ID: 999263762

View in Genome Browser
Species Human (GRCh38)
Location 5:150253382-150253404
Sequence GCTTATGTGTCAACACAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999263757_999263762 2 Left 999263757 5:150253357-150253379 CCACTCAGGCAGGGGGTTCCCAG 0: 1
1: 0
2: 3
3: 26
4: 242
Right 999263762 5:150253382-150253404 GCTTATGTGTCAACACAAATGGG 0: 1
1: 0
2: 0
3: 7
4: 131
999263748_999263762 24 Left 999263748 5:150253335-150253357 CCAACAGCATCTCCAGCCATACC 0: 1
1: 0
2: 2
3: 15
4: 379
Right 999263762 5:150253382-150253404 GCTTATGTGTCAACACAAATGGG 0: 1
1: 0
2: 0
3: 7
4: 131
999263750_999263762 12 Left 999263750 5:150253347-150253369 CCAGCCATACCCACTCAGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 213
Right 999263762 5:150253382-150253404 GCTTATGTGTCAACACAAATGGG 0: 1
1: 0
2: 0
3: 7
4: 131
999263756_999263762 3 Left 999263756 5:150253356-150253378 CCCACTCAGGCAGGGGGTTCCCA 0: 1
1: 0
2: 2
3: 10
4: 126
Right 999263762 5:150253382-150253404 GCTTATGTGTCAACACAAATGGG 0: 1
1: 0
2: 0
3: 7
4: 131
999263755_999263762 8 Left 999263755 5:150253351-150253373 CCATACCCACTCAGGCAGGGGGT 0: 1
1: 0
2: 0
3: 8
4: 137
Right 999263762 5:150253382-150253404 GCTTATGTGTCAACACAAATGGG 0: 1
1: 0
2: 0
3: 7
4: 131
999263747_999263762 25 Left 999263747 5:150253334-150253356 CCCAACAGCATCTCCAGCCATAC 0: 1
1: 0
2: 0
3: 20
4: 207
Right 999263762 5:150253382-150253404 GCTTATGTGTCAACACAAATGGG 0: 1
1: 0
2: 0
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999263762 Original CRISPR GCTTATGTGTCAACACAAAT GGG Intronic
901283242 1:8056151-8056173 GTTCATGAGTCATCACAAATGGG - Intergenic
902753038 1:18530737-18530759 GCTTATCTTTGAACACAGATGGG + Intergenic
906468323 1:46105092-46105114 ACTTATGTAGCAACTCAAATTGG + Intronic
908440182 1:64145871-64145893 GCTTCTGTATCAGCAAAAATAGG - Intronic
908684828 1:66704432-66704454 GGTTCTGTGTCAACACTGATGGG + Intronic
909864994 1:80656525-80656547 ATTTTTGTGTCAACAGAAATAGG + Intergenic
911378429 1:97080567-97080589 GAATATCTGTCCACACAAATTGG + Intronic
912913449 1:113787169-113787191 GATCATGTTTCAACACTAATAGG + Intronic
916405149 1:164490917-164490939 GGGTATGTGTCAACCAAAATAGG - Intergenic
920199541 1:204251063-204251085 GCTTGTGTCTAAACAAAAATTGG + Intronic
922653012 1:227357332-227357354 TCTTATGAGTCAGCACTAATGGG + Intergenic
923260854 1:232266519-232266541 GCTTAGGTGTCAAAATAAAGAGG + Intergenic
1063492110 10:6473560-6473582 GCTTATCTGTCACTACAGATGGG + Intronic
1063762496 10:9096040-9096062 ACACATGTTTCAACACAAATGGG - Intergenic
1070281667 10:75053487-75053509 CCTTATGTGGCAACAATAATGGG - Intronic
1070821610 10:79358896-79358918 CCTTATGTGTCAACCTAACTGGG + Intergenic
1071784664 10:88885413-88885435 GCATATATGAAAACACAAATTGG - Intronic
1074265553 10:111899548-111899570 GCTTCTGTGTGAACAGGAATAGG - Intergenic
