ID: 999261195

View in Genome Browser
Species Human (GRCh38)
Location 5:150239917-150239939
Sequence GGACGAGGACTGGCCCCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999261195_999261200 10 Left 999261195 5:150239917-150239939 CCTGGCGGGGCCAGTCCTCGTCC 0: 1
1: 0
2: 1
3: 9
4: 129
Right 999261200 5:150239950-150239972 AGTCCTCATGCACACTGCCTGGG 0: 1
1: 0
2: 2
3: 19
4: 153
999261195_999261199 9 Left 999261195 5:150239917-150239939 CCTGGCGGGGCCAGTCCTCGTCC 0: 1
1: 0
2: 1
3: 9
4: 129
Right 999261199 5:150239949-150239971 GAGTCCTCATGCACACTGCCTGG 0: 1
1: 0
2: 1
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999261195 Original CRISPR GGACGAGGACTGGCCCCGCC AGG (reversed) Intronic
900624527 1:3602195-3602217 GGAGGAGGAGGGGCCCAGCCCGG - Intronic
900652864 1:3739138-3739160 GGACAGGGACATGCCCCGCCCGG + Intergenic
901845653 1:11980508-11980530 TGGCGGGGACTGGCCCGGCCCGG + Intronic
903373269 1:22850424-22850446 GTACCAGGACTGGGCCTGCCAGG + Intronic
906130434 1:43452384-43452406 GGACGAGGGCTGGCACAGTCAGG - Exonic
906140593 1:43531524-43531546 GGGCGCGGCCTGGACCCGCCCGG - Intronic
911549718 1:99264377-99264399 GGAAGAGGACTGGCCCGCTCAGG + Exonic
917133308 1:171763914-171763936 TGCCGAGGAGTGGCCCCGGCTGG + Intergenic
923722924 1:236482598-236482620 GGACGAGGAGTGGCCCAAGCGGG + Exonic
1063369216 10:5509941-5509963 GGAAGAGCACTGGCCGTGCCGGG + Intergenic
1065198619 10:23291655-23291677 GGACCAGGACGGGCAGCGCCAGG + Intronic
1069691281 10:70354583-70354605 GGAGGAGGCCTGGCCCCTCTAGG - Intronic
1070032786 10:72692796-72692818 GGACGAGGGGCGGCCCCGCCGGG - Intronic
1075894212 10:125980660-125980682 TGACGTGGAATGGCCCCGCATGG + Intronic
1077222092 11:1422296-1422318 GGAGGAGGGCAGGCCCCACCTGG - Intronic
1077250087 11:1557082-1557104 GGGCGAGGACAGGCCCAGCGCGG + Exonic
1077333043 11:1991704-1991726 GGCCGAGGAGGGCCCCCGCCCGG + Intergenic
1077341055 11:2026520-2026542 GGAGTGGGACTGGCCCCTCCTGG - Intergenic
1077431280 11:2517144-2517166 GGATGAGGGCTGGCCCCGCCTGG - Intronic
1084953261 11:72678250-72678272 GGACCAGACCTGGCCCCACCTGG - Intergenic
1085238724 11:75034397-75034419 TGATGAGGACTTGCCCTGCCAGG + Intergenic
1089324007 11:117644852-117644874 GGCCAAGGACTGAACCCGCCGGG + Intronic
1089511005 11:118997262-118997284 GGTCGAGGACTGACCCTGCCAGG + Intergenic
1091215018 11:133895674-133895696 GGACGAGGACGGGCCAGGGCAGG + Intergenic
1202816026 11_KI270721v1_random:46882-46904 GGCCGAGGAGGGCCCCCGCCCGG + Intergenic
1202824040 11_KI270721v1_random:81709-81731 GGAGTGGGACTGGCCCCTCCTGG - Intergenic
1096657974 12:53103584-53103606 AGACGCAGACGGGCCCCGCCTGG - Exonic
