ID: 999269631

View in Genome Browser
Species Human (GRCh38)
Location 5:150289328-150289350
Sequence CAGTGTGTATGTAGGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 6, 3: 29, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999269631_999269636 -8 Left 999269631 5:150289328-150289350 CCTTCATCCCTACATACACACTG 0: 1
1: 1
2: 6
3: 29
4: 295
Right 999269636 5:150289343-150289365 ACACACTGGCCTGGCTAGCTTGG 0: 1
1: 0
2: 1
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999269631 Original CRISPR CAGTGTGTATGTAGGGATGA AGG (reversed) Intronic
901435143 1:9242972-9242994 GTGTGTGTATTTAGGGGTGAGGG + Intronic
901490176 1:9592703-9592725 CAGTGTGTATGTTGGGCTTGTGG + Intronic
901617755 1:10555346-10555368 GACTCTGTATGTAGGGAAGAAGG - Intronic
903044800 1:20556698-20556720 CAGTGTGTATGATGGACTGAGGG + Intergenic
903452870 1:23466512-23466534 GTGTGTGTATGTTGGGATCAGGG - Intronic
905930569 1:41784023-41784045 CAGGGAGTAGGTAGGGAAGAAGG + Intronic
906233694 1:44188998-44189020 CAGTGAGTATGTGGTGGTGATGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907314501 1:53559782-53559804 CAGTGAGTGTGTGTGGATGAGGG - Intronic
908428630 1:64034037-64034059 CAGTGTCCAAGTAGGGATGCTGG + Intronic
908565434 1:65351017-65351039 CAGTGTGGACATAGGGATTAGGG - Intronic
909213421 1:72853329-72853351 AAGTGTGTATTTGTGGATGAAGG - Intergenic
909731483 1:78897004-78897026 CAGGGAGTATGTAGGCAAGATGG - Intronic
910879791 1:91913045-91913067 AAGTGTGTACGTGGGGGTGAGGG + Intergenic
911707984 1:101037510-101037532 TAGCGTGTTTGTAAGGATGAAGG - Intergenic
912882899 1:113436389-113436411 CAGTTTGTTTGTAAGAATGATGG + Intronic
916001592 1:160621645-160621667 CAGTGTGTATGTGGTGAGCATGG + Intronic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
919493467 1:198234846-198234868 CAGTGTGAATGCAGAGAGGAGGG - Intronic
921583585 1:216923712-216923734 CAGTGTGGTTGTAGGAGTGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924444886 1:244119971-244119993 CAGCGTGTAGGAAGGGTTGAAGG + Intergenic
1063470686 10:6282409-6282431 CAGTGTGTCTGTTGGGAACATGG + Intergenic
1064341036 10:14485512-14485534 CTGTGTATATGTGGGGATGGGGG - Intergenic
1066059566 10:31709775-31709797 CTGTCTGTAAGAAGGGATGAAGG - Intergenic
1067763494 10:49068507-49068529 CAGCATGTATGTGGGGTTGATGG + Intronic
1068897545 10:62223914-62223936 AAGTGTCTATCCAGGGATGAAGG + Intronic
1073035804 10:100563433-100563455 GTGTGTGGATGTAGGGGTGAGGG - Intergenic
1073244676 10:102081318-102081340 CAGTGTGTTAGTGGGGAGGATGG - Intergenic
1073791957 10:106949492-106949514 CAGAGGCTGTGTAGGGATGAGGG - Intronic
1074083085 10:110183220-110183242 CAGTGTGTGTGTTGGGGAGAAGG + Intergenic
1074746115 10:116534105-116534127 CAGTGTCTGTCTAGGGTTGAGGG - Intergenic
1075068851 10:119307777-119307799 CAGTGTGTATGCAGAAAGGAGGG - Intronic
1075242778 10:120793266-120793288 CAGTGTGTGTGTGGGGGGGAGGG - Intergenic
1075713223 10:124541852-124541874 CAGTGGGGAAGTAGGGGTGAAGG - Intronic
