ID: 999259495

View in Genome Browser
Species Human (GRCh38)
Location 5:150229260-150229282
Sequence TTAAGCCATCTGGAGAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 202}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999259495_999259504 -8 Left 999259495 5:150229260-150229282 CCCAAATTCTCCAGATGGCTTAA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 999259504 5:150229275-150229297 TGGCTTAAGCCTGGGGCTGGGGG 0: 1
1: 0
2: 7
3: 50
4: 521
999259495_999259507 13 Left 999259495 5:150229260-150229282 CCCAAATTCTCCAGATGGCTTAA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 999259507 5:150229296-150229318 GGACTGTGCTCAGACCAAACGGG 0: 1
1: 0
2: 1
3: 9
4: 121
999259495_999259502 -10 Left 999259495 5:150229260-150229282 CCCAAATTCTCCAGATGGCTTAA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 999259502 5:150229273-150229295 GATGGCTTAAGCCTGGGGCTGGG No data
999259495_999259506 12 Left 999259495 5:150229260-150229282 CCCAAATTCTCCAGATGGCTTAA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 999259506 5:150229295-150229317 GGGACTGTGCTCAGACCAAACGG 0: 1
1: 0
2: 0
3: 10
4: 143
999259495_999259503 -9 Left 999259495 5:150229260-150229282 CCCAAATTCTCCAGATGGCTTAA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 999259503 5:150229274-150229296 ATGGCTTAAGCCTGGGGCTGGGG 0: 1
1: 0
2: 2
3: 37
4: 405
999259495_999259508 22 Left 999259495 5:150229260-150229282 CCCAAATTCTCCAGATGGCTTAA 0: 1
1: 0
2: 2
3: 17
4: 202
Right 999259508 5:150229305-150229327 TCAGACCAAACGGGATGCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999259495 Original CRISPR TTAAGCCATCTGGAGAATTT GGG (reversed) Intronic
903840948 1:26239748-26239770 TTAAGCCAACTGTAGAATGAAGG - Exonic
904486782 1:30830150-30830172 TTAAGCCATAGGAAGAAGTTTGG + Intergenic
905662343 1:39737268-39737290 GTAAGCCTTCTGGAAGATTTGGG - Intronic
907977903 1:59450140-59450162 TTAAGTAATCTGGAGAATACAGG - Intronic
910862961 1:91761277-91761299 TTTGACCATCTGGAAAATTTTGG - Intronic
912580660 1:110718188-110718210 GAAAGCCATTTGGAGAAGTTTGG - Intergenic
915500987 1:156317491-156317513 TTCCTCCATCTGGAGAATTCGGG + Exonic
916392552 1:164346469-164346491 TTGAGCCATGGGGATAATTTAGG + Intergenic
917781839 1:178405476-178405498 TGGATCCATCTGGATAATTTAGG - Intronic
918331084 1:183461127-183461149 TCAAGCAATCTGGAGAATATCGG + Intergenic
921762461 1:218931937-218931959 AAAAGCAATCTGAAGAATTTTGG - Intergenic
924150580 1:241125140-241125162 TTAAGCCAACTGGAGATTTGTGG + Intronic
924831833 1:247604311-247604333 CAAAGTCATCTGGAGAATGTCGG - Intergenic
1063867038 10:10376365-10376387 TGAAGGCATCAGGAAAATTTTGG + Intergenic
1064368123 10:14726624-14726646 TCAAGCCATTTGCAGAAATTTGG - Intronic
1068105824 10:52614456-52614478 TTAAGATATCTAGAAAATTTAGG + Intergenic
1070523417 10:77274737-77274759 TACAGCCTTCTGGAGAATGTAGG + Intronic