1074342080 10:112641864-112641886 GCTTGTCTTTGAACACAAATGGG + Intronic
1074423401 10:113329302-113329324 GCTGACATTTCAACACAAATTGG - Intergenic
1075599523 10:123757055-123757077 GCTCAAGTGTCAACACACAGTGG + Intronic
1075625770 10:123963568-123963590 GCCTAAGTGTCAAGAAAAATGGG - Intergenic
1077003399 11:337179-337201 GTTTATATTTTAACACAAATAGG - Intergenic
1078555098 11:12318617-12318639 GCTTATGTCTGAATAGAAATAGG - Intronic
1079629808 11:22659995-22660017 GCTCATTTCCCAACACAAATGGG - Intronic
1079642219 11:22820152-22820174 CCTTATGTCTCAACACATATAGG + Exonic
1079694213 11:23458555-23458577 GATTTTGTTTCAACATAAATTGG - Intergenic
1081584981 11:44378002-44378024 GCTTATGTGTAAACAGAAGTAGG - Intergenic
1081760003 11:45570511-45570533 GTGTATGTGTGAACACACATAGG + Intergenic
1085597754 11:77825491-77825513 TATTAAGTGTCAACAGAAATAGG + Intronic
1087494733 11:98876676-98876698 TTTTATGTGTCAACTTAAATGGG - Intergenic
1087886314 11:103487282-103487304 TTTTATGTGTCAACTCAACTGGG + Intergenic
1091204251 11:133808707-133808729 GATGATGGGTGAACACAAATTGG - Intergenic
1094005289 12:25742617-25742639 GCTTATTTGTATACAAAAATGGG + Intergenic
1095787508 12:46126046-46126068 GCTTAGCTTTCAACACAAAAAGG + Intergenic
1098075972 12:66731864-66731886 TTTTATGTGTCAATACAAATAGG - Intronic
1100859857 12:98793331-98793353 GATTATTTGTCAACTCAAAATGG + Intronic
1101543628 12:105688702-105688724 GCTTCTGTGTCATCTCATATTGG + Intergenic
1104186571 12:126438348-126438370 GCTTTAGTTTCCACACAAATGGG - Intergenic
1105402815 13:20110699-20110721 TGTTATGTGTCAACTCAACTGGG + Intergenic
1110993764 13:82077136-82077158 GCTTATATGTGAACGCAACTGGG - Intergenic
1115043218 14:28956460-28956482 TCTTATGTGCAAACACACATAGG + Intergenic
1117347375 14:54846560-54846582 GATTATGTTTAAACAAAAATGGG - Intronic
1118815175 14:69307176-69307198 GATTAGGTGTCAACTAAAATGGG - Intronic
1119917714 14:78417661-78417683 GCTTCTGTGACAACCCAAAGAGG - Intronic
1129624781 15:77185436-77185458 GCTTCTGTGTCATCACACCTTGG - Intronic
1129936791 15:79457426-79457448 GCTTATGCGGCAAAACAAAATGG + Exonic
1132758842 16:1499285-1499307 GCTTCTGGGTCATCACAAACTGG - Exonic
1136407554 16:30057258-30057280 CCTTATGTGTCTACACATACAGG - Intronic
1137245766 16:46703094-46703116 GCATATGTCTCTTCACAAATGGG + Intergenic
1137574456 16:49589751-49589773 GCTTCAGTGTCATCACAACTGGG - Intronic
1138779082 16:59760812-59760834 GATTATGTGTATACAAAAATAGG + Intergenic
1139159450 16:64486789-64486811 CTTTATGTGGCAACACAGATTGG + Intergenic
1140871992 16:79114893-79114915 GCCTCTGTGTCATCACCAATGGG - Intronic
1149333154 17:55607161-55607183 GCTCATGTGTGCACACACATGGG + Intergenic
1150494682 17:65598068-65598090 TCTTCTGTGTGAACAAAAATAGG + Intronic
1156060620 18:33070793-33070815 TATTATGTATCAATACAAATTGG + Intronic
1159133338 18:64306723-64306745 GCTTAAGTGTGAATGCAAATAGG + Intergenic
