ID: 999262727

View in Genome Browser
Species Human (GRCh38)
Location 5:150247601-150247623
Sequence TCACTTCTGGGTACAGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999262721_999262727 6 Left 999262721 5:150247572-150247594 CCCTGGGCTTGCTGACTTTTGAC 0: 1
1: 0
2: 0
3: 12
4: 146
Right 999262727 5:150247601-150247623 TCACTTCTGGGTACAGGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 82
999262722_999262727 5 Left 999262722 5:150247573-150247595 CCTGGGCTTGCTGACTTTTGACC 0: 1
1: 0
2: 0
3: 14
4: 138
Right 999262727 5:150247601-150247623 TCACTTCTGGGTACAGGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 82
999262720_999262727 15 Left 999262720 5:150247563-150247585 CCTGGTGGGCCCTGGGCTTGCTG 0: 1
1: 0
2: 2
3: 47
4: 417
Right 999262727 5:150247601-150247623 TCACTTCTGGGTACAGGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 82
999262719_999262727 20 Left 999262719 5:150247558-150247580 CCAGTCCTGGTGGGCCCTGGGCT 0: 1
1: 0
2: 5
3: 54
4: 341
Right 999262727 5:150247601-150247623 TCACTTCTGGGTACAGGCCGTGG 0: 1
1: 0
2: 1
3: 11
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999262727 Original CRISPR TCACTTCTGGGTACAGGCCG TGG Intronic
900709790 1:4106524-4106546 TCACTTCTGGGTGCAGGATCTGG - Intergenic
905688618 1:39926726-39926748 TCCCTCCTGGGAACAGGCCCTGG + Intergenic
913048734 1:115096472-115096494 TCACTACTGGGTATATCCCGAGG - Intergenic
916210167 1:162353844-162353866 TCACTTCCAGGTGCAGGCTGTGG + Intronic
917680924 1:177366535-177366557 CTACTTCTGGGTATAGGCAGAGG + Intergenic
1062835034 10:629737-629759 TCACTGCTGGGCACAGCCTGAGG + Intronic
1064112252 10:12549543-12549565 TCACTTCTGGGTATAGACCTAGG + Intronic
1067347260 10:45445513-45445535 GCTCTTCTGGGTACATGCCCAGG - Exonic
1077132075 11:978080-978102 CCAACTCTGGGTACAGGCCTGGG - Intronic
1077334528 11:1997508-1997530 TCACTTTTGGTTACAGGACGTGG - Intergenic
1077377483 11:2211849-2211871 TCACTTCTGGGGATAGACCTGGG - Intergenic
1077424397 11:2467566-2467588 TCACGTCAGGGTGCAGGCTGGGG + Intronic
1081082253 11:38756625-38756647 CCAGTTCTGGGTAGAGTCCGTGG - Intergenic
1082213893 11:49543027-49543049 TCATTTTTGGGTAAAGGCCATGG - Intergenic
1084196666 11:67526583-67526605 CCACATCTGAGGACAGGCCGGGG + Intergenic
1085625361 11:78067738-78067760 TCACTTCTGGCTGCAGGTCTAGG - Exonic
1086635711 11:89081463-89081485 TCATTTTTGGGTAAAGGCCATGG + Intergenic
1086928788 11:92669745-92669767 TCACTTCTAGCCACAGGCCCTGG + Intronic
1089174167 11:116536406-116536428 TCACTTCTGGGTATCTGCAGAGG - Intergenic
1090798822 11:130158290-130158312 TGCCTTCTGGGCACAGGCCAGGG - Intergenic
1091298667 11:134490661-134490683 ACACTTCTGCTTACAGGCAGTGG + Intergenic
1091298731 11:134491249-134491271 ACACTTCTGCTTACAGGCAGTGG + Intergenic
1202817511 11_KI270721v1_random:52690-52712 TCACTTTTGGTTACAGGACGTGG - Intergenic
1091700039 12:2653073-2653095 TGACTTCTGGGGACAGGCCATGG - Intronic
1093147173 12:15580736-15580758 TCATTTCTGGTTTCAGGCAGTGG - Exonic
1096028600 12:48390402-48390424 TCACTTCTGGGTAGAGGCTAAGG + Intergenic
1097478040 12:60083697-60083719 TAGCTTCAGGGTATAGGCCGAGG + Intergenic
1099020356 12:77395978-77396000 TCTCTTATGGGTAGAGGCCATGG + Intergenic
1110656971 13:78011779-78011801 ACATTTCTGGGTAGAAGCCGGGG - Intergenic
1111823025 13:93236117-93236139 TCCCTTCTAGGTACAGGCATAGG - Intronic
1113835165 13:113323999-113324021 TAACTTCTGGGTACAGGTGGAGG - Intergenic
1116259505 14:42605583-42605605 TCTCTTCTGGGTATTGGCCTAGG + Intergenic
1117444580 14:55791594-55791616 TCATTTCTGCATGCAGGCCGAGG + Intergenic
1117844929 14:59900888-59900910 TCACTGCTGCTTACAGGCTGGGG - Intergenic
1119392868 14:74302955-74302977 TCAGTACTGGGTAGAGTCCGAGG + Exonic
1121436805 14:93925936-93925958 TCACTTCTGGATGGAGGCCCTGG + Intronic
1123131903 14:105994097-105994119 ACACTTGTGGGCACAGGCCCGGG + Intergenic
1128942678 15:71801447-71801469 TCACGTCTGGGTGAAGGCAGAGG - Intronic
