ID: 999252334

View in Genome Browser
Species Human (GRCh38)
Location 5:150190276-150190298
Sequence GCCCCGGAGCGCAGAGAGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999252334_999252343 22 Left 999252334 5:150190276-150190298 CCTCGCTCTCTGCGCTCCGGGGC 0: 1
1: 0
2: 2
3: 20
4: 171
Right 999252343 5:150190321-150190343 CTCCAAGATGAAGAAGCTCCAGG 0: 1
1: 0
2: 3
3: 25
4: 222
999252334_999252344 23 Left 999252334 5:150190276-150190298 CCTCGCTCTCTGCGCTCCGGGGC 0: 1
1: 0
2: 2
3: 20
4: 171
Right 999252344 5:150190322-150190344 TCCAAGATGAAGAAGCTCCAGGG 0: 1
1: 0
2: 3
3: 23
4: 191
999252334_999252335 -10 Left 999252334 5:150190276-150190298 CCTCGCTCTCTGCGCTCCGGGGC 0: 1
1: 0
2: 2
3: 20
4: 171
Right 999252335 5:150190289-150190311 GCTCCGGGGCAGCTGAGCCCCGG 0: 1
1: 0
2: 1
3: 38
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999252334 Original CRISPR GCCCCGGAGCGCAGAGAGCG AGG (reversed) Exonic
900178958 1:1303034-1303056 GCCCAGGGGCTCAGAGGGCGTGG - Intronic
900366787 1:2314854-2314876 GCCCCGGACGGCAGGGAGGGTGG - Intergenic
901789994 1:11649000-11649022 GCCCAGGAGCGCTGTGGGCGGGG + Intronic
902600901 1:17539729-17539751 GCCTCGGAGCGCGGCGGGCGCGG + Intergenic
903573347 1:24322211-24322233 GGCCCAGAGAGCAGGGAGCGAGG - Intronic
903939792 1:26921783-26921805 CCGCAGGAGCGTAGAGAGCGCGG + Exonic
904991619 1:34597972-34597994 GCCCAGGAGTGCAGAGGGAGAGG + Intergenic
905617069 1:39408775-39408797 GCCCCGGGGCGCGGTGGGCGTGG + Intronic
906286735 1:44592548-44592570 GCCTGGGAGTGCAGAGGGCGGGG - Intronic
908354404 1:63316965-63316987 GCCCCGGGGCCCACAGAGCGCGG - Intergenic
909392906 1:75136357-75136379 GACCCGGAGCCCGGGGAGCGCGG + Intronic
914915726 1:151817934-151817956 GCCCCAGAGCAGAGAGAGGGTGG + Intronic
914918382 1:151831803-151831825 GCCCAGGAGGGCAGGGAGCAGGG + Exonic
915165645 1:153946455-153946477 GCCGAGGACCGCAGAGCGCGGGG + Exonic
916215633 1:162390662-162390684 GCCCCTGAGCTCAGAGACCTGGG - Intergenic
922577398 1:226671335-226671357 GCCCCTGAGGGCAGGGACCGTGG + Intronic
923986370 1:239386965-239386987 ACCCCGGAGCGCACACCGCGGGG + Intronic
1064859880 10:19815933-19815955 GCCCCAGAGCGCGGGGAGAGGGG - Intergenic
1067061902 10:43081963-43081985 GCCCCAGAGCTCAGAGAAGGGGG - Intronic
1069521364 10:69124194-69124216 GCGCCGGAGCGGAGGGAGCCGGG + Exonic
1070570712 10:77637935-77637957 GGCCCCGAGCGCCGAGAGCCAGG + Intronic
1073207290 10:101775909-101775931 GCCCCGGGGCACCGAGAGCCCGG + Exonic
1074865863 10:117543978-117544000 GCCGCGGAGCCCAGAGCCCGCGG + Intronic
1076795731 10:132797340-132797362 GCCCCGGCACCCAGAGACCGAGG - Intergenic
1077301328 11:1848496-1848518 GCCCAGGAGTGAAGAGAGTGAGG - Intergenic
1077501870 11:2912971-2912993 GCACTGGAGCTCAGAGAGGGAGG + Intronic
1079017223 11:16879482-16879504 GCCCTGGAGAGCATAGAGCAGGG + Intronic
1079076808 11:17389376-17389398 GCACCGGAGCGCAGGGGGCGGGG + Intergenic
