ID: 999256657

View in Genome Browser
Species Human (GRCh38)
Location 5:150213374-150213396
Sequence CAGAGACCACACGTTGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 167}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999256657_999256668 6 Left 999256657 5:150213374-150213396 CCACTGCCAACGTGTGGTCTCTG 0: 1
1: 0
2: 2
3: 19
4: 167
Right 999256668 5:150213403-150213425 GGAAGGAGGGAAGGCAGTGGAGG 0: 1
1: 2
2: 34
3: 529
4: 6257
999256657_999256671 12 Left 999256657 5:150213374-150213396 CCACTGCCAACGTGTGGTCTCTG 0: 1
1: 0
2: 2
3: 19
4: 167
Right 999256671 5:150213409-150213431 AGGGAAGGCAGTGGAGGGGCAGG 0: 1
1: 0
2: 20
3: 381
4: 2711
999256657_999256664 -8 Left 999256657 5:150213374-150213396 CCACTGCCAACGTGTGGTCTCTG 0: 1
1: 0
2: 2
3: 19
4: 167
Right 999256664 5:150213389-150213411 GGTCTCTGTGGCGGGGAAGGAGG 0: 1
1: 0
2: 3
3: 42
4: 400
999256657_999256667 3 Left 999256657 5:150213374-150213396 CCACTGCCAACGTGTGGTCTCTG 0: 1
1: 0
2: 2
3: 19
4: 167
Right 999256667 5:150213400-150213422 CGGGGAAGGAGGGAAGGCAGTGG No data
999256657_999256672 13 Left 999256657 5:150213374-150213396 CCACTGCCAACGTGTGGTCTCTG 0: 1
1: 0
2: 2
3: 19
4: 167
Right 999256672 5:150213410-150213432 GGGAAGGCAGTGGAGGGGCAGGG 0: 1
1: 1
2: 11
3: 304
4: 2469
999256657_999256665 -7 Left 999256657 5:150213374-150213396 CCACTGCCAACGTGTGGTCTCTG 0: 1
1: 0
2: 2
3: 19
4: 167
Right 999256665 5:150213390-150213412 GTCTCTGTGGCGGGGAAGGAGGG 0: 1
1: 0
2: 1
3: 38
4: 326
999256657_999256670 8 Left 999256657 5:150213374-150213396 CCACTGCCAACGTGTGGTCTCTG 0: 1
1: 0
2: 2
3: 19
4: 167
Right 999256670 5:150213405-150213427 AAGGAGGGAAGGCAGTGGAGGGG 0: 1
1: 0
2: 18
3: 257
4: 2091
999256657_999256669 7 Left 999256657 5:150213374-150213396 CCACTGCCAACGTGTGGTCTCTG 0: 1
1: 0
2: 2
3: 19
4: 167
Right 999256669 5:150213404-150213426 GAAGGAGGGAAGGCAGTGGAGGG 0: 1
1: 0
2: 21
3: 433
4: 2746
999256657_999256673 14 Left 999256657 5:150213374-150213396 CCACTGCCAACGTGTGGTCTCTG 0: 1
1: 0
2: 2
3: 19
4: 167
Right 999256673 5:150213411-150213433 GGAAGGCAGTGGAGGGGCAGGGG No data
999256657_999256666 -3 Left 999256657 5:150213374-150213396 CCACTGCCAACGTGTGGTCTCTG 0: 1
1: 0
2: 2
3: 19
4: 167
Right 999256666 5:150213394-150213416 CTGTGGCGGGGAAGGAGGGAAGG 0: 1
1: 0
2: 6
3: 115
4: 1124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999256657 Original CRISPR CAGAGACCACACGTTGGCAG TGG (reversed) Intronic
900156932 1:1206901-1206923 CAGATACCACCCGGAGGCAGTGG - Intergenic
902103767 1:14015975-14015997 CAGAGACCACAGGATTGTAGAGG + Intergenic
902117357 1:14132397-14132419 CAGAAACCACAGGTGGGCTGAGG + Intergenic
