ID: 999259850

View in Genome Browser
Species Human (GRCh38)
Location 5:150231323-150231345
Sequence CTGATTGAAGCCATAAGCAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999259850_999259853 27 Left 999259850 5:150231323-150231345 CCATTGCTTATGGCTTCAATCAG 0: 1
1: 0
2: 1
3: 8
4: 144
Right 999259853 5:150231373-150231395 TTTCCGCACTGTAAGGCAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92
999259850_999259851 20 Left 999259850 5:150231323-150231345 CCATTGCTTATGGCTTCAATCAG 0: 1
1: 0
2: 1
3: 8
4: 144
Right 999259851 5:150231366-150231388 TTTCCTGTTTCCGCACTGTAAGG 0: 1
1: 0
2: 0
3: 12
4: 129
999259850_999259855 29 Left 999259850 5:150231323-150231345 CCATTGCTTATGGCTTCAATCAG 0: 1
1: 0
2: 1
3: 8
4: 144
Right 999259855 5:150231375-150231397 TCCGCACTGTAAGGCAGAAGGGG 0: 1
1: 0
2: 0
3: 9
4: 97
999259850_999259854 28 Left 999259850 5:150231323-150231345 CCATTGCTTATGGCTTCAATCAG 0: 1
1: 0
2: 1
3: 8
4: 144
Right 999259854 5:150231374-150231396 TTCCGCACTGTAAGGCAGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999259850 Original CRISPR CTGATTGAAGCCATAAGCAA TGG (reversed) Exonic
901270797 1:7952000-7952022 CTGACTGAAACCCTAAGTAATGG + Intergenic
903410602 1:23140350-23140372 CTGCTTGAAGCCACAAGAGATGG - Intronic
904602641 1:31682107-31682129 CTAATTGCAGCCAAAATCAAAGG - Intronic
905537222 1:38731805-38731827 ATAATTGCAGCCAAAAGCAAAGG - Intergenic
906012488 1:42542020-42542042 CTGATTGAGGCCTTAGGCTAGGG - Intronic
906154945 1:43608426-43608448 CTGCTTAAAGCCATAGGCCAGGG - Intronic
907867511 1:58412491-58412513 ACGATTGCAGCCAGAAGCAAAGG + Intronic
909295890 1:73948379-73948401 CTGAATAAAGCCTTAGGCAAAGG - Intergenic
911697573 1:100908492-100908514 CTGATTTTAGTTATAAGCAAGGG + Intronic
915963041 1:160283169-160283191 CTGATAGAAGCCACAGGCAGTGG + Intronic
918677280 1:187303100-187303122 TTGATTGAATCCTTAATCAATGG + Intergenic
923935235 1:238752718-238752740 CTAACTGCAGCCTTAAGCAAGGG - Intergenic
1063684731 10:8225907-8225929 CTCATTGTAGCCATAAAGAAAGG - Intergenic
1063986212 10:11505917-11505939 CTGTTTGAAGGCAGAAACAAAGG - Intronic
1065054049 10:21825318-21825340 CTGAAAGAAGTCAGAAGCAAAGG - Intronic
1066978129 10:42387903-42387925 CTGATTGAAGTCCTTTGCAATGG + Intergenic
1068480487 10:57583551-57583573 CTGATTGAAGTGATAAGACAAGG + Intergenic
1070147221 10:73783525-73783547 CTTATTGCATCCAAAAGCAAGGG - Exonic
1070153120 10:73817497-73817519 CTGATTGAAGCCATCAACAATGG - Exonic
1070681219 10:78450642-78450664 CTGAGAGAAGCCAGATGCAAAGG - Intergenic
1075876444 10:125810208-125810230 TTGATTCAAGCCAAAAGAAATGG + Intronic
1078613153 11:12839878-12839900 CTGGTTGTAGCCTTAAGGAAGGG + Intronic
1080292071 11:30682190-30682212 CTGTGTGAAGACTTAAGCAAGGG + Intergenic
1082297056 11:50453890-50453912 CTCATTGAGGCCAAAGGCAAAGG + Intergenic
1087314233 11:96587436-96587458 CTGAATTAATCCAAAAGCAATGG - Intergenic
1091039787 11:132266213-132266235 CTGGTTGAAGCCTACAGCAAGGG + Intronic