1097184375 12:57188788-57188810 TGCTGAGGACTGGCCCCACCTGG + Intronic
1103968479 12:124654921-124654943 GGACGATGACGGGCCCCACGTGG - Intergenic
1104647118 12:130505508-130505530 GGATGAGGAGTGACCCCTCCAGG - Intronic
1104647144 12:130505567-130505589 GGATGAGGAGTGACCCCTCCAGG - Intronic
1104647188 12:130505679-130505701 GGGCGAGGAGTGACCCCTCCAGG - Intronic
1104647212 12:130505738-130505760 GGATGAGGAGTGACCCCTCCAGG - Intronic
1104647239 12:130505797-130505819 GGATGAGGAGTGACCCCTCCAGG - Intronic
1105883714 13:24624889-24624911 GCACCAGGCCTGGCCCAGCCAGG + Intergenic
1107216146 13:37920947-37920969 GGAAGAGAACTGGCCGAGCCTGG - Intergenic
1113834906 13:113322340-113322362 CGATGAGGACCAGCCCCGCCAGG - Exonic
1119319072 14:73718811-73718833 GGCCCAGGACTGGGCCAGCCTGG + Exonic
1121836668 14:97098454-97098476 GGACCAGGACTGGCTCTGCACGG + Intergenic
1122113115 14:99515209-99515231 GGACGTGGACTGGCCCTGCTGGG - Exonic
1122596567 14:102897562-102897584 GGACTAGCACAGGCCCGGCCTGG + Intronic
1122847962 14:104511029-104511051 GGAGCAGGGCTGGCCCTGCCAGG - Intronic
1122877786 14:104676895-104676917 GCAGGGGGACTGCCCCCGCCAGG + Intergenic
1123030110 14:105447600-105447622 GCTCGAGCACTGGCCCCCCCAGG + Intronic
1123707390 15:22959975-22959997 GGATGTGGCCTGGCCCTGCCAGG + Intronic
1124658335 15:31526152-31526174 GGGTGATGGCTGGCCCCGCCAGG - Intronic
1129876647 15:78979738-78979760 GCACCAGGACTGGCCCAGGCTGG - Intronic
1130106518 15:80932558-80932580 ACAGGAGGACTGGCCCCGGCTGG - Intronic
1131236140 15:90698724-90698746 GGATGAGGATTGGCCCAGCATGG - Intergenic
1131873698 15:96783647-96783669 GCATGAGGAATGGCCCCGGCTGG + Exonic
1132282124 15:100628548-100628570 GGACGAGGACTGGTTATGCCGGG - Intronic
1132341333 15:101080148-101080170 GGACTAGGAGGGCCCCCGCCAGG + Intergenic
1132747946 16:1444739-1444761 TGACGAGGCCTGGGCACGCCGGG + Intergenic
1132867784 16:2102461-2102483 GGAGGAGACCTCGCCCCGCCAGG - Exonic
1132968610 16:2673608-2673630 GGGAGAGGCCCGGCCCCGCCTGG + Intergenic
1133284181 16:4682976-4682998 GGAGGAGGGCTGGCCCGGGCGGG - Intronic
1134121387 16:11586969-11586991 GGGCGGGGGCTGGACCCGCCGGG + Intronic
1134523994 16:14930653-14930675 GGAGGAGACCTCGCCCCGCCAGG + Intronic
1134548909 16:15130282-15130304 GGAGGAGACCTCGCCCCGCCAGG - Intronic
1134644958 16:15858344-15858366 GGAGGGGGACCGGCCCGGCCCGG - Intergenic
1134711587 16:16329138-16329160 GGAGGAGACCTCGCCCCGCCAGG + Intergenic
1134719438 16:16372437-16372459 GGAGGAGACCTCGCCCCGCCAGG + Intergenic
1134947988 16:18339448-18339470 GGAGGAGACCTCGCCCCGCCAGG - Intergenic
1134955242 16:18379555-18379577 GGAGGAGACCTCGCCCCGCCAGG - Intergenic
