ID: 999250109

View in Genome Browser
Species Human (GRCh38)
Location 5:150177417-150177439
Sequence TCTAGCATGCAGGAGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999250109_999250113 18 Left 999250109 5:150177417-150177439 CCATGCACCTCCTGCATGCTAGA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 999250113 5:150177458-150177480 AGTGAGCCCCTGTATGCCGCAGG 0: 1
1: 0
2: 0
3: 7
4: 96
999250109_999250114 19 Left 999250109 5:150177417-150177439 CCATGCACCTCCTGCATGCTAGA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 999250114 5:150177459-150177481 GTGAGCCCCTGTATGCCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 93
999250109_999250115 23 Left 999250109 5:150177417-150177439 CCATGCACCTCCTGCATGCTAGA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 999250115 5:150177463-150177485 GCCCCTGTATGCCGCAGGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999250109 Original CRISPR TCTAGCATGCAGGAGGTGCA TGG (reversed) Intronic
900115681 1:1026866-1026888 CCCAGCAGGCAGGAGGTGCAGGG - Intronic
900745924 1:4360734-4360756 TGTGGCTTGCAGGAGGTGCATGG - Intergenic
902699317 1:18160950-18160972 TCCAGGATGCAGGGGGTACATGG - Intronic
903128821 1:21265221-21265243 TCTAGCCTGCGGGAGGTGACTGG + Intronic
910225503 1:84931939-84931961 TCTTGCATCCAGGAGGTTCAGGG + Intronic
910820370 1:91338664-91338686 GCTAGCATGCACATGGTGCACGG + Intronic
911091033 1:94016938-94016960 TTGAGCATGGAGGAGGTCCAGGG + Intronic
916676920 1:167071756-167071778 TCTAGCCTGGCGGAGGTCCAGGG - Intronic
918460923 1:184775727-184775749 TAAAGCATTCAGAAGGTGCACGG + Intergenic
918852333 1:189708474-189708496 GCTAGGATCCAGGAGGTCCATGG - Intergenic
919007411 1:191915508-191915530 TCTAGGTTTCAGGAGGTGCATGG + Intergenic
919207620 1:194437506-194437528 TCTTGCATGCTGGTGGAGCAAGG - Intergenic
923734209 1:236586860-236586882 TCTATCATGTAGGATGTGCTTGG - Intronic
924274152 1:242368282-242368304 TCCAGAATGCAGGTGGTTCAGGG - Intronic
1065922328 10:30403520-30403542 GGTAGCATGCAGGTGGTTCATGG + Intergenic
1066162225 10:32746315-32746337 GCTAGGATTCTGGAGGTGCATGG - Intronic
1066474366 10:35730635-35730657 CCTAGCATGCAGAAAGTGCTTGG - Intergenic
1067373957 10:45710423-45710445 TGTAACATGCAGGAGGGACACGG - Intergenic
1067379733 10:45761839-45761861 TGTAACATGCAGGAGGGGCACGG + Intronic
1067887431 10:50102494-50102516 TGTAACATGCAGGAGGGACACGG + Intronic
1070624976 10:78044627-78044649 TCTGGCATGCGGGAAGTTCAAGG - Intronic
1074237162 10:111597171-111597193 TATAGCATGTAGGAGATGAAAGG - Intergenic
1075046500 10:119150348-119150370 CCTGGCAGGCAGGAGGTGCTGGG + Intronic
1075877520 10:125820374-125820396 TCAAGCATGCAGGAGGAGACAGG + Intronic
1075937075 10:126351590-126351612 TGTAGCATGTGGGAGGTCCAAGG - Intronic
1076092728 10:127702307-127702329 TCCAGCCTGCAGGAGCTACAGGG + Intergenic