905951390 1:41954474-41954496 CAGAGACTTCACCTTGGCACAGG + Intronic
907526044 1:55054683-55054705 CAGAGCTCACAGGCTGGCAGAGG + Intronic
907995106 1:59623144-59623166 CAAAGATCACAGGTTGGCAATGG - Intronic
910347299 1:86254950-86254972 CCCAGACCACAGGTTGGCAGTGG + Intergenic
910598835 1:89008769-89008791 TAGTGACCACATGTAGGCAGTGG + Intronic
910935372 1:92482256-92482278 AAGTGACCACACGTTGGGTGGGG - Intronic
915765740 1:158360393-158360415 CACAGAACTTACGTTGGCAGTGG + Intergenic
916025896 1:160833305-160833327 CAGGGACCACAGGTTTGAAGGGG - Intronic
920170760 1:204071174-204071196 CAGTGACCAGACAATGGCAGTGG - Intergenic
920365054 1:205443900-205443922 CAGAGACCACAGCCTGGCAGAGG - Intronic
922348327 1:224715674-224715696 CAGAGATCACACGGCGGGAGAGG + Intronic
923571391 1:235117825-235117847 CATAGTCCTCACATTGGCAGTGG - Intronic
924622803 1:245677112-245677134 CTGAGACCGCTGGTTGGCAGAGG - Intronic
1062772673 10:115489-115511 GAGAGACCACATGTTCTCAGTGG + Intergenic
1064981555 10:21172076-21172098 CAGAGCCCACACGTTCTCAGTGG + Intronic
1065239252 10:23688653-23688675 CAGAGCCAAAATGTTGGCAGAGG - Intergenic
1069907321 10:71739539-71739561 CAGAGGGCCCACGTGGGCAGAGG + Intronic
1072477118 10:95773045-95773067 CAGAGATCACATGGTGGGAGAGG + Intronic
1074158073 10:110815541-110815563 CAGAGAGCAAGAGTTGGCAGGGG + Intronic
1075009838 10:118858115-118858137 CAGAGACCACATGGTGAGAGAGG - Intergenic
1076408783 10:130231363-130231385 CAGAGACGTGACGATGGCAGAGG - Intergenic
1076468766 10:130704119-130704141 CAGAGTCCACAGGTGGGCAGTGG - Intergenic
1076814923 10:132909889-132909911 CAGAGCCCAGATGTGGGCAGGGG + Intronic
1076818836 10:132928088-132928110 CAGCGACCCCACGTCAGCAGGGG + Intronic
1077378888 11:2218783-2218805 CAGAGACCACATGGTGAGAGAGG + Intergenic
1080611305 11:33906419-33906441 CAGAGGCCACACGTTGCCTAGGG - Intergenic
1081227802 11:40546230-40546252 CAGAGATCACACATTGGTAGAGG + Intronic
1081666803 11:44921341-44921363 CAGATTCCATATGTTGGCAGAGG + Intronic
1083965305 11:66040108-66040130 CAGAGACCACAGGGTGAGAGAGG - Intergenic
1083986317 11:66217911-66217933 AAGAGACCCCACGTAGGAAGAGG - Intronic
1088989011 11:114935381-114935403 CAGAGCCCAGAGGTGGGCAGTGG + Intergenic
1091087244 11:132733601-132733623 TAGAGACCACACATTAGTAGTGG + Intronic
1094429995 12:30358012-30358034 GAGAGACCACATGTAGGCATCGG + Intergenic
1097360835 12:58656354-58656376 CATGGACCACATGTTGACAGTGG - Intronic
1099864632 12:88264245-88264267 CAGAGAACACGTGATGGCAGAGG + Intergenic
1100346313 12:93734916-93734938 CAGGGACCTAACCTTGGCAGGGG - Intronic
1100605419 12:96148510-96148532 CAGAGTCCACACGATAGCACTGG - Intergenic