1142132637 16:88437926-88437948 GGAGGAGGCCTGTCCTCGCCGGG - Exonic
1142133944 16:88443159-88443181 GGATGTGGACGGCCCCCGCCTGG + Intergenic
1142358282 16:89614204-89614226 GGATGAGGTCTGGACCCGCCAGG + Intronic
1143056659 17:4167749-4167771 GGACGTGGCCTGGACCCTCCGGG + Exonic
1147278477 17:39337865-39337887 GGAGGGGGTCAGGCCCCGCCCGG + Intronic
1147647145 17:42040619-42040641 GGCCGAGGCCTGGCCTGGCCTGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149849716 17:60027310-60027332 GGACGACCAGTGGCCCCCCCCGG + Intergenic
1149860452 17:60119214-60119236 GGACGACCAGTGGCCCCCCCCGG - Intergenic
1152032596 17:77853506-77853528 GGAAGAGGACGGCCCTCGCCAGG - Intergenic
1152644270 17:81461548-81461570 GGACGAGGACGGGCCGGGGCTGG + Exonic
1152668057 17:81582953-81582975 GGAGGAGGCCTGGCCCTGGCCGG - Intronic
1152758231 17:82096022-82096044 GGCCGAGGGCTGGCCCAGGCAGG - Intronic
1152900947 17:82940834-82940856 GGAGGAGGCCTCGCCCCGCTCGG - Intronic
1157411827 18:47469503-47469525 GGAGGAGGCCTGGCCTGGCCTGG - Intergenic
1158478967 18:57803677-57803699 GGTCGAGGACTGAGCCAGCCTGG + Intergenic
1160333739 18:78018390-78018412 GGACAAAGCCTGGCCCCACCTGG - Intergenic
1161399598 19:4061447-4061469 GGCCGAGGACTGGGCCAGGCGGG - Intronic
1163288621 19:16364583-16364605 GGACCAGGAGTGGCCCTGCATGG - Intronic
1164593864 19:29520870-29520892 GGTGGAGGCCTGGCCCTGCCTGG - Intergenic
1167134462 19:47608758-47608780 GGACCAGCCCCGGCCCCGCCAGG - Intronic
1168609289 19:57786449-57786471 GGACGAGCACAGGAACCGCCTGG + Intronic
925290926 2:2748265-2748287 GGCTGAGGACTGGCACTGCCAGG - Intergenic
925867751 2:8244024-8244046 GGACCCTGGCTGGCCCCGCCAGG + Intergenic
927109029 2:19851245-19851267 GGATGAGGGCTGGCCTCACCTGG - Intergenic
931377008 2:61717017-61717039 GGACTATGAGTGGCCCAGCCTGG + Intergenic
931429064 2:62195621-62195643 GGGTGAGGAATGGCCCCGCCGGG - Intergenic
935344561 2:102093890-102093912 GCAGGAGGACTGGTCCCGCGGGG - Intronic
938319991 2:130356167-130356189 CGGCGAGGACTGCCCCCTCCCGG - Exonic
946366183 2:219250525-219250547 CGCCGAGGCCTGGGCCCGCCTGG - Exonic
946966587 2:225042797-225042819 GGCCTTGGACAGGCCCCGCCCGG - Intergenic
948237090 2:236399578-236399600 GGACCAGGACTGGGCCTGCGCGG - Intronic
948612789 2:239180323-239180345 GGATGAGGAATGGCCTCACCAGG + Intronic
948762316 2:240199656-240199678 AGATGAGGACTGGCCACGGCGGG - Intergenic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1171725941 20:28620860-28620882 GCATGAGGACTGGCTCTGCCTGG + Intergenic
1171857573 20:30361500-30361522 GCATGAGGACTGGCTCTGCCTGG - Intergenic
1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG + Intergenic