1079205623 11:18412203-18412225 GCCCTGGAGCGCAGTGTGGGTGG - Intergenic
1081528670 11:43943459-43943481 GCCCGGGAGCGCCGGGAGCGGGG + Intronic
1083572874 11:63769303-63769325 GCCCGGGAGCGCTGAGAGCTCGG + Intergenic
1084203218 11:67576148-67576170 GACCAGGCGGGCAGAGAGCGTGG - Intergenic
1087013324 11:93533466-93533488 TCCCCAGAGCACAGAGAGCTGGG + Intronic
1088823517 11:113475418-113475440 GCGCCCGAGCGCGGGGAGCGCGG + Intronic
1088892994 11:114059426-114059448 AGCCCGGAGCGCGGAGCGCGGGG + Intergenic
1090327797 11:125904268-125904290 GGGGCGGAGGGCAGAGAGCGGGG - Intronic
1090327803 11:125904287-125904309 GGGGCGGAGGGCAGAGAGCGGGG - Intronic
1090327817 11:125904325-125904347 GGGGCGGAGGGCAGAGAGCGGGG - Intronic
1093652592 12:21661809-21661831 GCACAGGAGCCCAGGGAGCGAGG - Intronic
1096732499 12:53625921-53625943 GCCCCGGGGGGCACAGGGCGTGG - Intronic
1098162459 12:67658375-67658397 CCACCGGAGAGCAGAGAGTGGGG + Exonic
1102795991 12:115689163-115689185 GCCCAGGAGCGCAGAGACCAGGG - Intergenic
1103142511 12:118561443-118561465 GCCCAGGAGGGCAGAGACCTTGG + Intergenic
1103207085 12:119138375-119138397 GCCCCGAAGTGCAGAGGGTGAGG - Intronic
1103400605 12:120640773-120640795 CCCCCGGCGGGCAGAGAACGGGG - Exonic
1103433002 12:120904051-120904073 GCCCCGGGGCCCAGGGAGCGGGG - Exonic
1103433055 12:120904208-120904230 GGCCCCGCGCGCAGTGAGCGCGG - Exonic
1103764536 12:123271290-123271312 GCTGCGGATCGCAGGGAGCGCGG - Intronic
1104689353 12:130813710-130813732 GCCCCAGAGCCCAGGGAGGGTGG + Intronic
1105352020 13:19624408-19624430 GCCCAGTAGCACAGAGAGCATGG + Intergenic
1107447322 13:40480693-40480715 GCCACGGTGCCCAGAGAGGGAGG - Intergenic
1113378979 13:109786243-109786265 GCCCCAGAGCGCGGAGGGCGCGG - Exonic
1114485179 14:23057695-23057717 GCCCAGGAGCGCCGAGGGGGCGG - Intergenic
1114533137 14:23407716-23407738 GCCCCAGAGCGCAGACAGGCAGG + Intronic
1117913888 14:60657478-60657500 TCCCCGGAGTGAAGAGCGCGCGG + Intronic
1119106821 14:71932601-71932623 GCCTGGGAGCGCGGAGAGCCAGG + Exonic
1122870804 14:104637428-104637450 GCCTTGGAGTGCAGAGTGCGTGG - Intergenic
1123091894 14:105745616-105745638 CCCCTGGAGCTCAGAGAGCCAGG - Intergenic
1123092015 14:105746137-105746159 CCCCTGGAGCTCAGAGAGCCAGG - Intergenic
1123097478 14:105773346-105773368 CCCCTGGAGCTCAGAGAGCCGGG - Intergenic
1125429349 15:39580472-39580494 GCCCCGGAGGGAGGTGAGCGCGG - Intergenic
1125578493 15:40770284-40770306 GCCCAGGAGAGCAGACAGCTGGG - Exonic
1129116677 15:73368649-73368671 GCTCCGGAGTGCAGAGCGCACGG + Exonic
1129944770 15:79529538-79529560 GGTCCGGAGTGCAGATAGCGGGG - Intergenic
1130335130 15:82952200-82952222 GCCCAGGGGCGAAGAGACCGCGG + Intronic
1132013097 15:98292958-98292980 GCCCGGGGGCGCAGCGAGCACGG - Intergenic
1132324679 15:100958863-100958885 GTCCCAGAGCACAGAGAGCCCGG - Intronic
1132341461 15:101080892-101080914 GCCCAGAAGAGCAGAGAGCCTGG - Intergenic
1132860899 16:2071281-2071303 GCCTCGGAGCTCACAGAGCCTGG - Intronic
