:109833207-109833229 GCCCTCCTGCACTCCAGCCTGGG + Intergenic
1030855932 7:114557833-114557855 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1030884647 7:114922573-114922595 CTCCTCCTCCTCTTCCGCCCCGG - Exonic
1031492911 7:122411244-122411266 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1031730788 7:125298297-125298319 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1032118854 7:129141924-129141946 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1032248948 7:130236496-130236518 ACCGTCTTGCTCTGTCGCCCAGG + Intergenic
1032307358 7:130748117-130748139 GGAGTCTTGCTCTGCCGCCCAGG - Intergenic
1032713507 7:134484045-134484067 AGCATCCTGCTCTGCTGCCCAGG + Intergenic
1032900704 7:136303714-136303736 GACCTCATGATCTGCCGCCTCGG - Intergenic
1032932616 7:136690677-136690699 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1033036930 7:137884029-137884051 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1033050661 7:138001574-138001596 GCCCTCCTGCCCCGCCCGCCGGG + Intronic
1033060161 7:138098582-138098604 GGCATCTTGCTCTGTCGCCCAGG - Intronic
1033094565 7:138419171-138419193 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1033301378 7:140189072-140189094 GCAGTCTTGCTCTGCCGCCCAGG - Intergenic
1033316800 7:140304160-140304182 GCACTCTTGCTCTGTCGCCCAGG - Intronic
1033503542 7:141977502-141977524 GCCCCCCTGCACTGCAGCCTGGG + Intronic
1033839940 7:145360898-145360920 GCCAGCCAGCCCTGCCGCCCCGG - Intergenic
1033905231 7:146193575-146193597 GCCCTTCTGCTCTGCAGCCTAGG - Intronic
1034156723 7:148961645-148961667 GGCCAGCTGCTCTGCCTCCCGGG - Intergenic
1034441026 7:151086265-151086287 GCGCTCCAGCCCTGGCGCCCCGG - Intronic
1034458469 7:151184994-151185016 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1034887583 7:154809893-154809915 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1035020549 7:155797664-155797686 GCTCTCCTCCTCTCCAGCCCTGG - Intergenic
1035021638 7:155804146-155804168 ACCCTCCTTCCCTCCCGCCCCGG + Intronic
1035076175 7:156179060-156179082 CCCCGCCTGCCCTGCTGCCCCGG - Intergenic
1035123062 7:156585199-156585221 GGGCTCCTGCCCTGCAGCCCCGG - Intergenic
1035152609 7:156887230-156887252 GACCTCGTGATCTGCCGCCTCGG - Intronic
1035277581 7:157757347-157757369 GCTCTCCCGCTCTGCCTTCCAGG - Intronic
1035468565 7:159095666-159095688 GCCCTGCTGTTCTGCCCCCTTGG + Intronic
1035539422 8:421057-421079 CACCTCCTGCTCTGTGGCCCAGG - Intronic
1035604493 8:920727-920749 GCAGTCCCGCTCTGTCGCCCAGG - Intergenic
1035735530 8:1884368-1884390 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1035752034 8:2002845-2002867 GCCCTTCCGCTGCGCCGCCCTGG + Exonic
1036200894 8:6771002-6771024 GGCATCTTGCTCTGTCGCCCAGG - Intergenic
1036814609 8:11892221-11892243 GAACTCTTGCTCTGTCGCCCAGG + Intergenic
1036937455 8:13017095-13017117 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1037529184 8:19757245-19757267 TCCCTCCTGCGCGGCCGCCGCGG + Intronic
1037835614 8:22213260-22213282 GCCCACCTGCTCTACTGCTCAGG + Intergenic
1037945981 8:22989888-22989910 GCCTGCCTGCTTTGCAGCCCTGG + Intronic
1038023458 8:23569235-23569257 GCAGTCTTGCTCTGTCGCCCTGG - Intronic
1038598931 8:28918227-28918249 GGACTCTTGCTCTGTCGCCCTGG + Intronic
1038602289 8:28957646-28957668 AGCGTCTTGCTCTGCCGCCCAGG + Intronic
1039316321 8:36376674-36376696 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1039557184 8:38484861-38484883 GCCTTCCTGCTCTTCCTTCCTGG - Intergenic
1039954770 8:42198459-42198481 GAAGTCCTGCTCTGTCGCCCAGG - Intronic
1039975812 8:42363967-42363989 GCCCTCCTGCACTCCAGCCCGGG - Intronic