1076708125 10:132313409-132313431 CCTAGCATGGAGCAGGTGCTTGG - Intronic
1078086979 11:8239772-8239794 TCTAGCGTGCAGGAGAAGCTTGG - Intronic
1079755176 11:24250080-24250102 TCTAGTGTGTAGCAGGTGCAGGG + Intergenic
1080401093 11:31936157-31936179 TCTGGGAAGCAGGAGATGCAGGG + Intronic
1080873815 11:36259264-36259286 TCCAGCATGCAGGAGCAGCTGGG + Intergenic
1081236355 11:40652111-40652133 CCTAACAGTCAGGAGGTGCACGG - Intronic
1083452364 11:62754399-62754421 TCCAGCAGGCAGGAGGTACCCGG + Intergenic
1084762033 11:71280064-71280086 TTTAGCATCCAGGATGTGAAAGG + Intergenic
1084770782 11:71341710-71341732 TCCAGCAAGGAGCAGGTGCACGG + Intergenic
1084853146 11:71960443-71960465 TGTAGCATGAAGGAGGTCCCAGG - Intronic
1084944654 11:72632131-72632153 TCTGGCATGGAGGAGGTTCTGGG + Intronic
1086512429 11:87573799-87573821 TTTAGCTTGAAGGAGGTGCAGGG + Intergenic
1091470537 12:722487-722509 TCAGGCTTGCAGGAGGGGCAGGG + Intergenic
1091967842 12:4760580-4760602 TCTAGCATGCAGGCAGAGAAGGG + Intronic
1092285859 12:7128996-7129018 TCCAGCCTGAAGGAGGGGCAGGG + Intergenic
1092441521 12:8508976-8508998 TGTAGCATGCTGGAGGTGCCAGG + Intergenic
1095359321 12:41317277-41317299 GCCAGCATGCTGGAGATGCAAGG + Intronic
1096812585 12:54181092-54181114 TCTTGCATGCTAGAGGTGGAAGG - Intronic
1100347353 12:93745450-93745472 TCTAGCAAGGAGGAGGCCCAGGG + Intronic
1101756044 12:107621207-107621229 TCTAGCCTGCAGGTGGCCCAGGG - Intronic
1102905945 12:116675393-116675415 TCTGGCCTGCAGGAGAGGCAGGG - Intergenic
1107802125 13:44118409-44118431 TCTAGAATCCAGGAGGAGAAAGG - Intergenic
1110306310 13:73991348-73991370 TCTAACATGCACTTGGTGCATGG - Intronic
1111287906 13:86119462-86119484 TCAGGCAAACAGGAGGTGCAGGG + Intergenic
1111586312 13:90288491-90288513 TCAAGCAACAAGGAGGTGCAAGG + Intergenic
1115104322 14:29742218-29742240 TGTAGCATGCAGGAGAGGAAAGG + Intronic
1118727489 14:68639432-68639454 CCTTGCATGCAGGAGGGGCCAGG - Intronic
1120056176 14:79926695-79926717 TTTAGCATACTGGAGGTTCATGG - Intergenic
1121605255 14:95235873-95235895 TCGGGCATGCAGGAGGCGGAGGG + Intronic
1121607720 14:95253505-95253527 TCTCGCATGCAGGGAATGCAGGG + Intronic
1123687150 15:22806852-22806874 TCTGCCCTGCAGGAAGTGCATGG - Intronic
1125517049 15:40327213-40327235 TCTACCATGGAGGAGGTAAATGG + Intergenic
1127986064 15:64071575-64071597 TCTAGCTTCCAGGAGCAGCAGGG + Intronic
1128033178 15:64499765-64499787 GCTAGCAAGAAAGAGGTGCAGGG + Exonic
1128930009 15:71695995-71696017 TAAAGCATGCAGGATGTGCCTGG + Intronic
1130169755 15:81499039-81499061 TCTAGACTGCAGGAAGTGCAAGG - Intergenic
1130415758 15:83693345-83693367 TCCAGGAGGCAGGAGGTGCTTGG + Intronic
1132237814 15:100235128-100235150 GATAGGATGCAGGAGGTGCTCGG + Intronic
1132276096 15:100565365-100565387 GCTAGCAAGTAGGAAGTGCAAGG + Intronic
1133324357 16:4934425-4934447 TGTAGCACACAGGAGGTGCCCGG - Intronic