1071116071 10:82221949-82221971 GTAGGCCACCTGGAGGATTTGGG - Intronic
1071682240 10:87717922-87717944 ATAATCCATCTGGATGATTTAGG + Intronic
1075284263 10:121169506-121169528 CTAAGCCTTCTGGAAAACTTTGG + Intergenic
1076299412 10:129413522-129413544 TTAAGCCCTCTGCACAATTTGGG + Intergenic
1076466360 10:130684877-130684899 TTTAGCCAGCTGGATAATGTGGG + Intergenic
1078773761 11:14375262-14375284 TTGAGCCAGCTGGAGAATAATGG + Intergenic
1078960415 11:16260790-16260812 TTAAGCTATATGAAGGATTTTGG - Intronic
1082730319 11:56788709-56788731 CTAAGCCATTTGCAAAATTTAGG - Intergenic
1084097277 11:66919946-66919968 TCAAGCCATTTGCAGAAGTTTGG - Intronic
1084290134 11:68159142-68159164 TTACGCCAACTGAAGATTTTCGG + Exonic
1089643054 11:119860253-119860275 ATGAGACATCTGAAGAATTTAGG - Intergenic
1089957444 11:122584826-122584848 ATGAGTCATCTGGAGAATATGGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1093529397 12:20143047-20143069 TTAGCCCATCTGCAGAATTTTGG + Intergenic
1098576317 12:72046905-72046927 TTAGACCATCTGGAGACCTTGGG - Intronic
1098789531 12:74804119-74804141 TTTTGCTATCTGGAGAATGTTGG - Intergenic
1098845778 12:75534037-75534059 TTAGGTCATCTGCAGAAATTGGG - Intergenic
1099771189 12:87059403-87059425 TCAAGCAAGCTGGAGTATTTGGG - Intergenic
1100588159 12:95998599-95998621 TTAACCCAACTGAAGAATTTAGG - Intergenic
1100635750 12:96433141-96433163 TTCAGGCATCTGGGGAATTGAGG + Intergenic
1100929180 12:99586012-99586034 TGAAGCCAGCTGCAGAAATTTGG - Intronic
1101194220 12:102366201-102366223 TTAAGCCATCTGGATATGTTGGG - Intergenic
1102122603 12:110454159-110454181 TCAAGCCATTTGGAGAGTTCAGG - Intronic
1104193984 12:126513037-126513059 TTCAGCCAATGGGAGAATTTTGG - Intergenic
1108832329 13:54495564-54495586 TAATGCAGTCTGGAGAATTTAGG + Intergenic
1110682883 13:78337230-78337252 TTAAGTCTTCTGGAGAAATAAGG - Intergenic
1114014209 14:18411297-18411319 ATAAGCCATAAAGAGAATTTTGG + Intergenic
1114290660 14:21285794-21285816 AAAAGCCATTTGGAGACTTTTGG + Intergenic
1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG + Intergenic
1115139929 14:30159115-30159137 TTTAGCCAGCTGGTGACTTTGGG - Intronic
1115428898 14:33293145-33293167 TGCAGCCAGCTGGAGAAATTAGG - Intronic
1115580454 14:34753348-34753370 TTAAGCACTCAGGAGAATGTAGG - Exonic
1116440240 14:44942783-44942805 TTATCCCATCTGGGGGATTTAGG - Intronic
1118194827 14:63615317-63615339 TTAAGACATCTGGTGACTTAGGG - Intronic
1119510038 14:75203837-75203859 TTGAGCCATCTGGGGCAGTTGGG + Intergenic
1119519549 14:75276100-75276122 TTAAGCTATCTGGAGGAAATAGG + Intergenic
1120378190 14:83736537-83736559 TTAGGGCATCTGGAAAAGTTAGG + Intergenic
1121912738 14:97806738-97806760 TTAAGGCATCTGGAGATGCTGGG + Intergenic
1122469441 14:101956233-101956255 TTAATCCATCTGGTGGATCTGGG + Intergenic
1123219361 14:106842033-106842055 GGAAGCCGTCTGGAGAATATAGG - Intergenic
1125107855 15:35995070-35995092 TGGAGCCATCTGGAAAAATTGGG - Intergenic
