ID: 999258185

View in Genome Browser
Species Human (GRCh38)
Location 5:150221559-150221581
Sequence CAGGGCAGAGAGGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2493
Summary {0: 1, 1: 1, 2: 34, 3: 272, 4: 2185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999258185_999258192 3 Left 999258185 5:150221559-150221581 CCTCCCTCCTCCTCTCTGCCCTG 0: 1
1: 1
2: 34
3: 272
4: 2185
Right 999258192 5:150221585-150221607 TGCTGTTCCTGAGTCAGTGCTGG 0: 1
1: 0
2: 4
3: 21
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999258185 Original CRISPR CAGGGCAGAGAGGAGGAGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr