ID: 999257397

View in Genome Browser
Species Human (GRCh38)
Location 5:150217187-150217209
Sequence GCTTATCACTGAGCCCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999257397 Original CRISPR GCTTATCACTGAGCCCTCCT TGG Intronic
902257093 1:15196951-15196973 TCTTATCACTCAGCCCTCCAGGG + Intronic
906296089 1:44650018-44650040 GCTTATGCCTGAGCCTGCCTGGG + Intronic
912033101 1:105274565-105274587 GCCTATCCCTGACCCCACCTGGG - Intergenic
915663948 1:157427774-157427796 CCTTCTCAGTGAGGCCTCCTTGG - Intergenic
920084014 1:203401334-203401356 TCTGATAGCTGAGCCCTCCTTGG + Intergenic
920751376 1:208680692-208680714 GCTTTGCAATGGGCCCTCCTTGG + Intergenic
923557947 1:235015862-235015884 GCTTTCCACTGAGTCCTCTTGGG - Intergenic
1066147639 10:32577891-32577913 GCCTATTACTGAGCCCTAATGGG - Intronic
1069770974 10:70899703-70899725 GGTTATCACTCAGTCCTGCTGGG - Intergenic
1069792078 10:71029238-71029260 GCCAATGACTGAGCCCTCCATGG - Intergenic
1072741384 10:97912056-97912078 GCTCATCACTGAACCTTCCTGGG + Intronic
1073455160 10:103632310-103632332 GCTGATGCCTGAGCCCTTCTGGG + Intronic
1077073421 11:688509-688531 GCGTGTCACTGAGCCCAGCTGGG + Intronic
1078492775 11:11784811-11784833 GCAGATCACTGAGCCCGCCAAGG - Intergenic
1079291719 11:19194110-19194132 GATTAACACTAAGCCCTCCTGGG + Intronic
1083694957 11:64436601-64436623 GGTTATCCCTGAGGTCTCCTTGG + Intergenic
1086885306 11:92198649-92198671 GCTTATCAGTGAACCATGCTTGG + Intergenic
1089125694 11:116174938-116174960 CCTCAACACTGAGCACTCCTGGG + Intergenic
1089912341 11:122114049-122114071 GATTAACACTGCTCCCTCCTGGG + Intergenic
1090544385 11:127747068-127747090 GCTCAACACTGAGCCCTCCTAGG - Intergenic
1094162014 12:27401113-27401135 GCATATCACTGGGCTCCCCTCGG - Intronic
1102007072 12:109595855-109595877 GCTTTGCACTGAGCCCCCTTAGG + Intronic
1102177137 12:110884318-110884340 GCCTCTCACAGAGCCTTCCTAGG - Intronic
1103983514 12:124752048-124752070 GCTTACCACAGTGCCTTCCTTGG + Intergenic
1104279843 12:127366422-127366444 GATAATCACTGGGCCCTCATAGG + Intergenic
1105965926 13:25384873-25384895 GCTTTTCACTGCCTCCTCCTGGG - Intronic
1112326599 13:98446032-98446054 GCTGCTCTCTGTGCCCTCCTGGG + Intronic
1112438459 13:99408260-99408282 GCTGGTCACTGGGTCCTCCTGGG + Intergenic
1115013317 14:28577432-28577454 GCTGAACACTGAGTCCTGCTAGG - Intergenic
1115859755 14:37671158-37671180 TCTTATGACTGAGGCATCCTGGG - Intronic
1116085938 14:40237706-40237728 GCTTTTCTCTGACCACTCCTGGG + Intergenic
1116961977 14:50976193-50976215 ACTCATCACAGAGCCCTTCTTGG - Exonic
1118841059 14:69511998-69512020 ATTTATCACTGAGCCCCTCTGGG + Intronic
1121186109 14:91971271-91971293 GCTTATCATTGAGCACTCTTAGG + Intronic
1121408281 14:93732641-93732663 GCTGATCACTGTGCCCGCCAGGG - Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1126337185 15:47599045-47599067 GCTTATCGATGAGCATTCCTGGG + Intronic
1129203249 15:74018881-74018903 TCTTGTCACGGAGCCCTTCTGGG + Intronic
1129708341 15:77807280-77807302 TCTAATCAGTGAGCTCTCCTGGG + Intronic
1131545503 15:93312703-93312725 GCCTGTCAGTGAGCACTCCTGGG + Intergenic
1132502990 16:292871-292893 CCTCCTCACTGCGCCCTCCTTGG - Intronic
1148649148 17:49237192-49237214 GTTTATTACAGAGCCGTCCTTGG - Intergenic
1149977464 17:61280395-61280417 GGTTATCACTGAGTCCAACTTGG + Intronic
1152771440 17:82172096-82172118 CCTGATCACTGAGCCCTTCCTGG - Intronic
1156215465 18:34993658-34993680 GCTCATCACAGACCCCTCTTTGG - Intronic
1156680551 18:39583450-39583472 CCTTATCAATGAGTCCTCCCTGG - Intergenic
1159021927 18:63150386-63150408 GCTTTTCTTTCAGCCCTCCTGGG - Intronic
1163406491 19:17126231-17126253 TCTTCTCACCCAGCCCTCCTTGG + Intronic
1164591010 19:29506887-29506909 GCAGATCATTGAGCCCTTCTAGG + Intergenic
1165055924 19:33176400-33176422 GTTTCTCACTGACCCCTTCTGGG - Intergenic
1165101569 19:33441517-33441539 GCTCCTCACTCAGCCCTCCAGGG - Intronic
1165135870 19:33668312-33668334 GCCTAACACTCTGCCCTCCTTGG + Intronic
1166599051 19:44077876-44077898 GCTCCTCCCTGACCCCTCCTCGG + Intronic
1167321469 19:48799535-48799557 ACTTAGCACTGAGCCCTGCACGG + Intronic
925013667 2:505108-505130 CCTTGTCACTGGGCACTCCTGGG + Intergenic
925907169 2:8546338-8546360 GGTTTGCACTGAGCCCACCTTGG + Intergenic
926696256 2:15771732-15771754 GCCCATCACTGTGCCCTGCTGGG - Intergenic
926905142 2:17798623-17798645 GCTAATCAATGAACTCTCCTGGG - Intronic
928430800 2:31217010-31217032 GCTTATCACTGAGGCCTTATGGG - Intronic
935213726 2:100959438-100959460 GATTATCACGGTGCTCTCCTAGG + Intronic
942067867 2:172288832-172288854 GCTTGCCACTGAGTCATCCTGGG + Intergenic
942828000 2:180203912-180203934 ACTTATCACTGGGCCATCCTGGG + Intergenic
947048061 2:226010388-226010410 GGTTATTGCTGAGCTCTCCTGGG + Intergenic
947824028 2:233092196-233092218 GCTTATCAGGGAGCCGTCCCAGG + Intronic
947997182 2:234537939-234537961 ACTTGTCATTGAGCCTTCCTTGG + Intergenic
1168851262 20:978647-978669 ACTTGTCTCTGAGCCCTGCTGGG - Intronic
1169354695 20:4896938-4896960 GCTGCTCCCTCAGCCCTCCTGGG + Intronic
1169723230 20:8701431-8701453 CCTTCTCAGTGAGGCCTCCTGGG + Intronic
1171164660 20:22959171-22959193 GGTTATCTCTGAGCCCTCCAAGG - Intergenic
1172887838 20:38243388-38243410 CCTTTTCACTTAGCCCTCTTGGG + Intronic
1174167475 20:48595376-48595398 GCTCATGCCTGAGTCCTCCTAGG - Intergenic
