ID: 999247692 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:150163924-150163946 |
| Sequence | CAGTATGAACAGAGGCCCTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 999247692_999247699 | 13 | Left | 999247692 | 5:150163924-150163946 | CCTCAGGGCCTCTGTTCATACTG | No data | ||
| Right | 999247699 | 5:150163960-150163982 | GCCGCCCTTCCCCACTCCCCAGG | No data | ||||
| 999247692_999247701 | 14 | Left | 999247692 | 5:150163924-150163946 | CCTCAGGGCCTCTGTTCATACTG | No data | ||
| Right | 999247701 | 5:150163961-150163983 | CCGCCCTTCCCCACTCCCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 999247692 | Original CRISPR | CAGTATGAACAGAGGCCCTG AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||