1134337737 16:13316907-13316929 TGCAGGTTGCAGGAGGTGCATGG - Intergenic
1137019202 16:35406754-35406776 TCCAGCATCCAGGATCTGCAAGG + Intergenic
1139264673 16:65627694-65627716 TATAGCATGTATGAGGTGTAGGG + Intergenic
1139306186 16:65988152-65988174 GCTGGCATAGAGGAGGTGCAAGG + Intergenic
1143112180 17:4558921-4558943 GCGTGCATGCAGCAGGTGCAGGG + Exonic
1144401944 17:14913174-14913196 TCCTGCAAGCAGGAGGTGAAGGG + Intergenic
1146162181 17:30565976-30565998 TCAAACATGCAGGAGGTGAGAGG - Intergenic
1146894610 17:36532565-36532587 TCTGGGTTGCAGGAGGTACAAGG + Exonic
1147814908 17:43202215-43202237 TAGAGTATGCAGGAGGAGCATGG - Intronic
1148283653 17:46369197-46369219 GCTGGCATGCAGGAGGCCCAGGG + Intergenic
1148305871 17:46587114-46587136 GCTGGCATGCAGGAGGCCCAGGG + Intergenic
1148749069 17:49934461-49934483 CCTAGGATGCAGTAGGTACATGG + Intergenic
1148896958 17:50844412-50844434 CCTAGCAGGCTGGAGGTGCTGGG - Intergenic
1153060511 18:990191-990213 TCTAGCATGGAGGAAGAGAAAGG + Intergenic
1154111981 18:11578009-11578031 TCAAGCATGCTGGAGGGGCAGGG + Intergenic
1162054868 19:8056431-8056453 TCGAGCATCCAGGAGCTTCATGG - Exonic
1162490573 19:10988997-10989019 TCTGGCATGGATGAGGCGCAGGG - Intronic
1166391119 19:42409509-42409531 TCTAGCATGCAGTAGGAACTTGG - Intronic
1167680510 19:50917259-50917281 TCCAGCATGAGGGAGGTGCAGGG + Intergenic
927700807 2:25267774-25267796 GCTGGCATGTGGGAGGTGCAGGG - Intronic
928457990 2:31441159-31441181 TCTAGCATACAGGAATTGCATGG - Intergenic
930261430 2:49151246-49151268 TCTGCCATCCAGGAGCTGCAGGG + Intronic
931334594 2:61326752-61326774 CCTAGCATGCAGAAGGTCAATGG + Intronic
932695748 2:73954665-73954687 GACAGCATGCAGGAGGTGCATGG + Intronic
936355051 2:111742534-111742556 GATAGCATGCAGGAGGAGAAAGG + Intergenic
939087813 2:137742826-137742848 TCTGGCAGGCAGGAGCAGCAGGG - Intergenic
945121109 2:206458236-206458258 CCTGGCATACAGGAGGTACATGG + Intronic
945705876 2:213230722-213230744 TCTGGCATATAGGAGGTGCCTGG + Intergenic
946661693 2:222007663-222007685 TCAAGCATAAAGGAGGTGAAAGG + Intergenic
948404114 2:237704707-237704729 TCTAGAAGGCAGGGGCTGCAAGG + Intronic
1170722711 20:18897857-18897879 TAGAGCATGCAGGAGGGACATGG + Intergenic
1172186096 20:33031937-33031959 TCTAACTTGCAGGGGGAGCATGG - Intronic
1172617792 20:36300595-36300617 CCTGGCATGGAGGAGGTGCCTGG - Intergenic
1173525835 20:43731881-43731903 TTTAACCTGCAGGAGGTGCCTGG - Intergenic
1175036815 20:56007074-56007096 TCTTGCGTGCAGGAAGTGCCTGG - Intergenic
1176115828 20:63431603-63431625 TCGGGCTTCCAGGAGGTGCAGGG + Intronic
1176308767 21:5138666-5138688 TCCAGCTTGGAGGAGCTGCACGG - Intronic
1176336112 21:5601604-5601626 TCCAGCATGCACCAGGTTCACGG + Intergenic
1176391645 21:6219344-6219366 TCCAGCATGCACCAGGTTCACGG - Intergenic
1176469774 21:7096830-7096852 TCCAGCATGCACCAGGTTCACGG + Intergenic
1176493335 21:7478608-7478630 TCCAGCATGCACCAGGTTCACGG + Intergenic
1176507307 21:7659775-7659797 TCCAGCATGCACCAGGTTCACGG - Intergenic
1177044030 21:16146931-16146953 TCTTACATGCAGGAGGTTCATGG - Intergenic
1178751422 21:35307560-35307582 TCCAGCATCTAGGAGGTGCTTGG - Intronic
1179381912 21:40907835-40907857 TCTAGCATGCATTAGCTGCATGG + Intergenic
1179848292 21:44123366-44123388 TCCAGCTTGGAGGAGCTGCACGG + Intronic
1180240354 21:46499326-46499348 TGGTGCATGCAGTAGGTGCAGGG + Intronic
1180992280 22:19943882-19943904 TGTGGCATGCAGGAGCTGGAGGG + Intronic
1181980697 22:26763898-26763920 TCTGGCTTGCAGGAGGCACATGG + Intergenic
1182349516 22:29691379-29691401 TCTAGCAAGCAGGTGTTGCTGGG + Intronic
1183297926 22:37043133-37043155 TGTCCCATGGAGGAGGTGCATGG + Intergenic
1183808790 22:40236784-40236806 TCAAACATGCAGGAGAGGCAGGG - Intronic
1183839429 22:40485803-40485825 TCTAAGATGGAGGAGGAGCAAGG + Intronic
1184059483 22:42073619-42073641 TCTAGGCTGCAGGAACTGCAAGG + Intergenic
1184087225 22:42272115-42272137 CCTGGCATGCAGGAGGTGTTGGG - Intronic
950659272 3:14456761-14456783 ACTCCCATGCAGGAGGGGCAGGG - Intronic
950753246 3:15148681-15148703 CCCAGCATGGAGGAGGGGCATGG - Intergenic
951873476 3:27393726-27393748 TCTAACTTACAGGAGATGCAAGG + Intronic
952189161 3:31003979-31004001 TCTTGCACTCAGGAGGTACAGGG + Intergenic
954442133 3:50527675-50527697 TCTAGGACTCAGGAGGTGCTTGG + Intergenic
956619403 3:71205730-71205752 TCTGGAACGCAGGAGGTGCAGGG + Intronic
958959813 3:100498475-100498497 GCTAGCAGGCTGAAGGTGCAAGG - Intronic
960015799 3:112886044-112886066 TCTAGGATTCTGGAGGTCCATGG + Intergenic
961732688 3:128978185-128978207 TCTAGAATGCAGGAGAAGAAAGG + Exonic
962630266 3:137268927-137268949 TCTAGGATGCAGGTTGTCCAGGG + Intergenic
963730830 3:148970366-148970388 TCTAGCTTTCAGGAGCAGCATGG + Intergenic
966983902 3:185162434-185162456 TCCTGCATTCAGGAGCTGCAGGG + Intergenic
968120353 3:196121538-196121560 TCCAGCAGGCAGGAGGGCCATGG + Intergenic
968704419 4:2071388-2071410 ACTAGCCTGCAGGAGGCTCATGG + Intergenic
968982690 4:3859050-3859072 TCTAGTATACAGCAGGTGCCAGG - Intergenic
971477784 4:27088660-27088682 TCTAGAAGGCAGGAAGAGCAGGG - Intergenic
973775243 4:54235671-54235693 TCCAGGAGGTAGGAGGTGCAGGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
977335423 4:95692557-95692579 TCTAGCATGCATGAGGTTTGTGG + Intergenic
983555397 4:169055078-169055100 ACTAGCATGCAGCAGAGGCAGGG + Intergenic
988645771 5:33093391-33093413 GCTAGGATTCAGGAGGTCCATGG + Intergenic
990168233 5:53018367-53018389 GCTAGGATGCTGGAGGTCCATGG + Intronic
991184304 5:63789324-63789346 GCCACCTTGCAGGAGGTGCAAGG + Intergenic
993618125 5:90137272-90137294 TCAAGCCTGCAGCAGGGGCAAGG + Intergenic
993944017 5:94096937-94096959 GCTAGCATTCTGGAGGTCCATGG - Intronic