1175890936 20:62315629-62315651 GCTGACCACTGTGCCCTCCTGGG + Intronic
1176172176 20:63700986-63701008 GCTGAGGACTGAGGCCTCCTGGG + Intronic
1183268957 22:36848962-36848984 GCTTATCCTTGAGCCTTCTTCGG + Intergenic
1183382435 22:37496881-37496903 GCTAATCACTGAGCCCGCTTCGG + Intronic
1184016039 22:41786393-41786415 GCTTATAACTGAGAAGTCCTGGG + Intronic
1184211152 22:43036291-43036313 GCTAAGCAGTGAGCCCTGCTGGG - Intergenic
952850006 3:37720008-37720030 CCATGTCACTGAGCCCTCCCTGG - Intronic
953021012 3:39113326-39113348 GCTTATCACAGAGCACCCTTGGG + Intronic
953761911 3:45695061-45695083 TCTCCTCACTGAGCCCTCCCTGG - Intronic
957389514 3:79545845-79545867 GCTTAACTCTAAACCCTCCTGGG - Intronic
958879675 3:99655158-99655180 GCATTTCTCTGAGCCCTCCCTGG + Intronic
961992234 3:131204364-131204386 GCTTCTCACAGCCCCCTCCTTGG - Intronic
963847945 3:150178889-150178911 GCCTATCACTGAGGCCACCATGG + Intergenic
974840268 4:67291335-67291357 GATTAACAATGAGCTCTCCTTGG + Intergenic
989236043 5:39149729-39149751 GTTTCTCACTGACTCCTCCTTGG + Intronic
990616506 5:57513905-57513927 ACTTATCAATCAGCTCTCCTGGG - Intergenic
991639678 5:68739844-68739866 CCTTCTCACTCAGCCCTCCCTGG + Intergenic
991970272 5:72134331-72134353 CCTTCTCACTGGGCCCTCCTTGG - Intronic
997318116 5:132954875-132954897 GCTTAACACTTAGCCATCCGTGG - Intronic
998503145 5:142651123-142651145 GGTTATCACTGCACCCTTCTCGG - Intronic
999257397 5:150217187-150217209 GCTTATCACTGAGCCCTCCTTGG + Intronic
999288928 5:150410882-150410904 TCTGAACACTGAGCCCACCTGGG + Intronic
1001271183 5:170312845-170312867 GCTTGTCACTGAGCAATCCTAGG - Intergenic
1005845863 6:29777923-29777945 GCTAAAAACTGAGGCCTCCTGGG + Intergenic
1007179097 6:39915614-39915636 GGTTATCCCTGTGCCCACCTGGG - Intronic
1007348630 6:41251932-41251954 GCTTAGCCCTGTGCCCTCCAGGG - Intergenic
1007423368 6:41733095-41733117 TCTTGGCCCTGAGCCCTCCTGGG - Intronic
1008901148 6:56617547-56617569 ACTTATTCCTGAACCCTCCTTGG - Intronic
1010451344 6:76007010-76007032 TCTTATTACTGAGCTCTCCAAGG + Intronic
1010494186 6:76513643-76513665 GGTTAACACTTAGCCCTCCACGG - Intergenic
1014200132 6:118600277-118600299 GCCTGTCCCTGAGCCTTCCTGGG + Intronic
1015635230 6:135268233-135268255 CCTAAACACTGAGCCCTCCTAGG + Intergenic
1015954737 6:138587927-138587949 GATTATCTCTAAGCCCTTCTTGG - Intronic
1017569578 6:155730508-155730530 GCTTATAACTGATATCTCCTAGG - Intergenic
1018188885 6:161291519-161291541 GCTGCTCCCTGAGCCCTCCCAGG + Intergenic
1024086251 7:45894179-45894201 CCTTAACACTGTGCCCTGCTTGG + Intergenic
1026848496 7:73710773-73710795 GCTCAGCACTGACCCCACCTCGG + Intronic