1126521826 15:49604539-49604561 TTAATCTATCTGGAGTTTTTTGG + Intronic
1131793186 15:95987172-95987194 TTTAGGCATCTGGAGAAGATTGG + Intergenic
1134539626 16:15054452-15054474 TTCAGCCGCCTGAAGAATTTAGG - Intronic
1134822322 16:17256861-17256883 TCAAGCCAGCTGCAGAATTGGGG - Intronic
1134831685 16:17328901-17328923 TTCAGCCATCTGGAGCGTTTTGG - Intronic
1141471795 16:84243689-84243711 TTGAGCCCCCTGGATAATTTGGG + Intergenic
1148259507 17:46168073-46168095 TTGACCCAGCTGGTGAATTTTGG - Intronic
1150900079 17:69264009-69264031 TTTAGCCATCTGGGTACTTTTGG + Intronic
1151054423 17:71014933-71014955 TTAAGCAACGTGGATAATTTAGG + Intergenic
1155424609 18:25693963-25693985 TTAAGTCATTTGGAGAAGATGGG + Intergenic
1155692039 18:28636339-28636361 TTAAACCATCTTGAGAAAATGGG + Intergenic
1155736163 18:29224921-29224943 TTAAGCCATCTGGTTATTTGAGG - Intergenic
1156035033 18:32756366-32756388 TTAAGCCACTTGGAGACTTTAGG + Intronic
1156760969 18:40589934-40589956 ATAAGCCAGCTGAAAAATTTAGG - Intergenic
1156785413 18:40907337-40907359 TTAAGCCATATGAAAAATTATGG - Intergenic
1159892376 18:73964718-73964740 TCAAGCCAGCTGCAGAAATTTGG - Intergenic
1165087889 19:33364020-33364042 TGAAGCCCTCAGGAGACTTTGGG - Intergenic
925844685 2:8024652-8024674 TTGAGCCATCTAGAGAATAGTGG + Intergenic
926905130 2:17798469-17798491 TTGAGCCACCTGGAGAATACTGG + Intronic
927814992 2:26207487-26207509 TAAAGCCATCATGAAAATTTTGG - Intronic
928008561 2:27585156-27585178 TTTGGCCATCAGGTGAATTTTGG + Intronic
928572718 2:32625275-32625297 AGAAGCCTTCTGGAGAATATTGG - Intergenic
929132079 2:38586318-38586340 TTAAATCATCTGAAGAATTGTGG + Intronic
929456161 2:42067514-42067536 TAAGGCCACCTGGAGAACTTAGG + Intergenic
929987153 2:46745909-46745931 TTATGCCATCTGGAGAATGAAGG - Intronic
930243628 2:48961250-48961272 TGACCCCATCTGGATAATTTCGG - Intergenic
930258257 2:49116192-49116214 TTAAGCCATATTGGGAAATTTGG + Intronic
931088678 2:58862791-58862813 TTAAGTCATGTGGAGAACCTGGG + Intergenic
931947479 2:67326061-67326083 TGAATTCAACTGGAGAATTTTGG - Intergenic
932552542 2:72785820-72785842 TTAAGCCAGCTGCAGAAATTTGG - Intronic
932806108 2:74784831-74784853 TTAAGCAAGATGGAGAATATAGG + Intergenic
933008890 2:77031467-77031489 TTTAGCCATGTGGAAAAATTAGG - Intronic
933573061 2:84036119-84036141 TTAGGCCATTTGGAGCACTTTGG + Intergenic
934589519 2:95533680-95533702 TTTAGCGAAATGGAGAATTTGGG - Intergenic
935448184 2:103179009-103179031 TTATGTCATCTGGAGTATATGGG + Intergenic
936549452 2:113423381-113423403 CTAAGGCAACTGGATAATTTAGG + Intergenic
940495674 2:154424944-154424966 TGAAGCCATCTAGAAAACTTTGG + Intronic
944879703 2:203999925-203999947 TTAGGTGCTCTGGAGAATTTGGG + Intergenic
945427035 2:209719086-209719108 TTATGCCATCTTGAGAAATGAGG + Intronic
948356965 2:237385862-237385884 TTAGCTCATCTGGAGGATTTGGG + Intronic
1170024586 20:11875047-11875069 TTAAACCATTAGGAAAATTTGGG + Intergenic