1102063964 12:109957289-109957311 CAGAGATCACACGGTGAGAGAGG - Intronic
1104384563 12:128339175-128339197 CACAGACCACATGCTGGCAGTGG - Intronic
1105469195 13:20676510-20676532 CAGAGGTCACACACTGGCAGTGG - Intronic
1106865415 13:33959194-33959216 CAGAGACCACAGGGTGGAGGTGG - Intronic
1110017264 13:70422895-70422917 CAGAGAACCCAAGTTGGTAGAGG + Intergenic
1112209116 13:97356759-97356781 CAGCGAGCACATGATGGCAGTGG - Intronic
1112317317 13:98374854-98374876 CAGAGATCACATGGTGGGAGAGG + Intronic
1112536684 13:100264835-100264857 AAAATATCACACGTTGGCAGGGG - Intronic
1113580464 13:111425232-111425254 CAGCGGCCACACGTGGCCAGCGG - Intergenic
1115150240 14:30276367-30276389 TAGAGACCACACTTGAGCAGAGG - Intergenic
1117062966 14:51981586-51981608 CACAGGCCACACTGTGGCAGAGG + Intergenic
1117514921 14:56491497-56491519 CAGTGACCTCAAGATGGCAGTGG + Intronic
1118776278 14:68976311-68976333 CAGAGTCCACAAGTGGACAGAGG - Intronic
1118813208 14:69290482-69290504 CTGAGACAAGATGTTGGCAGGGG + Intronic
1121553327 14:94818940-94818962 CAGAGACAACCTGCTGGCAGAGG - Intergenic
1122798526 14:104218305-104218327 CAGAGCCCACATGGTGGCAGCGG + Intergenic
1123811877 15:23935178-23935200 CAGAGATCACATGTTGAGAGAGG - Intergenic
1123980475 15:25597422-25597444 CAGCGACCACTCGTTCGGAGAGG - Intergenic
1125159877 15:36630796-36630818 CAGAGACCACATGGTGAGAGAGG + Intronic
1127404764 15:58631073-58631095 CAGAGATCACATGGTGGGAGTGG - Intronic
1129244760 15:74272425-74272447 CAGAGAGCACACGTTCATAGGGG - Intronic
1131602510 15:93863714-93863736 CAGAGATCACATGGTGGGAGAGG - Intergenic
1132345332 15:101104771-101104793 CACAGGCCACACCCTGGCAGGGG + Intergenic
1132749664 16:1451729-1451751 GAGAGAGCACACGTTGGGAGGGG + Intronic
1135889179 16:26341926-26341948 CACAGACCACAGGTTGGCAGTGG + Intergenic
1138558308 16:57785700-57785722 CAGAGGTCCCACGCTGGCAGAGG + Intronic
1138686700 16:58732902-58732924 TAAAGAGCACACGTTGACAGTGG + Intronic
1139545748 16:67648773-67648795 AAGAGACCACACATTGGGAGAGG + Intronic
1140219341 16:73032710-73032732 CAGAGTCCACACGCTTGCAAAGG + Intronic
1141290673 16:82715681-82715703 CAGAGACCACACTGTGGAAGGGG + Intronic
1141740267 16:85887060-85887082 CAGAGACCACAAGTTGGTCATGG - Intergenic
1142032109 16:87843782-87843804 CAGAGAGCCCACGGTGGCAGAGG + Intronic
1144752319 17:17657741-17657763 CAGAGGCCAGAGGTTGGCACTGG - Intergenic
1148076208 17:44936443-44936465 CAGAGACCAGTCATTGGGAGTGG - Intronic
1148475373 17:47925223-47925245 CAGAGAGCACAAGGAGGCAGGGG - Intronic
1150615275 17:66765671-66765693 CAGAAACCACAAGTGGCCAGTGG + Intronic
1154082916 18:11275964-11275986 GAGAGTCCACACGACGGCAGTGG + Intergenic
1157349637 18:46873013-46873035 CAAAGGCCACAGGTTGTCAGTGG - Intronic
1158753268 18:60291184-60291206 CACAGGCCGCACGTTAGCAGAGG - Intergenic
1160084346 18:75761012-75761034 AAGATAACACATGTTGGCAGGGG - Intergenic
1162863696 19:13527492-13527514 CAGAGACCACATGATGACAGAGG + Intronic
1163520771 19:17790378-17790400 CAGAGACCACACCTGCCCAGTGG + Intergenic
1163711681 19:18850891-18850913 CAGAAACCACACGAAGGCACGGG - Intronic
1163996701 19:21055994-21056016 AAGAAACCAAAAGTTGGCAGTGG + Intronic
925708182 2:6710568-6710590 CAGAGACCACATGGTGAGAGGGG - Intergenic
928190595 2:29162475-29162497 TAAAGACTACACTTTGGCAGTGG - Intronic
928835711 2:35541838-35541860 CAGAGACCAGAGGATGGTAGAGG + Intergenic
929670865 2:43875758-43875780 CAGAGACCAGGCTATGGCAGTGG - Intronic
932230898 2:70083527-70083549 CAGTGACCACAGGTTGGTTGAGG - Intergenic
932262269 2:70336874-70336896 CAAAGCCCACAGGTTGGCATTGG - Intergenic
932396028 2:71448753-71448775 AAAAGACCACACGTTGGGAATGG + Intergenic
932596254 2:73095474-73095496 CAGAGGCCACACCTGAGCAGAGG + Intronic
935182450 2:100702964-100702986 CAGAGATCACACGGTGAGAGAGG - Intergenic
935524817 2:104152737-104152759 CAGAGACCACAAGTTGGTCTTGG - Intergenic
937297252 2:120817288-120817310 GAGAGACCCCACGGAGGCAGTGG - Intronic
937549816 2:123074062-123074084 CAGAAACCACACACTGCCAGAGG - Intergenic
937703159 2:124887199-124887221 CAAAGACCACACTTTAGGAGGGG - Intronic
938191034 2:129280826-129280848 CAGGGACCCCAAGGTGGCAGAGG - Intergenic
940773328 2:157861219-157861241 CAGAGAGCTCAGCTTGGCAGAGG - Intronic
942193959 2:173498654-173498676 CAGAGACCACAAGTTGAAACTGG + Intergenic
942662770 2:178283797-178283819 CAGAGATCACATGGTGACAGAGG + Intronic
943369564 2:187001391-187001413 CAGAGACCTCCCGTTGGCCTAGG + Intergenic
949012237 2:241687236-241687258 CGGAGCCCTCACGCTGGCAGCGG - Intergenic
1173094800 20:40015190-40015212 CAGAGACCACACTGCGGCCGTGG + Intergenic
1173469261 20:43309931-43309953 CAGAGTCCACACAATGGCTGAGG - Intergenic
1173647811 20:44644464-44644486 CAGAACCCACACGGGGGCAGAGG + Intronic
1174389388 20:50208412-50208434 CAGAGTCCACACGCTGGCCCAGG - Intergenic
1175167114 20:57052267-57052289 CAGAGACCACATGTGGCCACTGG + Intergenic
1175693573 20:61084272-61084294 CAGAGACCACTCACTGGCAGTGG + Intergenic
1178361215 21:31949828-31949850 CAGAGATCACATGGTGGGAGAGG + Intronic
1180174249 21:46080068-46080090 CAGAGAACAGACGTCTGCAGAGG + Intergenic
1180908269 22:19431176-19431198 CAAGGACCACAGGTGGGCAGCGG + Intronic
1182503222 22:30763843-30763865 CAGAGACCCCAAGTGGGCTGGGG - Intronic
1183383565 22:37502655-37502677 CAAAGGCCACACGCTGTCAGAGG + Exonic
1183776799 22:39971437-39971459 CAGAGACCACACCTCGGCACTGG + Exonic
949093633 3:60047-60069 CAGAGATCACACGCTGAGAGAGG - Intergenic
950396046 3:12734802-12734824 CAAAGACCACAGGATGGCATGGG + Intronic
952731680 3:36643481-36643503 CAGAGATCACACGGTGAGAGAGG + Intergenic
953221207 3:40973417-40973439 CAGGGACCACCCCTTGGCATAGG + Intergenic
954689960 3:52390531-52390553 CAGAGGCCAGGCGTGGGCAGAGG + Intronic
955991579 3:64633413-64633435 CACAAATCACAGGTTGGCAGCGG + Intronic
956743249 3:72291396-72291418 CAGAGCCAACACGGTGGGAGAGG + Intergenic
959043226 3:101442301-101442323 CACAGACCACGGGATGGCAGGGG + Intronic
959429500 3:106235528-106235550 CAGAGATGAAAGGTTGGCAGGGG - Intergenic
962199214 3:133387988-133388010 CACAGAACACAGGCTGGCAGGGG - Intronic
963380918 3:144529129-144529151 CAGAATCCACACCTTGGTAGGGG - Intergenic
965734323 3:171804906-171804928 CAGAGACGAGGCATTGGCAGAGG - Intronic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
978100166 4:104829153-104829175 CAGAGCCCATACATGGGCAGTGG - Intergenic
984422310 4:179539504-179539526 AAGAATCCACACATTGGCAGTGG + Intergenic
984835330 4:184014388-184014410 CAGAGACCAAAGGCTGCCAGGGG + Intronic
985710303 5:1424117-1424139 CAGAGGCCCCAGGTTGGCACAGG + Intronic
986918779 5:12660404-12660426 CAGAGATCCCAAGATGGCAGCGG + Intergenic
991607147 5:68414108-68414130 CATAGAACATACGTTGGGAGTGG - Intergenic
992558259 5:77924468-77924490 CAGAGACCACACGGTGGGAGAGG - Intergenic
992947694 5:81825460-81825482 CAGAGGCCCCAGGGTGGCAGAGG - Intergenic
997606509 5:135178956-135178978 CAGAGCGCACACGTTGACTGAGG + Intronic
999256657 5:150213374-150213396 CAGAGACCACACGTTGGCAGTGG - Intronic
1001077531 5:168641696-168641718 TAGAGACCACACAGTGGCAGAGG - Intergenic
1005261662 6:24067819-24067841 CTGAGAGCACATGTTTGCAGTGG - Intergenic
1006144907 6:31953029-31953051 CAGAGATCACAGGATGGGAGTGG - Intronic
1007083853 6:39128771-39128793 CAGAGACCACACAGTGAGAGAGG + Intergenic
1007215122 6:40231066-40231088 CAGAGATCACACGGTGAGAGAGG + Intergenic
1007242994 6:40440554-40440576 CAGAGGCCACAGGGTGTCAGAGG - Intronic
1010037641 6:71344579-71344601 CGGAGACCACAAGCTGGAAGAGG - Intergenic
1011531244 6:88323650-88323672 CAGAGGTCACAGGTTGGGAGGGG - Intergenic
1013915197 6:115328943-115328965 CTGAAACCAGAGGTTGGCAGAGG - Intergenic
1013939472 6:115644574-115644596 CTGAGACCAAATGTAGGCAGGGG - Intergenic
1018565386 6:165146160-165146182 CAGAGACCACATGGAGGGAGAGG - Intergenic
1019276480 7:178533-178555 CAGAGACCACACCGTGGCGGAGG - Intergenic
1019580798 7:1761248-1761270 CAGAGACTAAACGCCGGCAGCGG + Intergenic
1023674594 7:42616732-42616754 CATAGAACACACGTTGGGAGTGG + Intergenic