999250109 5:150177417-150177439 TCTAGCATGCAGGAGGTGCATGG - Intronic
1001219992 5:169892355-169892377 TCTAGCATGGAGCAGGAGCTAGG + Intronic
1001483758 5:172105497-172105519 GCTGGCATTCAGGAGGTGCCTGG + Intronic
1001756103 5:174171476-174171498 TCAAGCATGTAGCAGGTGCTCGG - Intronic
1002613272 5:180435338-180435360 TGGAGGATGCAGGGGGTGCAGGG + Intergenic
1003798881 6:9639114-9639136 GCTAGCATGGAGGAGCAGCAAGG + Intronic
1007647523 6:43394462-43394484 TCAAGCAGCAAGGAGGTGCAGGG + Intergenic
1007972344 6:46065737-46065759 TCTAGGAGGCAGGAGGTGTCTGG + Intronic
1009462864 6:63934982-63935004 TTTAGCAAGGAGGAGGTGCGGGG - Intronic
1010034361 6:71306344-71306366 ACTAGAATGCAGAAGGAGCAGGG - Exonic
1015606028 6:134955453-134955475 TCTAGAATAGAAGAGGTGCAGGG + Intergenic
1020052226 7:5089247-5089269 TCTTGCATGCAGTTGGTGGAAGG - Intergenic
1020805325 7:12783526-12783548 TCTATCTTGCAGGAGGTGCAAGG + Intergenic
1021683015 7:23153851-23153873 TCTAATATGTAGGAGGTGCTAGG + Intronic
1022910855 7:34898644-34898666 TCAAGCTGGCAGGGGGTGCAGGG - Intergenic
1023096727 7:36668958-36668980 TGCAGCATGCAGGAAGGGCAGGG + Intronic
1023151100 7:37202082-37202104 TATAGAATGCAGGAGGTCCCGGG - Intronic
1023381215 7:39610096-39610118 TCTAGCTTGCCGGAGGGCCAAGG - Intronic
1028760740 7:94493663-94493685 TCTTGAATCCAGGAGGTGGAGGG - Intergenic
1035306263 7:157934673-157934695 TCTGGGAAGCAGGAGGTCCAAGG - Intronic
1035698352 8:1618763-1618785 TCAAGAATGCTGAAGGTGCACGG - Intronic
1036614020 8:10374400-10374422 TCTAGCCTGCAGGATGTGCTAGG - Intronic
1037477700 8:19273686-19273708 TCTACCTTGCGGGAAGTGCATGG - Intergenic
1045540640 8:103081030-103081052 TGTGGCATGCAGAAGGGGCAGGG - Intergenic
1047450883 8:124964095-124964117 TGAGGCAAGCAGGAGGTGCAAGG + Intergenic
1048577797 8:135706573-135706595 TCTAGCAAGCTGAAGGAGCAGGG - Intergenic
1048846678 8:138609114-138609136 TCTGGCATGTAGGAAGTGCCCGG - Intronic
1050319259 9:4434243-4434265 TCTGGCATACAGCAGGTGCTTGG - Intergenic
1057829741 9:98397276-98397298 TCCAGCATCCAGGATGTCCAAGG - Intronic
1060947552 9:127579095-127579117 TCTAGCATGGAAGAGGTGGGAGG - Intergenic
1061865093 9:133488020-133488042 TGTAGCAGGCAGGATGGGCAGGG - Intergenic
1061913792 9:133738618-133738640 TCCAGCAGGCAGGTGGTGCCTGG - Intronic
1062035537 9:134380984-134381006 CCCAGCGGGCAGGAGGTGCAGGG + Intronic
1203425530 Un_GL000195v1:33298-33320 TCCAGCATGCACCAGGTTCACGG - Intergenic
1185643262 X:1599965-1599987 TCGCGCCTGCAGGAGGAGCAGGG - Intronic
1189423892 X:40881233-40881255 TCAACCATACTGGAGGTGCATGG - Intergenic
1190472452 X:50796509-50796531 TCTAGAATGTCGGAGGTGGAAGG + Intronic
1192624934 X:72716511-72716533 TCTAGCTTGAAGGAGGCACAAGG - Intergenic
1193047797 X:77070725-77070747 TCAAGCAACAAGGAGGTGCAGGG + Intergenic
1200367653 X:155684325-155684347 TCCAGCTTGCAGCAGGTGAAGGG + Intergenic