1076122614 10:127948311-127948333 CTGTGTGTGTGTAGGGTTAAGGG - Intronic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1081147000 11:39573997-39574019 CTGTGTGAATATAGAGATGATGG - Intergenic
1081510910 11:43772419-43772441 CACTGTGCATGAAGGGGTGATGG - Intronic
1083506812 11:63165597-63165619 CAGTGGATATGTAGTGATTAGGG + Intronic
1084089454 11:66870514-66870536 CAGTGGTTATGTGGGGGTGATGG - Intronic
1084609185 11:70191342-70191364 GTGTGTGTATGTTGGGATGGGGG + Intergenic
1086212469 11:84336934-84336956 TAGTGTGTATATAGGAGTGAGGG - Intronic
1086407141 11:86508120-86508142 CAGTGTGGGGGTGGGGATGAGGG - Intronic
1087674696 11:101146878-101146900 CAGTCTGTGGGTAGGGATGAAGG - Intergenic
1087843688 11:102946901-102946923 CTGTGTGTATGTAGAGATGGAGG + Intronic
1088837931 11:113594138-113594160 TAGTGTGTATGTGGGGGTGGGGG + Intergenic
1091637266 12:2206586-2206608 CAGTGAGTAGGTAGGGAGGTGGG - Intronic
1092116363 12:6011488-6011510 CACTGTGCATGTGGTGATGAGGG + Intronic
1092783885 12:12010731-12010753 GAGTGTGTGTTTAGGGAAGATGG - Intergenic
1092886330 12:12927507-12927529 CAGTGTGTTTGTACGCATGCAGG - Intergenic
1092890972 12:12969024-12969046 CAGTGTGAGTGAAGGCATGAAGG + Intergenic
1093167366 12:15820030-15820052 CTGTGTGTATGCATGCATGAAGG - Intronic
1093523219 12:20074727-20074749 AACTGTGTGTGTAGGAATGAGGG - Intergenic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1097039494 12:56146950-56146972 GATTCTGTATGTAGGGAAGAGGG - Intergenic
1099054268 12:77818552-77818574 CAGTGTCTTTGCAGGGATGAGGG + Intergenic
1099353113 12:81598151-81598173 CACTGTGTATGTAAGAAGGATGG - Intronic
1099981961 12:89614629-89614651 AAGTGTGTAGCTAGGGAAGAAGG - Intronic
1100364177 12:93904168-93904190 CAGTATGTATGTTGGGAAGTGGG - Intergenic
1102073804 12:110044164-110044186 ATGTGTGTCTGTAGGGATGTGGG + Intronic
1102662471 12:114541667-114541689 CAGTGGGGATTTAGGAATGAGGG + Intergenic
1102665269 12:114566634-114566656 CAGTGGGGATTTAGGAATGAGGG - Intergenic
1102748939 12:115275270-115275292 CAGCCTGTATGTGGGGATGCTGG - Intergenic
1102871202 12:116415747-116415769 GAGTGTGTATGTGTGAATGAGGG + Intergenic
1105324273 13:19355849-19355871 ACGTGGGTATGTGGGGATGAGGG - Intergenic
1105844435 13:24282093-24282115 CAGTGTGGCTGAAGTGATGAGGG + Intronic
1108603893 13:52017879-52017901 TGGTGTGTATGTTGGGATGGTGG - Intronic
1108637305 13:52348357-52348379 CTGTGTTTCTGCAGGGATGAAGG - Intergenic
1108677990 13:52754384-52754406 CAAAGTGAAAGTAGGGATGAGGG - Intergenic
1108716859 13:53088730-53088752 CAGTGTTTAGGCAGAGATGAAGG - Intergenic
1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG + Exonic
1112301978 13:98239284-98239306 CAGTTTTTATGATGGGATGAGGG - Intronic
1113239247 13:108318054-108318076 GAGCGTGGATGTAGGGAAGAGGG - Intergenic
1113597315 13:111542766-111542788 GTGTGTGTGTGTATGGATGAAGG + Intergenic
1114339319 14:21726641-21726663 CAGTGTGTCTGTAGGGCACATGG + Intergenic
1117096598 14:52304982-52305004 CAGTGTGCATACAGCGATGAAGG - Intergenic
1117190888 14:53290034-53290056 CAATATGCATTTAGGGATGATGG + Intergenic
1117870279 14:60193433-60193455 CAGTGAGGATGTAGGGAAAATGG - Intergenic
1118007013 14:61572512-61572534 CAGTGATTCTGTAAGGATGAAGG - Intronic
1119521144 14:75286421-75286443 CAGAGTGCCTGTAGGGAAGAAGG - Intergenic
1119914296 14:78382910-78382932 GAGTGTGTGTGTGGGGAGGAGGG + Intronic
1120053568 14:79896763-79896785 GAGTGTGTATGTATGGATACTGG - Intergenic
1126903531 15:53339430-53339452 TTGTGTGTATGTAGGCATGAAGG + Intergenic
1126952533 15:53897450-53897472 CCTTGTTTTTGTAGGGATGAGGG + Intergenic
1131118882 15:89810890-89810912 CAGCTTGTGTGTAGGGAGGAAGG - Intronic
1132193536 15:99891205-99891227 CAGTGGATTTGTAGGGATGAAGG - Intergenic
1132565230 16:619383-619405 CAGTGTGTGTGCAGGTATGGTGG + Intronic
1132836905 16:1958737-1958759 CTGTTTGTCTGTAGGGTTGATGG + Intergenic
1133997741 16:10761165-10761187 CTGTAGGGATGTAGGGATGATGG + Intronic
1134040050 16:11061437-11061459 CAGTGTTTAGGTAAGGATGAAGG + Intronic
1134133114 16:11663224-11663246 CAGTGAGTTTGTAGGGGGGAAGG + Intergenic
1135622791 16:23970281-23970303 CAGAGTGTATGTACAAATGAGGG - Intronic
1135692635 16:24555227-24555249 CAATGTGGAGGTAGGGATGGGGG - Intronic
1135893062 16:26374460-26374482 AAGGGTGAATGTATGGATGATGG + Intergenic
1137638790 16:50010361-50010383 CACTGTGTTTGGAGGGAGGATGG + Intergenic
1138070412 16:53987665-53987687 CAGTGTTTATGATGGGAGGATGG - Intronic
1140150389 16:72357564-72357586 CATGGTGTGTGTAGGGAGGAGGG - Intergenic
1141007103 16:80362869-80362891 GTGTGTGTATGTGGGGGTGAGGG + Intergenic
1143137762 17:4721188-4721210 CAGTGTGTATCTTGGGGGGATGG - Exonic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1144481416 17:15632611-15632633 TAGTGTTTACGTAGGGCTGAAGG - Exonic
1145871505 17:28277217-28277239 CAGTGTCTATGCAGGCATCAGGG - Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147953081 17:44117779-44117801 CAGTTTGTACCTGGGGATGAGGG + Intronic
1149540273 17:57463249-57463271 CATTGTGTATGTAGGAGTGGGGG + Intronic
1149825766 17:59826509-59826531 CAGTGTGTATTTTAGGCTGAGGG + Intronic
1149906100 17:60527759-60527781 CAGTGTCTAAGAAGTGATGAAGG - Intergenic
1151037054 17:70812753-70812775 CAGTGTGTACTAAGGGATGGGGG - Intergenic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1154068879 18:11134516-11134538 AAGAGTGTATTTTGGGATGAGGG - Intronic
1156604631 18:38651812-38651834 CAGTGTATAGGAAGGGCTGAAGG + Intergenic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158909551 18:62046560-62046582 CGCTGTGTATGTGGGGGTGAGGG - Intronic
1159289679 18:66399997-66400019 GAGTGTGTATGTAGGCAAAAAGG + Intergenic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1161426936 19:4208829-4208851 TAGTGTGGATGCAGGGAGGAGGG - Intronic
1164067338 19:21729327-21729349 CATTTTGTATGTAGGGTTTATGG - Intronic
1165981266 19:39726382-39726404 CAGTTTTTATCTAGGGATGAGGG - Intergenic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
925030203 2:644535-644557 CAGTGTGAATGAATGGATGGAGG + Intergenic