1175902024 20:62363718-62363740 GGATGAGGTCTGGCCCCCCAAGG - Intronic
1179172732 21:38985280-38985302 GCAGGAGGCCTGGCCCAGCCAGG - Intergenic
1180142556 21:45901143-45901165 GGACCAGGCCTGCCCCCGCCAGG - Intronic
1181934644 22:26429665-26429687 GTACGAGCACTGGCCTCGGCCGG - Intronic
1183393846 22:37560689-37560711 GAACGGGGACGGGACCCGCCCGG + Intronic
1184335849 22:43852639-43852661 GGACAAGGACTGGCCGCAGCAGG - Intronic
1184362029 22:44024491-44024513 GGCCGAGGGCGGGCACCGCCGGG - Intronic
1184673407 22:46027564-46027586 GGGCGAAGACCAGCCCCGCCCGG - Intergenic
1185258523 22:49849342-49849364 AGACGGGGACCGGCCCCGCGGGG + Intergenic
950040205 3:9915258-9915280 GGAGGAGCACTGGCCGCGCTGGG - Exonic
960947693 3:122978184-122978206 GAACCAGGCCTGGCCCCACCTGG + Intronic
961737699 3:129012563-129012585 GAACGTGGATTGGCCCAGCCTGG + Intronic
967119856 3:186373207-186373229 GGATGAGAACTGGCCCAGCAAGG - Intergenic
968356678 3:198113641-198113663 GGCCGAGGGCTGGGCCCGCGGGG + Intergenic
969121586 4:4915144-4915166 GGAGGAGGAGTGACTCCGCCAGG + Intergenic
976246703 4:83012515-83012537 GGCCGAGCGCTGGCCCTGCCGGG + Intronic
977642045 4:99368143-99368165 GGCCCAGGACTGGCCCCTCATGG - Intergenic
985434611 4:189916935-189916957 GCATGAGGACTGGCTCTGCCTGG - Intergenic
985528661 5:421135-421157 GGAAGAGGAGCCGCCCCGCCTGG + Intronic
985817540 5:2137759-2137781 GGAAGAGCAGTGGCCCCACCTGG - Intergenic
989478767 5:41904223-41904245 GGAAGAGGGCTGGCCCAGGCCGG - Intronic
999261195 5:150239917-150239939 GGACGAGGACTGGCCCCGCCAGG - Intronic
1007448783 6:41927408-41927430 GGACGAGGAGTGGCCCACCCTGG + Exonic
1018912110 6:168107363-168107385 GGACGGGGTCTGGCCCGGCCAGG - Intergenic
1019164475 6:170088843-170088865 GGCCCTGGACTGTCCCCGCCGGG + Intergenic
1029599562 7:101555825-101555847 GGATGAGGACTCGCTCTGCCAGG - Exonic
1031918443 7:127584549-127584571 GGAGGAGGAGAGGGCCCGCCTGG - Exonic
1035182075 7:157096819-157096841 TGACGAGGACTGAGCCCTCCTGG - Intergenic
1035848087 8:2886552-2886574 GCAGGAGGACAGGTCCCGCCGGG - Intergenic
1049680048 8:143914081-143914103 GGAACAGGAGTGGCCCCGGCCGG - Intergenic
1053360865 9:37485932-37485954 GGAAAAGGCGTGGCCCCGCCGGG - Exonic
1053723670 9:40975008-40975030 GCATGAGGACTGGCACTGCCTGG - Intergenic
1054342290 9:63876991-63877013 GCATGAGGACTGGCTCTGCCTGG + Intergenic
1060831977 9:126722779-126722801 GGCCGAGGGGTGGCCCCACCAGG - Intergenic
1203451489 Un_GL000219v1:120990-121012 GCATGAGGACTGGCTCTGCCTGG + Intergenic
1187093671 X:16124043-16124065 GAACGATGACTGGTCCCACCCGG + Exonic
1188104426 X:26132357-26132379 GAACTAAGAATGGCCCCGCCTGG + Intergenic
1200074312 X:153543658-153543680 GGACGAGGAATGGGCCCTCCTGG - Intronic