ID: 999247692

View in Genome Browser
Species Human (GRCh38)
Location 5:150163924-150163946
Sequence CAGTATGAACAGAGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999247692_999247699 13 Left 999247692 5:150163924-150163946 CCTCAGGGCCTCTGTTCATACTG No data
Right 999247699 5:150163960-150163982 GCCGCCCTTCCCCACTCCCCAGG No data
999247692_999247701 14 Left 999247692 5:150163924-150163946 CCTCAGGGCCTCTGTTCATACTG No data
Right 999247701 5:150163961-150163983 CCGCCCTTCCCCACTCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999247692 Original CRISPR CAGTATGAACAGAGGCCCTG AGG (reversed) Intergenic
No off target data available for this crispr