925059194 2:878165-878187 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059207 2:878211-878233 GTGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059228 2:878326-878348 GCGTGTGTGTGTAGGGGTGAGGG - Intergenic
925059256 2:878481-878503 GCATGTGTATGTAGGGGTGAGGG - Intergenic
925090969 2:1155850-1155872 AAGTGAGTGTGTAGGGGTGATGG + Intronic
925291199 2:2749763-2749785 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291212 2:2749808-2749830 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291219 2:2749836-2749858 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291233 2:2749888-2749910 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291246 2:2749933-2749955 GTGTGTGTGTGTAGGGATGGGGG + Intergenic
925291253 2:2749961-2749983 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925291267 2:2750013-2750035 ATGTGTGTGTGTAGGGATGGGGG + Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363498 2:3295619-3295641 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363517 2:3295719-3295741 GTGTGTGTATGTAGAGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925391447 2:3497127-3497149 CAGTGTAAGTGTAGGGATCAGGG + Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926266176 2:11323747-11323769 CTATGTGTATGCAGGGGTGAGGG - Intronic
927892418 2:26760128-26760150 AAGTGTTTTTGTAGAGATGAGGG + Intergenic
928836114 2:35547308-35547330 CAGTGTGAATGTAGAGATTTTGG + Intergenic
929876976 2:45804780-45804802 CAGTGTTGATGTATGGATGTTGG + Intronic
931175846 2:59854140-59854162 GAGTGTATATGTATGTATGAGGG - Intergenic
931871068 2:66460137-66460159 CAGTTTGTTTGTTGGGATGTTGG + Intronic
932161503 2:69464583-69464605 CATTGTGGAGGTAGGCATGATGG + Intronic
932568304 2:72923469-72923491 CAGTGTGTGTGTTGGGATAGGGG + Intronic
933222736 2:79709484-79709506 CAGGGTTACTGTAGGGATGAGGG + Intronic
936239834 2:110777786-110777808 CTGTGTGTATGTGGGGTTGAGGG + Intronic
937245259 2:120488363-120488385 GTGTGTGTATGTGGGGATGGGGG + Intergenic
940265675 2:151833271-151833293 CTGTGTTTTTGTAGGGATGGTGG - Exonic
940663977 2:156584110-156584132 CTGTGTGTGTGTCGGGATGGGGG - Exonic
941870948 2:170385104-170385126 CAGGGTGTATGGGGGGAGGAAGG + Intronic
942064152 2:172254302-172254324 CAGTGTGTAGCCAGGAATGAGGG + Intergenic
942735149 2:179102050-179102072 GAATGTGTATTTAGGGATGGAGG - Exonic
943060073 2:183033453-183033475 CAGTGTGTAAGTAGGATTGTCGG - Intronic
943118561 2:183705858-183705880 AAGTGTGTGTGTAGGTATGTGGG + Intergenic
943567960 2:189539211-189539233 CAGTATGTATATAGAGAGGAGGG - Intergenic
945385423 2:209193696-209193718 CAGTGTGAGTGTGGGGGTGAGGG - Intergenic
945599276 2:211838322-211838344 CAGAGGCTATGTAGAGATGATGG - Intronic
946507666 2:220318718-220318740 CAGTGTGTGTGTGGGTATGGGGG - Intergenic
948569474 2:238908716-238908738 CAGTGTGTGTGTGGGTATGTGGG + Intronic
948964603 2:241367962-241367984 CTGTGTGTATGTGGGGGTGGAGG - Intronic
1168868529 20:1109296-1109318 CTGTGTGTATGTAGGGTGGTGGG - Intergenic
1168922527 20:1552406-1552428 CAGTGGAGATGTAGGGTTGAAGG - Intronic
1169163822 20:3406509-3406531 CAGTGTGGAGGTTGGAATGATGG - Intronic