1039994808 8:42522653-42522675 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1041177281 8:55209714-55209736 GCTCATCTGCTCTGCCGGCCAGG + Intronic
1041831023 8:62153226-62153248 GGCATCTTGCTCTGTCGCCCAGG - Intergenic
1041955144 8:63550964-63550986 GACCTCATGATCTGCCGCCTCGG - Intergenic
1042089821 8:65146510-65146532 GCCCACCTCCTCTGCCTCCAGGG + Intergenic
1042134906 8:65623580-65623602 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1042555961 8:70034074-70034096 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1042582222 8:70292381-70292403 GACCTCGTGATCTGCCGCCTGGG + Intronic
1042924642 8:73954624-73954646 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1042929002 8:73995150-73995172 GCCCTTCTGCTCTTCCACCATGG + Intronic
1043199347 8:77345308-77345330 GACCTCGTGATCTGCCTCCCTGG - Intergenic
1043519412 8:81027877-81027899 GGAGTCCTGCTCTGTCGCCCAGG - Intronic
1044638276 8:94350565-94350587 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1044850027 8:96418977-96418999 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1044887784 8:96798023-96798045 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1044992561 8:97808933-97808955 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1044995667 8:97835856-97835878 CACCTCCTGCTGTGCAGCCCGGG - Intronic
1045226187 8:100248270-100248292 GCAGTCCTGCTCTGTCACCCAGG + Intronic
1045467778 8:102485774-102485796 GCTGGCCTGCCCTGCCGCCCCGG - Intergenic
1046451545 8:114398254-114398276 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1046648674 8:116813140-116813162 GCGGTCTTGCTCTGTCGCCCAGG - Intronic
1047410780 8:124622765-124622787 GACTCCCTGCTCTGCCGCCCAGG - Intronic
1047707330 8:127512761-127512783 CCCCTCCGGCTCTGCTGCCTCGG - Intergenic
1047833596 8:128662755-128662777 GGAGTCCTGCTCTGCCGCCCAGG - Intergenic
1048251826 8:132872450-132872472 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1048833454 8:138497353-138497375 CCCCGCCCGCTCGGCCGCCCGGG + Intergenic
1049007758 8:139866444-139866466 TCACTCCTGCTCTGGCACCCAGG - Intronic
1049115062 8:140679048-140679070 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1049196824 8:141320410-141320432 CCTCACCTGCTCTGCTGCCCTGG - Intergenic
1049202984 8:141350879-141350901 GCCCACCTCCTCTGCTGCCCCGG - Intergenic
1049266669 8:141671338-141671360 ACCCTCCTGCTCTCCCTGCCAGG + Intergenic
1049655855 8:143796968-143796990 ACCCTCCAGCTCTGGCCCCCAGG + Intronic
1049675914 8:143888945-143888967 GCCCTCCGCCTCTCCCTCCCCGG - Intergenic
1049933965 9:482902-482924 GCCATCCTGCTCTGCCTGCCGGG + Intronic
1049982990 9:921904-921926 GCCCTCCAGCTCTGTAGCACAGG + Intronic
1050941289 9:11461725-11461747 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1051212855 9:14763467-14763489 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1051421812 9:16896551-16896573 GCACTCTTGCTCTGGTGCCCAGG + Intergenic
1051921642 9:22274040-22274062 ACCATCTTGCTCTGCCTCCCAGG - Intergenic
1052114566 9:24634746-24634768 GTCCTCATGCTCTCCCTCCCCGG + Intergenic
1053237504 9:36469084-36469106 GGACTCTTGCTCTGTCGCCCAGG - Intronic
1053294049 9:36900659-36900681 GTCCTCCTCCTCAGCCACCCTGG + Intronic
1053467056 9:38316384-38316406 GGCCACCTGCTCTGCCTCCCAGG - Intergenic
1053487601 9:38471626-38471648 GGCCTCCTGCTCTGCCGTCACGG + Intergenic
1053491964 9:38514082-38514104 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1053800785 9:41763185-41763207 GCCCTACTGCACTGCAGCCTGGG - Intergenic
1054144408 9:61551651-61551673 GCCCTACTGCACTGCAGCCTGGG + Intergenic
1054189216 9:61975337-61975359 GCCCTACTGCACTGCAGCCTGGG - Intergenic
1054464096 9:65482610-65482632 GCCCTACTGCACTGCAGCCTGGG + Intergenic
1054649303 9:67613278-67613300 GCCCTACTGCACTGCAGCCTGGG + Intergenic
1054748509 9:68880527-68880549 GCAGTCTTGCTCTGCCGCCCAGG - Intronic
1054948627 9:70824451-70824473 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1054983333 9:71232729-71232751 GACCTCGTGATCTGCCGCCTCGG + Intronic
1055015953 9:71618493-71618515 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1055085925 9:72314246-72314268 GACCTCATGATCTGCCGCCTTGG - Intergenic
1055510497 9:76991633-76991655 GAAGTCTTGCTCTGCCGCCCAGG + Intergenic
1055814106 9:80185312-80185334 GCCCTCCTGCTCCACGGCGCCGG - Intergenic
1056346267 9:85698716-85698738 GCAGTCTTGCTCTGTCGCCCAGG + Intronic
1056376733 9:86021505-86021527 GCCTTCCTCCTCTCCTGCCCTGG + Intronic
1056617463 9:88180611-88180633 GCCCTCCTTCTCTCCCGCCCGGG + Intergenic
1056723231 9:89089406-89089428 TCCCTCCTGCTCCACCCCCCAGG - Intronic
1057432229 9:95004938-95004960 GCCCGCCCGCGCCGCCGCCCAGG + Intronic
1057566252 9:96168477-96168499 GTCTTCTTGCTCTGCTGCCCAGG - Intergenic
1057755095 9:97827586-97827608 GAGGTCCCGCTCTGCCGCCCAGG - Intergenic
1057825328 9:98368778-98368800 CCCCTCCTGCTCTGCGGCTCTGG - Intronic
1059244944 9:112841967-112841989 GGACTCTTGCTCTGTCGCCCAGG + Intronic
1059251350 9:112890317-112890339 GGCTTCCTGCTCTCCCGCCTCGG - Exonic
1059349741 9:113656166-113656188 GGCGTCTTGCTCTGTCGCCCAGG - Intergenic
1059395876 9:114033707-114033729 CCCCTCCTGCCCTGCCTCTCAGG - Intronic
1059810602 9:117852124-117852146 GCCCGCCGGCCCTGCTGCCCCGG + Intergenic
1060104993 9:120868095-120868117 GTCGTCCTGCTTTGTCGCCCAGG + Intronic
1060201418 9:121653742-121653764 GACCTCCTGCTCAGCTGACCAGG + Intronic
1060457174 9:123809694-123809716 GCCTTCTTGCTCTGTCACCCAGG + Intronic
1060488413 9:124064063-124064085 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1060530897 9:124346520-124346542 GCCCTCCTGCTGTCTGGCCCCGG - Intronic
1060657827 9:125384737-125384759 ACAGTCCTGCTCTGTCGCCCAGG - Intergenic
1060696522 9:125713527-125713549 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1060794508 9:126504837-126504859 GTCCTGCTGCTGTGCCACCCAGG - Exonic
1060833159 9:126732583-126732605 GGTCTCCTGCTCTGCCGCCCAGG + Intergenic
1061035583 9:128112418-128112440 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1061132900 9:128718260-128718282 GCCTCCCTGCCCTGCCTCCCTGG + Intronic
1061185655 9:129051619-129051641 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1061186329 9:129056542-129056564 GGACTCCTGCTCTGTTGCCCAGG + Intronic
1061203099 9:129148416-129148438 GCCCTGCTTCTCTGCTCCCCTGG + Exonic
1061208203 9:129176438-129176460 GCCCTCCTGAGCTGCGCCCCCGG + Exonic
1061257085 9:129459496-129459518 CCCCCCCAGCTCGGCCGCCCTGG - Intergenic
1061257398 9:129460626-129460648 GCCCGGCTGCTCGGCCGCCGCGG + Intergenic
1061261508 9:129483010-129483032 GCCTCCCTGCTCCCCCGCCCTGG - Intergenic
1061454705 9:130688907-130688929 GGAATCCTGCTCTGTCGCCCAGG - Intergenic
1061485675 9:130919467-130919489 GTCCTGCTGCTCAGCCTCCCCGG + Intronic
1061562689 9:131416337-131416359 GACCTCATGATCTGCCGCCTCGG + Intronic
1061564424 9:131428437-131428459 GCCCTACTGCACTGCAGCCTGGG - Intronic
1061712349 9:132497160-132497182 GCCCTGCAGCTTTGCCTCCCAGG - Intronic
1061959853 9:133982397-133982419 GGCCTCCTGCCCTGCCAGCCTGG - Intronic
1062018600 9:134304936-134304958 GGCCTCCTGCTCTCCCAGCCAGG - Intergenic
1062325464 9:136010494-136010516 GTCCCCCTGCTCCCCCGCCCAGG - Exonic
1062475758 9:136726266-136726288 GCCCTCCTTCCCTGCCTGCCGGG - Intergenic
1062514260 9:136924534-136924556 CCCCTCTTGCTCTGTTGCCCAGG - Intronic