1092887516 12:12937876-12937898 CTCATTGAAGCCACATACAAGGG - Intergenic
1107351689 13:39521196-39521218 CTGATTGAAGCTGTGAGGAATGG - Intronic
1108106960 13:47021021-47021043 TTGATTGAAGTGATAAGCTATGG - Intergenic
1111025345 13:82513745-82513767 CTGATTTAAAAAATAAGCAAAGG + Intergenic
1112759076 13:102672670-102672692 TTGTTGGAAGGCATAAGCAAAGG + Intronic
1112924460 13:104656892-104656914 CTGAATAAAGTCATAAGCCAAGG - Intergenic
1113850767 13:113416448-113416470 CTGACTGAGGCCATAAGCGCTGG + Intergenic
1114176265 14:20323286-20323308 CTGCTTGAAGCCTTAGGCAGTGG - Intronic
1114743115 14:25118563-25118585 GTGAATGAAGTCATAAGCAATGG + Intergenic
1115234408 14:31194760-31194782 CTGATGGAAGCAATAAAAAAAGG + Intronic
1115659977 14:35484119-35484141 TTGATTGAAGCCAGAAGGAGAGG + Intergenic
1118081682 14:62368493-62368515 TTCCTTGAAGCCAGAAGCAATGG - Intergenic
1118616578 14:67578224-67578246 CTGACAGAAGCCATTGGCAAGGG + Intronic
1119439755 14:74620171-74620193 CTGACTGAAGACAACAGCAAAGG + Intergenic
1120601143 14:86511097-86511119 ATGATTTTAGCCCTAAGCAAAGG - Intergenic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1124398659 15:29329507-29329529 CTGAGTGAACCTAGAAGCAAAGG + Intronic
1134113770 16:11532810-11532832 CTAATTGAATAAATAAGCAAAGG - Intergenic
1139254551 16:65528571-65528593 CAGATTGAAATCCTAAGCAAAGG - Intergenic
1144492513 17:15726145-15726167 CTGATTCAAGCAAGAATCAATGG + Intergenic
1144796765 17:17896684-17896706 CAGAATGAAGCCAAAAGCCATGG + Intronic
1144907962 17:18653042-18653064 CTGATTCAAGCAAGAATCAATGG - Intronic
1147195905 17:38766550-38766572 CTGTTTGAGGCCAAAAGCACAGG + Exonic
1158826739 18:61229042-61229064 ATGACTGAAGCCAAAGGCAATGG - Intergenic
1160096779 18:75880506-75880528 CTGACTGAAGCCACAAGAACCGG + Intergenic
1163272309 19:16261695-16261717 GCGGTTGAAGCCATGAGCAAGGG + Intergenic
926869535 2:17398346-17398368 CTGTTTGAAGCCCAAAGTAAAGG + Intergenic
928980593 2:37132066-37132088 CTGATTGAAGTCCTTTGCAATGG - Intronic
929837430 2:45418247-45418269 CTGAATGAAGGCATGAACAATGG + Intronic
932075898 2:68662681-68662703 CTAATTGAAGCTATAAACAGAGG - Intergenic
933166991 2:79087297-79087319 CTGATTGAATCTATATGCGATGG - Intronic
933579090 2:84104618-84104640 ACAATTGAAGCAATAAGCAAAGG - Intergenic
934592606 2:95569541-95569563 CTGAAAGAGCCCATAAGCAATGG + Intergenic
935468449 2:103428333-103428355 CTGGTTTAAGAAATAAGCAAAGG - Intergenic
935530939 2:104231773-104231795 CTGAATGAAGCCACAAGGATAGG - Intergenic
939402356 2:141710784-141710806 CTGTTTGTAGCAATAACCAAAGG - Intronic
940216258 2:151306768-151306790 CTGAGTGAAGATTTAAGCAAAGG - Intergenic
942004620 2:171685609-171685631 GGGAATGAAGCCATAAGCAGGGG - Intergenic
942690039 2:178575408-178575430 GTGATTGAAGCCCAAAGAAAAGG - Exonic
948652137 2:239454587-239454609 GTGCTTGAAGACATTAGCAATGG + Intergenic
1170318178 20:15065305-15065327 CTCAATGAAGACAAAAGCAATGG - Intronic
1174275436 20:49400415-49400437 CTGCTTGCAGCCATAGCCAATGG + Intronic
1174330813 20:49815883-49815905 CTGATTGAAGCCAGGAGCAGGGG - Intronic