1170817389 20:19725640-19725662 GTAAGCCATCTGAACAACTTTGG - Intergenic
1171933051 20:31245781-31245803 TTCAGTCAGCTGCAGAATTTTGG + Intergenic
1180438706 22:15342103-15342125 ATAAGCCATAAAGAGAATTTTGG + Intergenic
1180607437 22:17069653-17069675 TTAAGGCATCTGAAATATTTTGG - Intergenic
1181235233 22:21444529-21444551 TAAAGCCATCTGGTCATTTTTGG + Intronic
1182289264 22:29266048-29266070 TGAAACCATCTGGAGCATTAAGG - Intronic
1182673043 22:32013916-32013938 TTAACTTATTTGGAGAATTTGGG + Intergenic
1185356413 22:50374351-50374373 TTAATCCATATGTTGAATTTTGG - Intronic
951970582 3:28440522-28440544 TGCAGCCTTCTGGAGAACTTTGG + Intronic
953462121 3:43089727-43089749 TTAAATCATCTGCAGACTTTGGG - Intronic
953729047 3:45429550-45429572 TTGGGCCACCTGGATAATTTAGG + Intronic
955823977 3:62925626-62925648 TTAAGCGATTTGGAGAAGTCAGG - Intergenic
956446904 3:69334516-69334538 TTAAATGATCTGGGGAATTTAGG + Intronic
957511111 3:81188612-81188634 TTAAATCATCTGGAGCAATTTGG + Intergenic
957727206 3:84083011-84083033 TTAAGCCAAATGGAAAATTCCGG - Intergenic
958563749 3:95781297-95781319 TCAAGCCAGCTGTAGAAATTTGG + Intergenic
959420363 3:106120749-106120771 TTTAGGCTTCAGGAGAATTTAGG - Intergenic
960087112 3:113603256-113603278 TTAAGTCTTCTGGGAAATTTGGG - Intronic
960192971 3:114729594-114729616 AGAAGCCATCTTGGGAATTTGGG + Intronic
960652875 3:119971126-119971148 TCAATCCATTTGGGGAATTTTGG - Intronic
961991855 3:131200662-131200684 TTGAGGCATCTGGTGAGTTTTGG - Intronic
963020663 3:140870035-140870057 TTAAGTCATCTTGAAGATTTGGG + Intergenic
963294368 3:143529347-143529369 TTAATTCATCTGAAGCATTTTGG + Intronic
963421264 3:145063744-145063766 GTAAGCCATGTGGATATTTTTGG + Intergenic
963469793 3:145726035-145726057 ATAAGCCATGTTAAGAATTTAGG - Intergenic
964777371 3:160292973-160292995 TCACTCCATCTGGAGAATTTAGG + Intronic
968039667 3:195578657-195578679 GAAAGCCCCCTGGAGAATTTTGG + Intronic
968123558 3:196142715-196142737 TTAAGCCTTCTTGAAGATTTGGG + Intergenic
968249282 3:197191287-197191309 CTAAGACATCTGGAGACTCTGGG + Intronic
970785174 4:19787811-19787833 TTAAGCAATTTGGAGCAATTTGG + Intergenic
971643326 4:29163397-29163419 GAAAGCCACCTGGAGAATATGGG + Intergenic
974009440 4:56593562-56593584 TGAGGCCACCGGGAGAATTTGGG + Intronic
974060038 4:57024554-57024576 TTGAGCCATCTGAAGTACTTAGG + Intronic
975573887 4:75844001-75844023 TAAAGAGATCTGGAGAATCTGGG + Intergenic
976986244 4:91302623-91302645 TTAAGCCATGGTGAGAAGTTTGG - Intronic
979366117 4:119825548-119825570 TGAAGGCAGCTGAAGAATTTTGG - Intergenic
980532259 4:134070913-134070935 TTTAGCCATATGGAGAATGTCGG - Intergenic
982293397 4:153802723-153802745 TTAAGCCAGGTGGAAAATTCTGG + Intergenic
982478328 4:155878933-155878955 TTCAGGGGTCTGGAGAATTTTGG + Intronic
982901884 4:161015945-161015967 TTAAGACTTTTGCAGAATTTAGG - Intergenic
984188229 4:176572585-176572607 TTCAGCAATCTGGTAAATTTTGG - Intergenic