1169212537 20:3775418-3775440 CAGTGTGTGTGAAGGGCTAACGG - Intergenic
1171085022 20:22230534-22230556 CAGTGTGTATGGGAGAATGAAGG + Intergenic
1172616351 20:36288054-36288076 CTCTGCGTATGTAGGGATGGGGG - Intergenic
1174533483 20:51233104-51233126 CAGTGCTTATCTAGGGAGGAGGG + Intergenic
1175629310 20:60519913-60519935 CAGTGTCTACATAGGGCTGATGG - Intergenic
1175984037 20:62755364-62755386 GAGGGTGGATGGAGGGATGAAGG - Intronic
1177993637 21:28069222-28069244 GAGTGTGTATGTATGTATGTGGG + Intergenic
1179261704 21:39763675-39763697 CAGGGTGAGTGTGGGGATGATGG - Intronic
1180567781 22:16689974-16689996 CACTGTGCATGTGGTGATGAGGG + Intergenic
1182476967 22:30581670-30581692 CAGTGTGGGTGCAGGGATGGGGG + Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG + Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
952743871 3:36760201-36760223 CACTGTGTTTGGAGAGATGATGG - Intergenic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
954608909 3:51933987-51934009 CAGTGAGTTTGTGAGGATGAAGG + Intronic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
957582507 3:82092612-82092634 CAGTGTGTATGTAGGGGGTGAGG + Intergenic
957590029 3:82184859-82184881 GTGTGTGTATGTTGGGATGGGGG + Intergenic
958065674 3:88542471-88542493 GTGTGTGTGTGTTGGGATGATGG + Intergenic
958428163 3:94003926-94003948 CATTGTAAATGTAGGGACGATGG + Intronic
959789792 3:110345702-110345724 CAGTGTTTATTTGTGGATGAGGG + Intergenic
960421969 3:117457627-117457649 CAGTGTGTAAGGAGGAATGAAGG + Intergenic
960899464 3:122540388-122540410 GAGCGTGTATGTATGGATGTGGG - Intronic
961207953 3:125102266-125102288 CAGGGTGTATGAAGGCAGGAAGG + Intronic
961908234 3:130285037-130285059 CATTCTGTATGTAGGAAAGATGG - Intergenic
962129044 3:132652814-132652836 CAGTGTGTAGGTGGGGGTAAAGG + Intronic
964690327 3:159442777-159442799 CAGAGTGAATGTGGGGATGGAGG + Intronic
964705868 3:159617883-159617905 GAATGGGTATGTAGGGATGAAGG - Intronic
965978035 3:174649710-174649732 CTGTGTGTATGTATGTATAAAGG - Intronic
966891909 3:184413350-184413372 GAGTGTGTATGTGAGGATGAAGG + Intronic
969487050 4:7478200-7478222 CAGTGAGTATGCAGTGATGTGGG + Intronic
970663165 4:18308623-18308645 CAGTGAGTCTCAAGGGATGATGG + Intergenic
971598100 4:28557554-28557576 CACTGTGTATGTTGCTATGATGG + Intergenic
972319002 4:37955333-37955355 CTCAGTGTATGTGGGGATGAGGG + Intronic
972790999 4:42370952-42370974 CAGTGTGTATGTATGTGGGAGGG + Intergenic
973963846 4:56140161-56140183 CACTGTGGATGCAGGGATAAAGG - Intergenic
974600826 4:64076995-64077017 CATTTTTTATGAAGGGATGAAGG + Intergenic
975382038 4:73711800-73711822 TAGTGTGTGTGTAGGAAGGAGGG + Intergenic
975459063 4:74629324-74629346 CTGTGTGCATGAAGGAATGAAGG - Intergenic
975698457 4:77038188-77038210 TAGTTTGTATGTAGGTATGAAGG + Exonic
979021375 4:115503142-115503164 AAGTGTGTGTGTACGGATAAGGG + Intergenic
980272830 4:130608938-130608960 CAGTTTGTATGTAAGAATCAGGG - Intergenic
981778273 4:148395060-148395082 CAATGTGTGTGTTGGGATGGGGG + Intronic
982810114 4:159814630-159814652 CAGTGTGTATGTGGAGAATAGGG + Intergenic
982929136 4:161379477-161379499 CAGTGTGTGTGTATGGGGGAGGG + Intergenic
983109106 4:163726045-163726067 CTGTATATATGTAGGGATGGGGG - Intronic
983959725 4:173737944-173737966 CAGTGTGTATATTGGGATGATGG - Intergenic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
984720791 4:182970844-182970866 GAGTGGGGATGTAGGGAGGAAGG + Intergenic
985198204 4:187455921-187455943 CAGAGTGTATGAGGGGCTGATGG + Intergenic
985968949 5:3360347-3360369 CAGTGGGTATTTAGGGAGGAAGG - Intergenic
988069290 5:26266488-26266510 GAGTGTGAATGTAGAGATGCTGG + Intergenic
989124876 5:38042758-38042780 CAGTGTGTTTGTAGGGAAAACGG - Intergenic
989769379 5:45125435-45125457 CAGTGTCCTTGTAGTGATGAAGG + Intergenic
990691381 5:58368025-58368047 CAGTGTGAATAATGGGATGATGG + Intergenic
992067904 5:73124154-73124176 CATTGTGTATGTACACATGATGG - Intronic
993890818 5:93469739-93469761 GAGTGTGGATGTAGGGAATAGGG - Intergenic
996899276 5:128525070-128525092 ACGTGTGTATGTATGTATGAGGG - Intronic
997734269 5:136201918-136201940 CAGTGTACATGAAGTGATGAGGG + Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998892540 5:146761933-146761955 CAGAGTGTATGTGGGAATGATGG + Intronic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
1000299454 5:159942636-159942658 TTGTGTGTTTGTAGAGATGAGGG - Intronic
1000698818 5:164422393-164422415 CAGAGGGCATGTAGTGATGAGGG - Intergenic
1000788624 5:165577043-165577065 CAGTATATATCTAGGGATTAGGG - Intergenic
1004567129 6:16808430-16808452 CAGTGTCCTTGCAGGGATGAGGG - Intergenic
1004571615 6:16851265-16851287 CACTGTGTATGCATGGAAGAGGG + Intergenic
1004771292 6:18785553-18785575 CTGTGTGTATGTAGGTATGGGGG - Intergenic
1006962394 6:37946493-37946515 CAGTGTGCATGAAGGAATGGGGG - Intronic
1007028925 6:38609075-38609097 CAGTGTGTATGTAAGAATAAAGG + Intronic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007493254 6:42240803-42240825 CAATGTGTATGTAGTGCTGTGGG - Intronic
1007921365 6:45612472-45612494 CAGTGATTGTTTAGGGATGAAGG - Intronic
1010107747 6:72189079-72189101 TAGTGGGTCTCTAGGGATGATGG + Intronic
1014561479 6:122896224-122896246 CTGTGTGTATGTTGGGTTGTGGG + Intergenic
1017590835 6:155976498-155976520 CAGTGTGTATTCTGGGAAGAGGG - Intergenic
1017631247 6:156397906-156397928 CATTGTGTATGTATGTATGGTGG - Intergenic
1017917191 6:158840475-158840497 TAGTATGTATGTATGGAGGAGGG - Intergenic
1018028759 6:159825835-159825857 CAGGGTGTATCTTAGGATGAGGG - Intergenic
1018209422 6:161466547-161466569 CACTGTGGATGTTAGGATGAAGG + Intronic
1019549418 7:1594684-1594706 GAGGGTGGATGTAGGGAGGATGG - Intergenic
1019714366 7:2531578-2531600 CAGGGTGTGTGTGGGGATGGGGG - Intergenic
1019741957 7:2679494-2679516 CAGGGTGTGTGTGGGGATGGGGG + Intergenic
1020240038 7:6387047-6387069 CAATGTGTATGTGGTGATAAAGG + Intronic
1024978262 7:55133623-55133645 CAGTGTGGACGTGGGGATGACGG - Intronic
1029221853 7:98996124-98996146 AGGTGTGTATGATGGGATGAGGG - Intronic
1030232732 7:107225032-107225054 CTGTGTGTGTGTATGTATGAGGG + Intronic