1133311113 16:4847446-4847468 GCTCCGGCGCGCGGAGACCGCGG - Intronic
1139390763 16:66605256-66605278 TCCCCGGGGCCCAGAGAGGGCGG - Intronic
1142199865 16:88755947-88755969 GCCTCGGAGCGGGGAGGGCGGGG + Intronic
1142265691 16:89063099-89063121 GCCTGGGAGGGTAGAGAGCGGGG - Intergenic
1142429578 16:90019085-90019107 GGCCGGGAGCGCAGAGAACAAGG + Intronic
1142974719 17:3636586-3636608 GGGCCGGGGCGCAGAGATCGGGG - Exonic
1143152607 17:4816769-4816791 GCCCCAGAGAGCTGAGAGCAGGG + Intronic
1143528184 17:7484366-7484388 GCTCAGAAGCGCCGAGAGCGCGG + Exonic
1144637694 17:16920777-16920799 GCCCCTGAGCCCAGGGAGTGTGG + Intergenic
1144854233 17:18259054-18259076 GCCCCGGGGCGCAGAGGCCCAGG + Intergenic
1145210713 17:21011215-21011237 GCCCCTGAGCCCAGGGAGCGAGG - Exonic
1147334611 17:39719813-39719835 GCCCCGCCGAGCAGAGAGCCAGG + Exonic
1147726170 17:42567270-42567292 GCCCCGGGGCACGGAGAGCGTGG - Exonic
1147996815 17:44363985-44364007 GTCTGGGAGCGCAGAGCGCGGGG - Intergenic
1148356387 17:46978558-46978580 GCGGCAGAGCGCAGAGAGCGGGG + Exonic
1148770789 17:50064756-50064778 CCCCAGGAGTGCAGAGAGCGAGG - Intronic
1149999600 17:61425514-61425536 GCCCCAGAGAGCGGAGAGCAAGG - Intergenic
1151490786 17:74431395-74431417 GTCCCGGAGCGCAGAGGCCCAGG + Exonic
1151561658 17:74873048-74873070 TTCCCGGAGCGCAGGGGGCGGGG - Intergenic
1152132307 17:78484812-78484834 GCCCCGGGGCGGTGAGGGCGGGG - Intronic
1152343975 17:79740463-79740485 GCCCCTGAGCACAGAGAGGCAGG - Intronic
1152477215 17:80526239-80526261 GGCCAGGAGCGCAGAGAGGCAGG + Intergenic
1152786222 17:82249401-82249423 GCCCCAGAGCGCTGGGAGGGGGG + Intronic
1152868545 17:82738192-82738214 GCCCGGGAGCACTGAGGGCGTGG - Intronic
1155153016 18:23136669-23136691 GTCCCGTAGCCCAGAGACCGCGG - Intronic
1160481820 18:79246718-79246740 GCCAGGGAGCGCGGGGAGCGCGG - Intronic
1160962026 19:1726244-1726266 GGCCTGGAGCCCAGAGAGTGTGG + Intergenic
1161040436 19:2108314-2108336 GGCCCGGAGCGGAGGGAGCGAGG + Intronic
1162630434 19:11923459-11923481 GCCCGGGAGAGCAGAGATGGGGG - Intergenic
1162635356 19:11963738-11963760 GCCCGGGAGAGCAGAGATGGGGG - Intronic
1163390359 19:17026872-17026894 GCCCAGGAGCGGGGCGAGCGGGG - Intergenic
1164902148 19:31937583-31937605 TCCCAGCAGTGCAGAGAGCGAGG - Intergenic
1165427909 19:35755891-35755913 GCACCTGAGCGCAGCGGGCGCGG + Exonic
1166316794 19:41993966-41993988 GCCCCGGAGCGCAGGGGTCCCGG + Intronic
1168287201 19:55340753-55340775 GCCAGGGAGGACAGAGAGCGGGG - Intronic
925917819 2:8619309-8619331 GCCCCGGGGCCCAGGGAGCAGGG + Intergenic
927472367 2:23385735-23385757 GGCCCGACGCGCAGAGAGCCCGG - Exonic
929775791 2:44929750-44929772 GGCACGGAGCCCACAGAGCGAGG + Intergenic
932339087 2:70948601-70948623 GCCCAGGAGCACGGACAGCGAGG - Intronic
932582925 2:73004187-73004209 CCCCTTGAGCGCAGAGAGAGGGG + Intronic
933776179 2:85772474-85772496 GCCACGGAGGGCAGAGGGCAGGG + Intronic
934041285 2:88129493-88129515 ACCACGGAGGGCAGAGAGAGTGG - Intergenic
936531073 2:113277588-113277610 GTCCCGGCGCGCAGCGAGTGCGG - Intronic
936561225 2:113541570-113541592 GCCCCGGAGGGCGGCGAGCGCGG + Intergenic
937083920 2:119158391-119158413 GTCCCCGAGCGCGGGGAGCGGGG - Exonic
937750570 2:125472176-125472198 GCCCTGGAGCTCTGAGAGCCAGG + Intergenic
937908501 2:127064263-127064285 GGCCGGGAGGGCAGTGAGCGTGG + Intronic
941155393 2:161971718-161971740 GCCCCGGAGCGCGGGGATGGAGG - Intronic
942454485 2:176128942-176128964 GCCCCGGCGCGCAGCGAACCAGG - Intergenic
946098849 2:217301454-217301476 GCCCTTGAGGGCAGAGAGCAAGG + Intronic
947877856 2:233479869-233479891 ACCCCGGAGAGCAGAGAGGAAGG + Intronic
948237860 2:236403850-236403872 GCCCCGAGGCACAGCGAGCGAGG - Intronic
948770097 2:240247497-240247519 GCCCTGGAGCACCGAGAGAGGGG + Intergenic
948901072 2:240957172-240957194 GCCAGGGAGGGCAGAGAGCTGGG - Intronic
1169767191 20:9159704-9159726 GCCCAGGAGGGCAGAGAGCTTGG + Intronic
1175544948 20:59772170-59772192 GCCCGGAAGAGCAGAGAGCATGG - Intronic
1175715804 20:61253371-61253393 GCCCGCGGGGGCAGAGAGCGCGG + Intronic
1175760006 20:61556012-61556034 GCACCGGAGCAGAGAGAGGGCGG - Intronic
1179641176 21:42747969-42747991 GCAGCGGAGCGCAGAGAGAGGGG + Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181886739 22:26027598-26027620 TCCCCCGAGCGGAGAGAGCCAGG + Exonic
1182289847 22:29268622-29268644 GGCCCGGAGCTCAGGGCGCGAGG - Intronic
1183600657 22:38838501-38838523 GCCTCGGAGCCCAGAGTGAGAGG - Intronic
1184362357 22:44025972-44025994 GCCCCGGAGCACATAGAACAGGG + Intronic
1184634788 22:45818578-45818600 GCCCCGGTCCGCTGAAAGCGAGG - Intronic
1185055278 22:48575908-48575930 GCCCCGGGCCGGAGCGAGCGCGG + Intronic
950069608 3:10141850-10141872 GCCCCGGAGGGCGGAGAACTGGG + Exonic
953723092 3:45373405-45373427 TCCCTGGAGGGCAGAGAGCCTGG + Intergenic
954660946 3:52226489-52226511 CCCCTGGAGGGCAGAGAGCAGGG - Intergenic
956178877 3:66500151-66500173 GCCCCGGGGCGCAGAGAGGGCGG + Intronic
960937615 3:122913138-122913160 GCCCCGGAGCGGTGAGGGCGGGG - Intronic
963983541 3:151566701-151566723 GTGCCGGAGGGCAGAGAGCTGGG + Intergenic
976565562 4:86547538-86547560 GCACAGGAGCCCAGGGAGCGCGG - Intronic
978277283 4:106967485-106967507 GCCCCAGAGGGAAGAGAGCAAGG + Intronic
981713594 4:147732165-147732187 GCCCGGGCGCGCGGCGAGCGCGG - Exonic
997955308 5:138274466-138274488 CCCCTGGAGCTCTGAGAGCGGGG + Exonic
998139091 5:139689957-139689979 CCCCAGGAGGGCAGGGAGCGAGG - Intergenic
998337709 5:141388109-141388131 CACCGTGAGCGCAGAGAGCGGGG + Exonic
998338819 5:141398352-141398374 CACCGTGAGCGCAGAGAGCGGGG + Exonic
998342158 5:141427793-141427815 GTCCGTGAGCGCACAGAGCGGGG + Intronic
998583443 5:143403598-143403620 GCGGCGGAGGGAAGAGAGCGCGG + Exonic
999252334 5:150190276-150190298 GCCCCGGAGCGCAGAGAGCGAGG - Exonic
1001309682 5:170601995-170602017 ACCCCAGAGGGCAGAGAGCCTGG - Intronic
1001402032 5:171451372-171451394 GCCTCGGGGGCCAGAGAGCGAGG - Intronic
1002456084 5:179345861-179345883 GCCCCAGAGCACAGAGACAGGGG - Intergenic
1003948166 6:11094019-11094041 GCCCCGGAGAGCCGAGGCCGCGG - Exonic
1006129247 6:31859446-31859468 TCCCGGGAGGGCAGAGAGGGTGG + Exonic
1006979180 6:38132859-38132881 GCTCCGGAGGGCAGAGTGAGGGG - Intronic
1007633387 6:43284812-43284834 GCCCTGGAGGACAGAGAGCCAGG + Intronic
1007702173 6:43771735-43771757 CCGCGGGAGGGCAGAGAGCGTGG + Intronic
1007775795 6:44223707-44223729 GCCACGGAGGGCAGGGAGGGCGG + Exonic
1014507800 6:122280863-122280885 GCACAGGAGCCCACAGAGCGCGG - Intergenic
1018959916 6:168441046-168441068 GCACCGGAGCGGAGCGGGCGCGG + Intergenic
1019491243 7:1314567-1314589 ATCCTGGAGCGCGGAGAGCGTGG + Intergenic
1019598092 7:1867680-1867702 GCCCCGGAGGCCAGGAAGCGTGG - Intronic
1020008106 7:4792886-4792908 ATCCCGAAGCTCAGAGAGCGTGG + Intronic
1023699292 7:42876555-42876577 GCCCCGGATCACACAGATCGTGG + Intergenic
1026538547 7:71260669-71260691 GCCCAGGAGTACAGAGAGCTGGG - Intronic
1026571898 7:71538715-71538737 GCTCCTGAGCTCAGAGAGAGTGG - Intronic
1026665522 7:72337110-72337132 GCCCCGGAGCCCAGTGGCCGAGG + Intronic
1026869606 7:73842286-73842308 GACACTGAGCGCAGAGAGGGCGG + Intronic
1035264775 7:157684838-157684860 GCCCAGGAGGGCACAGGGCGGGG - Intronic
1035352210 7:158254739-158254761 GCTCCTGAACGCAGAGAGGGAGG - Intronic
1035388243 7:158488818-158488840 GGCCCGGGGCGCACTGAGCGAGG - Intronic
1037903770 8:22703502-22703524 CCCCTGGAACGCGGAGAGCGTGG - Intergenic
1039454019 8:37696287-37696309 GCCCCGGGGCGCTGGGAGCTGGG - Intronic
1039885098 8:41650046-41650068 GCCCCGGGGGGCAGAGGACGAGG - Intronic
1044320079 8:90791716-90791738 GACACCGAGCGCGGAGAGCGCGG + Exonic
1049427787 8:142545024-142545046 GCCCCGGGCCGCACAGAGGGAGG - Intergenic
1049891462 9:73746-73768 GCCCCGGAGGGCGGCGAGCGCGG - Intergenic
1053732889 9:41074843-41074865 GTCCCGGAGGGCGGCGAGCGCGG - Intergenic
1054695539 9:68356711-68356733 GCCCCGGAGGGCGGCGATCGCGG + Intronic
1055454362 9:76459208-76459230 GCTCCGGAGCGCCTAGAGCGCGG + Intronic
1056787979 9:89606118-89606140 GCCCCGGGGCGCCTAGAGCGCGG + Exonic
1060832176 9:126723428-126723450 CACCCGGAGCGCAGCGAGCCAGG - Intergenic
1061395130 9:130339737-130339759 GCCCAGGAGCACAGAGAGCGTGG - Intronic
1061716411 9:132521130-132521152 GCCCTGGAGAACAGAGAGCCCGG - Intronic
1061725957 9:132582199-132582221 CCCCCGGAGCGGCGAGGGCGCGG + Exonic
1062495841 9:136831311-136831333 GCCCCGGTGGGCAGGGAGCCTGG + Intronic
1062718687 9:138023638-138023660 GCCCCGGGAGGCGGAGAGCGGGG + Exonic
1185504083 X:619310-619332 GGCGGGGAGCGCAGAGCGCGCGG - Intergenic
1190911175 X:54774015-54774037 GACCCAGAAAGCAGAGAGCGTGG - Intronic
1195875597 X:109537132-109537154 GCCCCGCAGTGCAGAGAGCCGGG - Intronic
1199512512 X:148638353-148638375 GGCCCGGAGGGGAGAGAGCAGGG + Intronic
1199833180 X:151563664-151563686 GCCCCAGAGTGCAAAGCGCGTGG - Exonic