1168286685 19:55338692-55338714 GCTTGTGTGTCTACACATATAGG - Intergenic
928067902 2:28185077-28185099 GCTTATTTCTCAATATAAATGGG - Intronic
928209228 2:29311481-29311503 GTTTTTGTGTCCAAACAAATAGG + Intronic
929685511 2:44030608-44030630 GCTTATTTGTCAATAAAGATAGG - Intergenic
935683443 2:105659635-105659657 GCATATATGTCCACAAAAATTGG + Intergenic
940914680 2:159241287-159241309 TCTTATGTTACAACACAAAGTGG - Intronic
943161456 2:184258145-184258167 GCTTATGACTCAATTCAAATGGG - Intergenic
943175555 2:184468362-184468384 GATTTTGTGGCATCACAAATTGG - Intergenic
945323339 2:208453220-208453242 GCTTATATGTCAACAAAAAATGG - Intronic
946031282 2:216707177-216707199 ACTTATGTGTCAACTTAACTGGG + Intergenic
947292567 2:228593417-228593439 TTTTATGTGTCAACTTAAATGGG + Intergenic
948748625 2:240113767-240113789 GCTTAGGTGTCAGCAGGAATAGG + Intergenic
1169666061 20:8037419-8037441 ACTTATGTATCACCCCAAATAGG - Intergenic
1169711495 20:8569599-8569621 TCCTATGTGTCCACAAAAATAGG + Intronic
1169958413 20:11131588-11131610 GGTTCTGTGTCAACACATGTGGG - Intergenic
1170237036 20:14118539-14118561 TCTTATATTTCAACACGAATGGG + Intronic
1174754713 20:53146249-53146271 GCGGATGAGTCAACACAATTTGG + Intronic
1182106001 22:27689928-27689950 CCTTATGTTTTTACACAAATGGG - Intergenic
1182579892 22:31300637-31300659 GCTGATGTGGGAACACACATTGG + Intergenic
1182871915 22:33655103-33655125 TTTTATGTGTCAACTCAACTGGG + Intronic
950657300 3:14444635-14444657 GCTTGTGTGTCAGCAGAGATGGG + Intronic
952051417 3:29388935-29388957 GATGATGTGTCTACATAAATGGG - Intronic
956985248 3:74691002-74691024 GCTTCTCTGTTAACACAAGTTGG + Intergenic
957956330 3:87193195-87193217 GCTCATGAGTCTACACAAGTTGG + Intergenic
960540769 3:118859904-118859926 GCATTTGTGACAACACAGATGGG - Intergenic
967782655 3:193456891-193456913 GCCTATGGGTCATCACCAATTGG - Intronic
971202789 4:24527727-24527749 GCTACAGTGTCAACACAAAAGGG + Exonic
974115396 4:57572668-57572690 TCTTAAGTGTCACCACAAAAAGG + Intergenic
975076488 4:70215660-70215682 ACCTATGAGCCAACACAAATGGG - Intergenic
975077046 4:70222642-70222664 ACCTATGAGCCAACACAAATGGG + Intergenic
977555735 4:98485805-98485827 GATGATGTGTCAACAAAAGTTGG + Intronic
979015764 4:115431648-115431670 CGTTATCTGTCAACACAAGTTGG + Intergenic
979546040 4:121941128-121941150 GCTTATGTGTCAGAACATTTTGG + Intronic
988039247 5:25867787-25867809 GCTTATGTGTCCACAGTTATAGG + Intergenic
988053571 5:26061854-26061876 GCACATTTGTTAACACAAATAGG - Intergenic
994629350 5:102264484-102264506 GGTTATGTGTCAACTAAAAAAGG - Intronic
997777464 5:136624059-136624081 GCTTATGAGCCAACAGAATTAGG + Intergenic
997889838 5:137665956-137665978 GCTTATGTTTGTACACATATAGG - Intronic
999263762 5:150253382-150253404 GCTTATGTGTCAACACAAATGGG + Intronic
999798392 5:155009368-155009390 CCTTCTGTGCCAACAGAAATAGG - Intergenic