1062530907 9:136999617-136999639 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1062572718 9:137193002-137193024 CCCCTCCTGCTCTGCTGTCTGGG + Intronic
1062582537 9:137234870-137234892 GCCCTGCTGCTCTGCCTCCTTGG + Intronic
1185506300 X:634155-634177 GCCCTCCTGCGCTGCAGCGGTGG + Intronic
1185625349 X:1477161-1477183 GCAGTCTTGCTCTGTCGCCCAGG - Intronic
1185657916 X:1701122-1701144 GCCGTCTTGCTCTATCGCCCAGG + Intergenic
1185822584 X:3219521-3219543 AGCCTCCTGCACTGCAGCCCAGG - Intergenic
1185862006 X:3588603-3588625 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1185891525 X:3826343-3826365 GCTCTCTTGCTCTGTCGCCCAGG - Intronic
1185896633 X:3864757-3864779 GCTCTCTTGCTCTGTCGCCCAGG - Intergenic
1185901751 X:3903184-3903206 GCTCTCTTGCTCTGTCGCCCAGG - Intergenic
1186282560 X:8009202-8009224 GCACTCCTGCTCTGTGACCCAGG + Intergenic
1186687768 X:11943489-11943511 GCCCTTCTGCTCTTCCGCCATGG - Intergenic
1187273015 X:17795745-17795767 GCCATCTTGCTCTGTTGCCCAGG + Intergenic
1187274161 X:17803983-17804005 GGAGTCCTGCTCTGCAGCCCAGG + Intronic
1187463299 X:19506544-19506566 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1188179421 X:27035488-27035510 GGCCTCTTGCTCTGTCACCCAGG - Intergenic
1188354645 X:29176117-29176139 GGAGTCTTGCTCTGCCGCCCAGG + Intronic
1188492462 X:30752120-30752142 GACGTCTTGCTCTGTCGCCCAGG + Intergenic
1189125739 X:38443954-38443976 GGAGTCTTGCTCTGCCGCCCAGG - Intronic
1189317037 X:40063748-40063770 TCCTTCCTGCTTTGCCGGCCAGG + Exonic
1189432522 X:40960339-40960361 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1189435463 X:40988944-40988966 GAACTCTTGCTCTGTCGCCCAGG - Intergenic
1189650514 X:43184028-43184050 ATCCTCCTGCTCAGCCTCCCAGG - Intergenic
1189686759 X:43572584-43572606 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1189781731 X:44520898-44520920 GACATCTTGCTCTGTCGCCCAGG + Intergenic
1190268657 X:48845398-48845420 GTTCTCCTGCTCTGTCACCCCGG - Intergenic
1190419488 X:50215013-50215035 GCAGTCTTGCTCTGTCGCCCGGG + Intronic
1190869738 X:54415023-54415045 GGCGTCTTGCTCTGTCGCCCAGG + Intergenic
1192500687 X:71649488-71649510 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1192738502 X:73871444-73871466 ACACTCTTGCTCTGCCACCCAGG + Intergenic
1196319550 X:114270823-114270845 GCCGGCCGGCCCTGCCGCCCTGG - Intergenic
1196706323 X:118720703-118720725 ACAATCCTGCTCTGTCGCCCAGG + Intergenic
1196707705 X:118729942-118729964 GCCGTCCTGCCCTGCTACCCTGG - Intronic
1196740760 X:119023999-119024021 GGAGTCTTGCTCTGCCGCCCAGG + Intergenic
1197207579 X:123803059-123803081 GCAGTCTTGCTCTGTCGCCCAGG - Intergenic
1197401038 X:125991265-125991287 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1198303025 X:135350030-135350052 GGAGTCCTGCTCTGTCGCCCAGG + Intronic
1198699599 X:139382659-139382681 GGCCTCCTGCTCTGCGGAGCAGG - Intergenic
1199084030 X:143608532-143608554 GCGGTCTTGCTCTGCCACCCAGG - Intergenic
1199345138 X:146730529-146730551 GCAGTCTTGCTCTGTCGCCCAGG + Intergenic
1199405524 X:147454183-147454205 GGACTCTTGCTCTGTCGCCCAGG - Intergenic
1199607983 X:149592047-149592069 GGAGTCCTGCTCTGTCGCCCAGG + Intergenic
1199609596 X:149601222-149601244 GCCCTCCTGCCCTGCCTCCTGGG + Intronic
1199629520 X:149768132-149768154 GCCCTCCTGCCCTGCCTCCTGGG - Intergenic
1199631137 X:149777313-149777335 GGAGTCCTGCTCTGTCGCCCAGG - Intergenic
1200074736 X:153545292-153545314 GCACTCCTGTGCTGCAGCCCTGG + Intronic
1201851286 Y:18484009-18484031 GTCCTCCTGCACTCCAGCCCGGG - Intergenic
1201882033 Y:18836370-18836392 GTCCTCCTGCACTCCAGCCCGGG + Intergenic
1202137116 Y:21676926-21676948 GCCGGCCCGCCCTGCCGCCCTGG - Intergenic