984744476 4:183201156-183201178 CCCAGCCATCTGGAGAATGTGGG - Intronic
984789444 4:183601900-183601922 TTCAGCTATTTGGAGAATTATGG - Intergenic
984988800 4:185357525-185357547 CTATGACATCTGCAGAATTTGGG - Intronic
985159893 4:187033838-187033860 TCAAGCCATCTGCAGAAATTTGG + Intergenic
985207856 4:187559704-187559726 TAAAATTATCTGGAGAATTTTGG - Intergenic
986848453 5:11782420-11782442 TTCAGATATCTGGATAATTTAGG - Intronic
987507844 5:18796382-18796404 TGAAACCATCTGGAGTTTTTGGG + Intergenic
989207938 5:38830198-38830220 TCATGACATCTGGAGAATTTGGG + Intergenic
990014010 5:51035619-51035641 TTATGCCATAAGTAGAATTTTGG - Intergenic
990468554 5:56091892-56091914 CTGTGCAATCTGGAGAATTTTGG + Intergenic
991368766 5:65896248-65896270 TAAAGCCATGTTGAGAAATTTGG + Intergenic
993021026 5:82591171-82591193 TTGAGTCATCTGGAGTATTGAGG - Intergenic
996450398 5:123615708-123615730 TTAACCCTTCTTGAAAATTTTGG - Exonic
997042039 5:130267983-130268005 TTCATCCATCTGTAGAATTGAGG - Intergenic
999259495 5:150229260-150229282 TTAAGCCATCTGGAGAATTTGGG - Intronic
999540635 5:152568353-152568375 CAAAGCCATCTGGAATATTTAGG + Intergenic
999903325 5:156111363-156111385 CTAAGCAATGTTGAGAATTTGGG + Intronic
1001683004 5:173572565-173572587 TCAGGGCATCTGGATAATTTAGG + Intergenic
1004715188 6:18210053-18210075 TCCAGCCTTCTGGAGAAATTAGG + Intronic
1004737324 6:18420611-18420633 CCAAGTCTTCTGGAGAATTTGGG + Intronic
1006380991 6:33697088-33697110 TTAAGCCAACTGGGCAATGTGGG + Exonic
1006763507 6:36484589-36484611 TTGATCCATCTGGATTATTTGGG + Intronic
1007437115 6:41822233-41822255 TTCAGCCATGTGGAGAAAATGGG - Intronic
1009268379 6:61586813-61586835 TTCAGGCATGTGGAGAATATGGG - Intergenic
1010162921 6:72879687-72879709 TTGAGACATCTCGAAAATTTAGG - Intronic
1011524858 6:88253534-88253556 TGAAGCCATCTTAAGTATTTTGG + Intergenic
1013491252 6:110647898-110647920 TTAAGCCATCTGGATGGATTTGG - Intronic
1014126691 6:117784035-117784057 TTGAGCCATCTGGAAGACTTGGG - Intergenic
1014266719 6:119286309-119286331 TTAAGACATTCGGAGTATTTGGG - Intronic
1014747011 6:125212617-125212639 TTAAGCCATCTGAAGAATGTAGG - Intronic
1015915311 6:138210191-138210213 TTAAACCATCAGGGTAATTTAGG - Intronic
1017488994 6:154927719-154927741 TTAAGCCATGTGCAAAATTAGGG - Intronic
1020656417 7:10933022-10933044 TCAAGAGATCTTGAGAATTTTGG - Exonic
1020908261 7:14093559-14093581 TTAATACATATGAAGAATTTAGG - Intergenic
1021846453 7:24767733-24767755 TTAAGTTTTCTGCAGAATTTTGG - Intergenic
1023428155 7:40061412-40061434 TTAAGTTATTTGGAGAAATTTGG + Intronic
1023714546 7:43029831-43029853 TGAAGCTATTTGGAGTATTTTGG + Intergenic
1027993455 7:85394633-85394655 TTAAGACTTCTGGAGACTGTTGG - Intergenic
1028273173 7:88818289-88818311 TTATGCCAACTCGAGATTTTTGG - Intronic
1028765711 7:94556728-94556750 TTAAGTAAACTGGTGAATTTGGG + Exonic
1030351435 7:108492634-108492656 TTATGCCATCAGTAGAATCTAGG - Intronic