1000434711 5:161194122-161194144 GGTGATATGTCACCACAAATTGG + Intergenic
1002365748 5:178709237-178709259 GCTTAAGTGGCAATACAAGTTGG - Intergenic
1004409321 6:15366045-15366067 GATTAAGTGTAAACAAAAATGGG - Intronic
1004686968 6:17955831-17955853 GTAGATGTGTGAACACAAATTGG - Intronic
1004884886 6:20041957-20041979 GCTGAGGTATCAAGACAAATCGG + Intergenic
1005819174 6:29582930-29582952 GCTTATGAGGCTACAGAAATAGG + Intronic
1011674335 6:89716945-89716967 GCTTCTGTTTAAACACAGATAGG + Intronic
1011779523 6:90771218-90771240 GCTCGTGTGTCAAAAAAAATAGG + Intergenic
1012047195 6:94292435-94292457 TTTTATGTGTCAACTCAACTGGG + Intergenic
1012533479 6:100267110-100267132 GCTGTGGTTTCAACACAAATGGG - Intergenic
1015224650 6:130843472-130843494 GCATCTTTGTCAATACAAATTGG + Intronic
1017952161 6:159144281-159144303 GGTAATATGTCAACACAACTAGG - Intergenic
1019084511 6:169462755-169462777 GATTATGCATCAAGACAAATTGG + Intronic
1019920809 7:4162197-4162219 GCTTCTGTGTATACACAAATTGG + Intronic
1020975175 7:14997408-14997430 GCAGATGTGAGAACACAAATGGG - Intergenic
1028660490 7:93267086-93267108 GCTTCTCTATCAAAACAAATGGG - Intronic
1028675496 7:93455887-93455909 GCTTATGTGCCACCACCAACAGG - Intronic
1028678553 7:93496998-93497020 CTTTATGTGGCAACATAAATTGG - Intronic
1033496570 7:141903178-141903200 TGTTATGTGTCAACTCAAGTAGG - Intergenic
1034434169 7:151055219-151055241 CCCTATTTGTCAACTCAAATGGG + Intronic
1036149754 8:6286466-6286488 TCTTATGTGTTAACTCAACTGGG - Intergenic
1038031203 8:23642534-23642556 GCTGATTTCTCAACAAAAATAGG - Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1043346979 8:79309946-79309968 ACTTATGTGTCAACTTAACTGGG + Intergenic
1045066329 8:98449567-98449589 CCTGATGGGTCATCACAAATGGG + Intronic
1047018712 8:120751581-120751603 GCTTATGGGTAAAGAAAAATTGG - Intronic
1048248847 8:132840578-132840600 GATTATGTGGCAACAAAAAATGG - Intronic
1050201688 9:3151648-3151670 GCTTAGCTGTCATCACGAATTGG + Intergenic
1051477555 9:17524582-17524604 GTTTATGTGTCAACTTGAATGGG - Intergenic
1054852880 9:69866704-69866726 TTTTATGTGTCAACATAACTGGG - Intronic
1055535438 9:77237796-77237818 ACATATAAGTCAACACAAATAGG + Intronic
1055782500 9:79834532-79834554 TCCTTTGTGACAACACAAATGGG - Intergenic
1055923976 9:81491112-81491134 GCTGATGTGTCCACACTAAAAGG + Intergenic
1057990699 9:99766752-99766774 GTTTATGTGTCAACTCAACTGGG + Intergenic
1186054198 X:5631575-5631597 TCTTTTGTTTGAACACAAATGGG - Intergenic
1188066790 X:25671662-25671684 GCTGAAGTGGTAACACAAATGGG + Intergenic
1189856075 X:45226422-45226444 ACTTTTGTGGCAAAACAAATGGG - Intergenic
1197320399 X:125022323-125022345 GCTAGTGTCCCAACACAAATGGG + Intergenic
1197501096 X:127243543-127243565 GTTTATGTGTCAACCTGAATGGG + Intergenic
1197891310 X:131273324-131273346 GACTATGTGTCAAACCAAATTGG + Intergenic
1199417503 X:147602416-147602438 GCTTCTGTGTCAACAAATACTGG + Intergenic