1129360369 15:75020503-75020525 TCCCTTCTGCCTACAGGCCTTGG + Exonic
1130375305 15:83323761-83323783 ACACTGCTGGGTACAGGAAGGGG - Intergenic
1131072847 15:89476944-89476966 GCACTTCTGGCTACAGGACTGGG - Intronic
1133173592 16:3997474-3997496 TCACTGCAGGGTGCAGGCCTCGG - Intronic
1143981482 17:10873961-10873983 TCAGTTCTGGGTACAGTGCCTGG - Intergenic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155553734 18:26995007-26995029 TCACTTCTGGGGAAAGCCGGTGG + Intronic
1156279441 18:35620852-35620874 TCACTTCTAGGTACAGTCCCTGG - Intronic
1160947002 19:1648333-1648355 CCACCTCTGGGTAAAGCCCGAGG + Intronic
1163117683 19:15198073-15198095 TCACTCGTGGGTACATGCCTTGG - Intronic
1165285310 19:34837393-34837415 TCACTGCTGCTTACAGGCTGGGG + Intergenic
925277057 2:2657575-2657597 TCCCTGCTGGGTGCAGGCGGGGG - Intergenic
927576846 2:24207711-24207733 TCACTGGTGGGGACAGGACGTGG + Intronic
929444397 2:41991595-41991617 TCACTAATGGGTGCATGCCGTGG - Intergenic
931590415 2:63876771-63876793 AGACTTCTGGGAACAGGCCCTGG - Intronic
936005659 2:108884818-108884840 TCACTCCTGGGTGCAGGCTCAGG + Intronic
946025482 2:216669544-216669566 TCAGTTCTGTCTGCAGGCCGCGG + Intergenic
1169601780 20:7269408-7269430 TCACTTCTGGTCTCAGGCTGGGG - Intergenic
1171286005 20:23938449-23938471 TCAGTTCTGGGTGGAAGCCGTGG + Intergenic
1182522377 22:30891756-30891778 TCACTCCAGGGTTCAGGCCAAGG - Intronic
1183250983 22:36730237-36730259 TCACGTCGGGGTCCAGGCTGGGG + Intergenic
1184100093 22:42337417-42337439 TCACTTCTGCTTACAAGCCCTGG + Intronic
949119090 3:363843-363865 TCACTTCAGGGCACAGTCCTGGG + Intronic
950205467 3:11076864-11076886 TCACTGCTGGGCGCAGGGCGAGG - Intergenic
950475563 3:13212511-13212533 TCTCTCCTGGGTAGAGGCCCTGG + Intergenic
952708620 3:36406249-36406271 GCACTTTTGGGAACAGGCCCTGG + Intronic
953347040 3:42184921-42184943 ACAGTTCTGGGCTCAGGCCGCGG - Intronic
954716383 3:52528923-52528945 TCCCTTCTGGGTACTGCCGGGGG + Exonic
955042780 3:55333228-55333250 TCACTTCTGGATTCAAGCCACGG + Intergenic
957730339 3:84125777-84125799 TCAGTTCTGGGTGGAGTCCGCGG + Intergenic
965870716 3:173261200-173261222 TCATTTCTGGGCATAGGCCGAGG - Intergenic
975251627 4:72186223-72186245 TCACTACTTGGTACAGGCCATGG - Intergenic
976621678 4:87134651-87134673 TGACCTTTGGGAACAGGCCGAGG + Exonic
981166611 4:141566377-141566399 TCACTTCTGGGTGCAGCCACAGG - Intergenic
984247915 4:177297602-177297624 TCATTTCTGGGTGTAGGCCAAGG + Intergenic
991084617 5:62637102-62637124 TCACTTCTGGGAACAGTCTTGGG - Intergenic
992459924 5:76951476-76951498 TGAATTCTGGGAACAGGCCAAGG + Intergenic
997640955 5:135448601-135448623 TCACTTCTGGATCAAGGCCTTGG - Exonic
999262727 5:150247601-150247623 TCACTTCTGGGTACAGGCCGTGG + Intronic
1000124864 5:158234393-158234415 TCACTTCTTGCTACATGCAGTGG + Intergenic
1001937100 5:175712983-175713005 TCATGTCTGGGTACAGGAAGGGG - Intergenic
1006313998 6:33279684-33279706 GCACTTCTGGGGACAAGCCATGG + Intronic
1007123116 6:39400043-39400065 AGACTTCTGGGTACAGTCTGGGG + Intronic
1018698428 6:166408309-166408331 GCACTTCTGGGTACAGCAGGAGG + Intergenic
1023108838 7:36789808-36789830 TCACTTCTGGCTACAGACACAGG - Intergenic
1028282793 7:88952939-88952961 TTACTTCTGGGTACAGGCAGTGG + Intronic
1031867684 7:127056438-127056460 TCCCTTCTGTGTACAGGCCCTGG - Intronic
1036518812 8:9471376-9471398 TCACTTCAGGATACAGTCCAGGG - Intergenic
1040883649 8:52235591-52235613 TCACTTTTTGCTACAGGCTGTGG - Intronic
1045425326 8:102060426-102060448 TCACTTCTGAGTCCAGGCACTGG + Intronic
1045713909 8:105019220-105019242 TCATTCCTGGGTTCAGGCAGTGG + Intronic
1046619553 8:116513832-116513854 TCACTTGTGGGGATTGGCCGTGG - Intergenic
1049591684 8:143465636-143465658 TCACTCCTGGGTACCTGCCGTGG - Intronic
1049746853 8:144266649-144266671 TCACCTCGGGGTACAGGTAGCGG - Exonic
1060992659 9:127857704-127857726 TCCCTGCTGGGCACAGGCCTTGG + Intergenic
1190063055 X:47223138-47223160 TCAATTCTGGGCACACGCCCTGG + Exonic
1200239292 X:154485571-154485593 TCACTTCAGGGTGCAGGAAGCGG + Exonic