1029228359 7:99045597-99045619 GCTCATCACCAAGCACTCCTGGG - Intronic
1031836461 7:126685916-126685938 GCTTTTCCCTGGGCCCTCGTGGG + Intronic
1032204828 7:129853188-129853210 GCTTATCACCCTGCACTCCTGGG - Intronic
1032479451 7:132234899-132234921 GCTGGTCACTGATCTCTCCTAGG - Intronic
1033127988 7:138721577-138721599 GCGTGTCACTGAGGACTCCTTGG - Intronic
1033717761 7:144020556-144020578 GCTTATTAGTGAGTCCTCATGGG - Intergenic
1033810032 7:145001752-145001774 GCTTATCTTTGAGCCATCCCAGG + Intergenic
1034677809 7:152903926-152903948 GCTGATCCCTGTGGCCTCCTGGG - Intergenic
1035934995 8:3826740-3826762 GCTTATAAGTGAGTCCTCCTAGG - Intronic
1036051695 8:5206058-5206080 GCTTCTCCCTCAGCCCTCTTTGG + Intergenic
1039790068 8:40868551-40868573 GGCTGCCACTGAGCCCTCCTTGG - Intronic
1040725905 8:50381031-50381053 GCTTATCACTGAGCTGTCCATGG + Intronic
1041374311 8:57197089-57197111 GTTTGTCACTGTGCCCACCTAGG + Intergenic
1042209341 8:66363418-66363440 GCATATTAATGAGCCCTGCTTGG - Intergenic
1044604891 8:94039879-94039901 GTTTCTCACTGGCCCCTCCTTGG - Intergenic
1046015756 8:108603349-108603371 CCTTATCACTGACTCCTCCAGGG + Intergenic
1048033930 8:130658849-130658871 GCTTATCACTCCTCTCTCCTCGG - Intergenic
1048496868 8:134942679-134942701 GCTTAGCGCTGAGCCCGCCTAGG + Intergenic
1048807187 8:138251768-138251790 GATTAGCACTGGGTCCTCCTGGG - Intronic
1049097104 8:140555280-140555302 CCTGAACACTGAGCCCTCCAGGG - Intronic
1049577654 8:143397162-143397184 GCTCTTCCCAGAGCCCTCCTGGG + Intergenic
1054893874 9:70285193-70285215 TCTTAGCTGTGAGCCCTCCTAGG - Intronic
1060772885 9:126345596-126345618 GGTTATCAGAGAGACCTCCTGGG - Intronic
1061779705 9:132988387-132988409 GCCCAGCACTGAGCCCGCCTTGG + Exonic
1186778803 X:12892572-12892594 GTTTATCACTGCCCCCTCTTGGG + Intergenic
1190548697 X:51556814-51556836 ACTTTTCTCTGAGCTCTCCTGGG + Intergenic
1193135049 X:77961698-77961720 GCTTCCCACTGACTCCTCCTGGG + Intronic
1195888179 X:109663582-109663604 GATTATCATTGAGCCTTTCTTGG - Intronic
1199315349 X:146370774-146370796 CTTTATCACTGAGCCTTTCTTGG + Intergenic
1200079743 X:153570314-153570336 GGTCAGCACTGAGCCCACCTGGG - Intronic
1200690944 Y:6306082-6306104 CCTGAACACTGTGCCCTCCTGGG - Intergenic
1200951487 Y:8903206-8903228 ACTTAACACGGTGCCCTCCTAGG + Intergenic
1201044328 Y:9868634-9868656 CCTGAACACTGTGCCCTCCTGGG + Intergenic
1202161462 Y:21940106-21940128 ACTTAACACGGTGCCCTCCTAGG - Intergenic
1202229894 Y:22646267-22646289 ACTTAACACGGTGCCCTCCTAGG + Intergenic
1202313262 Y:23549898-23549920 ACTTAACACGGTGCCCTCCTAGG - Intergenic
1202557540 Y:26120696-26120718 ACTTAACACGGTGCCCTCCTAGG + Intergenic