1030504665 7:110405640-110405662 TTAAGCCATCTGAATCCTTTGGG + Intergenic
1031193507 7:118585430-118585452 TTAAGACATTTGGAGACTGTTGG - Intergenic
1033109578 7:138562470-138562492 AGAAGCCATCTGGAGAATACAGG - Intronic
1035604165 8:918346-918368 TTAAGCCATTCGTAGAATTAGGG + Intergenic
1037006921 8:13793047-13793069 TTTAGCCATCAGGAAAGTTTTGG - Intergenic
1038714594 8:29980493-29980515 TTAAGCCATCCCCAGAATGTGGG - Intergenic
1039435057 8:37554263-37554285 GAAAGCCATCTGGGGAAGTTGGG - Intergenic
1041182175 8:55260232-55260254 TTCAACTAGCTGGAGAATTTTGG - Intronic
1042037042 8:64544821-64544843 TAAAGCAATATGGAAAATTTAGG + Intergenic
1042065377 8:64869247-64869269 TTAAGTCATATGGAGAATGCTGG + Intergenic
1044363675 8:91318149-91318171 TTAAGCCCTCTGGGAACTTTGGG + Intronic
1047171972 8:122502577-122502599 GTATGTCATCTGGAGAAGTTCGG + Intergenic
1048240668 8:132738630-132738652 TTATGCCATATTGAGGATTTGGG - Intronic
1049813782 8:144588577-144588599 CCAAGCCATCTGGAGAAACTCGG + Intronic
1049903491 9:193447-193469 CTAAGGCAACTGGATAATTTAGG - Intergenic
1050016448 9:1238998-1239020 TTAATCCCACTGGAGAATTCTGG - Intergenic
1050074946 9:1853601-1853623 TTAAGACTTCTGGAGACTATTGG + Intergenic
1050364887 9:4864703-4864725 TTAAGCAATCTGAGGATTTTTGG - Intronic
1050436119 9:5612582-5612604 TTAATCCCTCTGGAGAATTTTGG - Intergenic
1050532706 9:6604719-6604741 TGAGGCCACCTGGAGAATTTGGG - Exonic
1053045495 9:34912737-34912759 TTAAGTCCTCTGCAGAATGTTGG - Intergenic
1053387128 9:37701699-37701721 TTAAGCCATATTCAGGATTTTGG + Intronic
1053746498 9:41203741-41203763 CTAAGGCAACTGGATAATTTAGG - Intergenic
1054480766 9:65661481-65661503 CTAAGGCAACTGGATAATTTAGG + Intergenic
1054681847 9:68227537-68227559 CTAAGGCAACTGGATAATTTAGG + Intergenic
1054861651 9:69959943-69959965 TTCAGCCTCCTTGAGAATTTGGG + Intergenic
1055876509 9:80949128-80949150 TTAATTAATCTGGAGAATTCAGG - Intergenic
1056766365 9:89446957-89446979 GGAAGGCATCTGGAGAATTGAGG - Intronic
1056781504 9:89554529-89554551 GTAAGCCATCTGGGGACTTCAGG + Intergenic
1056979546 9:91296432-91296454 TTCAGGCAACTGAAGAATTTGGG - Intronic
1057337121 9:94165030-94165052 TTAAGCCATGGGTAGGATTTGGG - Intergenic
1061682360 9:132249299-132249321 GGAAGCCATCTGGAGCACTTTGG - Intergenic
1202782628 9_KI270718v1_random:14516-14538 CTAAGGCAACTGGATAATTTAGG - Intergenic
1185956560 X:4497422-4497444 TTGAGCAATTTGGAGCATTTAGG + Intergenic
1188571783 X:31595308-31595330 TTAATCCATCTGAAGCATTTGGG - Intronic
1189555497 X:42140765-42140787 TTAATCCATTTGGGGAAGTTTGG + Intergenic
1192307138 X:69973299-69973321 TTCAGCCATCTAGAGAACTTGGG - Intronic
1195280041 X:103323531-103323553 TGAAGCCATTTGGAGTATTAGGG - Intergenic
1199531316 X:148850879-148850901 TGCAGCCATCTGGGGAATCTGGG - Intronic
1200367017 X:155677398-155677420 TTAACCCAGTTGGTGAATTTAGG + Intergenic
1202095642 Y:21245993-21246015 GAAAGCCATCTGGGGAATATGGG - Intergenic