1023926145 7:44671230-44671252 CAGAGATCACATGGTGGGAGGGG + Intronic
1026794595 7:73358666-73358688 CAGAGTCCCCAGGTGGGCAGGGG + Intergenic
1027237685 7:76307635-76307657 CAGAGGTCACGGGTTGGCAGGGG + Intergenic
1031869834 7:127079697-127079719 CAGGGACTACTGGTTGGCAGTGG + Intronic
1032071401 7:128809615-128809637 AAGAGGCCACTCTTTGGCAGTGG - Exonic
1035305083 7:157926936-157926958 CAGAGACCTCACGTCTGCTGGGG + Intronic
1036659800 8:10700587-10700609 CAGAGACCAGATGATGGCATGGG - Exonic
1037267839 8:17086402-17086424 CAGGGACTACACGTGGGCAAGGG - Intronic
1037553318 8:19996396-19996418 CAGAGAGCATAGGATGGCAGGGG + Intergenic
1042722932 8:71844034-71844056 CAGTGACAACTCGTCGGCAGAGG - Exonic
1044840632 8:96333765-96333787 AAGAGACCCCACGTTGGCAAAGG - Exonic
1045423459 8:102039873-102039895 CAGATATCACATGTTGGGAGAGG - Intronic
1046685940 8:117226974-117226996 CAGAAGCCACAGGTTGGCGGGGG - Intergenic
1047533846 8:125701304-125701326 CAGAGATCACATGGTGACAGAGG + Intergenic
1048058296 8:130890717-130890739 CAGAGACCACAGGCTGGCAAGGG + Intronic
1049090349 8:140509965-140509987 CAGGGAGCACATTTTGGCAGAGG - Intergenic
1049166869 8:141131516-141131538 CAGTGACCACATGTGGCCAGTGG - Intronic
1049549266 8:143249292-143249314 CAGGGACCACACGTGCCCAGTGG - Intronic
1050135521 9:2459507-2459529 AAGAGACCTCACGAAGGCAGGGG + Intergenic
1051566686 9:18507797-18507819 CAGAGAACTCACCCTGGCAGGGG + Intronic
1054176322 9:61877576-61877598 CAGACACCACACGGGGGGAGAGG + Intergenic
1054661217 9:67703232-67703254 CAGACACCACACGGGGGGAGAGG - Intergenic
1056306359 9:85294630-85294652 CAGGGTCCACACCTGGGCAGTGG + Intergenic
1056805784 9:89727598-89727620 GAGTGACCACAGGCTGGCAGGGG + Intergenic
1060433001 9:123566447-123566469 CACAGCCCACAAGTTGTCAGGGG - Intronic
1185774787 X:2793820-2793842 CCCAGCCCTCACGTTGGCAGTGG - Intronic
1187101394 X:16196521-16196543 CAGAGACCACATGGTGAGAGAGG - Intergenic
1188317460 X:28692033-28692055 CAGAGACCACATGATGAGAGAGG + Intronic
1199499414 X:148493758-148493780 GAGAGACCACAGCTTGGAAGAGG - Intergenic
1200038978 X:153352300-153352322 CAGAGAACACACGTTTGAACAGG - Exonic
1200800569 Y:7383482-7383504 CAGAGTCCAGGCATTGGCAGTGG - Intergenic
1200864279 Y:8026057-8026079 GAGTGACCTCATGTTGGCAGTGG - Intergenic
1202195398 Y:22295201-22295223 CTGAGAGCACAAGTAGGCAGGGG - Intergenic
1202275813 Y:23118659-23118681 CACAGACCTCACCATGGCAGAGG + Intergenic
1202290215 Y:23302032-23302054 CACAGACCTCACCATGGCAGAGG - Intergenic
1202428807 Y:24752378-24752400 CACAGACCTCACCATGGCAGAGG + Intergenic
1202441984 Y:24917711-24917733 CACAGACCTCACCATGGCAGAGG - Intergenic