1174423608 20:50416644-50416666 CTTCTTGAACCCATAAGCAGGGG - Intergenic
1174521193 20:51131990-51132012 CACATTGAAGCCATTGGCAAAGG + Intergenic
1175863288 20:62161517-62161539 CTGAGTGACGCCATCAGCACGGG + Exonic
1175923464 20:62460896-62460918 CTGAATGAAGCCATAAATTAAGG + Intergenic
1181619586 22:24080797-24080819 TTAATAGAAGCAATAAGCAAAGG - Intronic
1182842394 22:33401943-33401965 AGGATTGAAGGCATCAGCAAGGG - Intronic
1184895173 22:47402586-47402608 CTGTTTGAGGCCCTATGCAAAGG + Intergenic
952609459 3:35190559-35190581 CTGATGGAAGAAATTAGCAAAGG - Intergenic
956550703 3:70455701-70455723 ATGATTGAAGCCATAATAAAAGG + Intergenic
957258296 3:77867216-77867238 CTGATAGACACCATAACCAATGG + Intergenic
958842600 3:99225778-99225800 GTGAAAGAAGCCATATGCAAAGG - Intergenic
960150350 3:114242835-114242857 CCGTTTGAAGCAATAAGCAATGG - Intergenic
962243479 3:133771427-133771449 CTGATTCAAGCAAGAATCAATGG + Intronic
963698710 3:148596979-148597001 CTTATTTAAGCAATGAGCAAAGG + Intergenic
964862383 3:161217213-161217235 TTGAGTGAAGCAATAAGAAATGG - Intronic
965523381 3:169691173-169691195 CTGAGTGAAACCATATTCAAAGG + Intergenic
966625967 3:182017421-182017443 CTGAAAGAAGCCAGGAGCAAGGG - Intergenic
966739061 3:183215062-183215084 CTCATAGAAGCCATGAGCCATGG + Intronic
966934490 3:184696944-184696966 CAGATGAAAGCCATAAGCAGGGG - Intergenic
968131035 3:196192941-196192963 CTGAAGGAAGGCAAAAGCAATGG - Intergenic
968830905 4:2932667-2932689 CTGATTGGGGGCATCAGCAAAGG - Exonic
969557546 4:7923140-7923162 CTCAATTAAGACATAAGCAAAGG + Intronic
970327839 4:14946230-14946252 ATGAAAGAAGCCAGAAGCAAAGG + Intergenic
972347493 4:38204982-38205004 CTGATGGCAGGCATAAACAAAGG + Intergenic
976848512 4:89517572-89517594 TTGAATGAATACATAAGCAAAGG - Intergenic
977662749 4:99609738-99609760 CTGAAGGAAGACATAAGAAACGG + Intronic
978634023 4:110782143-110782165 CTCCGTGAAGCCAAAAGCAACGG - Intergenic
978862345 4:113465547-113465569 CTGATCGAAGCTATCAACAATGG - Exonic
979304102 4:119122338-119122360 AGGAATGAAGCCATTAGCAAAGG - Intergenic
981153761 4:141409812-141409834 ATGATTGAAGAAATAAACAAGGG + Intergenic
982059284 4:151586822-151586844 CTGAATGAAGCCATAGCAAAGGG - Intronic
982714070 4:158788405-158788427 CTGAATAAATCAATAAGCAAAGG + Intronic
983059608 4:163142964-163142986 CTGATTCAAGATAAAAGCAAAGG + Intronic
987620080 5:20329131-20329153 CTCATTGAAGCCCTCAGGAATGG - Intronic
987969819 5:24928306-24928328 CTAACTGAAACCATAAGCCAAGG - Intergenic
988150180 5:27367073-27367095 CCAATTGAAGCCAAAAACAATGG + Intergenic
992344109 5:75858752-75858774 AAGATTGAAGCCATAATAAAAGG - Intergenic
994682450 5:102906171-102906193 CTAATTGAAGACATTAGAAATGG - Intronic
999259850 5:150231323-150231345 CTGATTGAAGCCATAAGCAATGG - Exonic
1000303921 5:159978701-159978723 CTGAATAAGGCCATGAGCAAGGG - Intergenic
1001960583 5:175878372-175878394 TTGATTGAAGCCAGGAGCATTGG - Intronic
1008828758 6:55732001-55732023 CTGATTAAAGATATAATCAAAGG + Intergenic
1009740501 6:67737430-67737452 CTTATCTAAGCCATAAGGAAAGG - Intergenic
1010345677 6:74807797-74807819 CTGAATGAAGACTTCAGCAAAGG + Intergenic
1010655993 6:78511716-78511738 CTGACTGAAGCAGTAAGCAAGGG + Intergenic
1011677555 6:89749724-89749746 CTTATTGATGCCATGAGAAAAGG - Exonic
1014027161 6:116662266-116662288 ATGATCAAAGCGATAAGCAAAGG - Intronic
1015011633 6:128356314-128356336 CTTATTGAAGGTATAATCAACGG + Intronic
1016838483 6:148503067-148503089 CTGATTCAAGGCATTAGGAAAGG - Intronic
1018352130 6:162970865-162970887 CTGACTGAAGTAATCAGCAAGGG + Intronic
1018588789 6:165392922-165392944 CTGACTGAATCCATGAGCACTGG + Intronic
1021035566 7:15794371-15794393 CTGATTGAAGGCACAAGGAAGGG - Intergenic
1022420849 7:30222133-30222155 GTGAATGAAGACAGAAGCAAAGG + Intergenic
1023563974 7:41505205-41505227 TAGATTCAAGCCATAAGAAAGGG - Intergenic
1026336166 7:69395773-69395795 CTAATAGAAACCATAAGCATTGG - Intergenic
1031452311 7:121937274-121937296 CTGTTGGAAGCCAGAATCAAGGG + Intronic
1031614399 7:123864210-123864232 CTCATTAAAGCCATAGGTAAAGG - Intronic
1031695957 7:124854530-124854552 CTGATGGAGGATATAAGCAAAGG + Intronic
1032909355 7:136412111-136412133 CTGCTTGAAGCCATGAGTCAGGG - Intergenic
1034110127 7:148528930-148528952 GTGATTGGAGCCAGAAGCAAAGG - Intergenic
1037210380 8:16378841-16378863 CTGATAGAGAACATAAGCAAGGG + Intronic
1040825410 8:51615065-51615087 CTGATTGAAGTCACAGGAAAAGG - Intronic
1043222317 8:77682431-77682453 CTGGTAGATGCCATAATCAAAGG - Intergenic
1043274132 8:78372219-78372241 CTAATGGAAGCCATAAGCATGGG - Intergenic
1046085695 8:109432195-109432217 CTGAGAGAAGCCATGTGCAAAGG - Intronic
1049315902 8:141967348-141967370 CTGAATGAAGCCATCAACACAGG + Intergenic
1050063151 9:1731430-1731452 CTGATTGAAACCACATGGAATGG - Intergenic
1050868415 9:10534470-10534492 ATAATTGAAGGCAAAAGCAATGG + Intronic
1053208135 9:36205328-36205350 CTGATGGAAGCCATCACCACTGG - Intronic
1057903273 9:98965792-98965814 GAGCTTGGAGCCATAAGCAAAGG - Intronic
1186448676 X:9653932-9653954 ATGAATGAAGCCAGAAGCAGGGG - Intronic
1187714089 X:22084654-22084676 AAGATTGAAGCCATAATAAAAGG - Intronic
1187986913 X:24823728-24823750 CTGTTTGCTGCCTTAAGCAAGGG + Intronic
1188660615 X:32753321-32753343 TTTATTGAAGACATAAGAAAAGG - Intronic
1189754752 X:44259665-44259687 ATGACTGCAGCCATATGCAAAGG + Intronic
1192316471 X:70055664-70055686 CTGATTGAATGAATGAGCAAAGG + Intergenic
1193079014 X:77386899-77386921 GAGATTGAAGCCATAATAAAAGG + Intergenic
1193845976 X:86470863-86470885 CTTATTTTAGCCATTAGCAAAGG - Intronic
1194243751 X:91483683-91483705 GTGATTGAAAATATAAGCAAGGG - Intergenic
1194341375 X:92710341-92710363 CTTATTGAAGCCATGATCCAGGG - Intergenic
1197140280 X:123110279-123110301 CTGAATTATGCCATAACCAAAGG + Intergenic
1197923918 X:131626675-131626697 ATGATTGCAGGCATAAGGAAAGG + Intergenic
1198639629 X:138742466-138742488 CTAATAGATGCCATCAGCAAGGG + Intronic
1200562731 Y:4725046-4725068 GTGATTGAAAATATAAGCAAGGG - Intergenic
1200649726 Y:5827053-5827075 CTTATTGAAGCCATGATCCAGGG - Intergenic