1031468969 7:122146686-122146708 CTGAGTGTATGCAGGGATAAAGG + Intergenic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1032471457 7:132182078-132182100 CAATGTGAGTGTAGGGCTGATGG - Exonic
1033249723 7:139748227-139748249 GAGTCTGGATGTAGGGCTGAGGG - Intronic
1033663421 7:143419366-143419388 CAGTGTGAAAGTAGGGGTGCTGG + Intergenic
1033902845 7:146163765-146163787 AAGTGTGTTTGTAAGGAAGAGGG + Intronic
1034309986 7:150079029-150079051 CCCTGTGTATGTGGGGATGAAGG - Intergenic
1034375478 7:150640331-150640353 GAGTGTTTTTGTATGGATGATGG - Intergenic
1034796859 7:154021592-154021614 CCCTGTGTATGTGGGGCTGAAGG + Intronic
1035180032 7:157082625-157082647 CAGTGTGATTGAAGGGATGCAGG + Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1038007502 8:23445183-23445205 CAGGTTGTGTGTTGGGATGAGGG - Intronic
1040598358 8:48861361-48861383 CACTGAGTATGCAGTGATGACGG + Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041467470 8:58171327-58171349 CAGTGGGTGTCCAGGGATGAAGG - Intronic
1041761767 8:61375053-61375075 AAGAGTTTATGGAGGGATGAAGG - Intronic
1041877495 8:62707042-62707064 GTGTGTGTATGTATGTATGATGG - Intronic
1043108671 8:76149860-76149882 CAGTGGTTATGTTGAGATGATGG - Intergenic
1043184963 8:77137044-77137066 GTGTGTGTATGTTGGGATGTGGG + Intergenic
1043226033 8:77731571-77731593 GAGTGAGTATGTAGGGATAAAGG - Intergenic
1044833090 8:96269213-96269235 CAGAGTGGAAGTAGGTATGAGGG - Intronic
1045743532 8:105389048-105389070 GTGTGTGTGTGTAGGCATGAGGG + Intronic
1045897421 8:107236428-107236450 CAGTGTGTATGGGTGCATGAAGG + Intergenic
1045908648 8:107379080-107379102 CAATGGATATTTAGGGATGAGGG + Intronic
1046144288 8:110137355-110137377 GTGTGTATATGTTGGGATGAGGG + Intergenic
1046594220 8:116241421-116241443 CAGTGTCTATGTAGTGGGGAGGG + Intergenic
1047243017 8:123110646-123110668 GTGTGTGTATGTTGGGATGTGGG - Intronic
1049301720 8:141874137-141874159 CAGTGTGTAGGTGAGGGTGATGG + Intergenic
1049301771 8:141874378-141874400 CAGTGTGTAGGTGAGGGTGATGG + Intergenic
1049390387 8:142365514-142365536 CATTGTGTATTTGGGGATCAAGG + Intronic
1051056803 9:12997073-12997095 CAGTGTATTTGTAGGTAAGAAGG - Intergenic
1051198611 9:14591636-14591658 CAATTTGTATGAAGGGATCATGG - Intergenic
1051561428 9:18445401-18445423 CATTTTGTATGTAGGAATGTAGG - Intergenic
1055505463 9:76943812-76943834 CAGAGTATATGTACGGATGCTGG - Intergenic
1055656836 9:78459072-78459094 TGGTGTGTATGTAGTGATCAGGG + Intergenic
1056548404 9:87631994-87632016 GAGTATATATGTAGAGATGAAGG + Intronic
1056548408 9:87632022-87632044 GAGTATATATGTAGGGATGAAGG + Intronic
1056548414 9:87632150-87632172 ATGTATGTATGTAGAGATGAAGG + Intronic
1056548419 9:87632205-87632227 GAGTATATATGTAGGGATAAAGG + Intronic
1056548426 9:87632259-87632281 CAGTATATATGTAGGAATGAAGG + Intronic
1056548435 9:87632342-87632364 GAGTACATATGTAGGGATGAAGG + Intronic
1056548445 9:87632426-87632448 AAGTGTGTATGTAAGGATGAAGG + Intronic
1056548452 9:87632482-87632504 CAGTATATATGTAGGGATGAAGG + Intronic
1056548456 9:87632538-87632560 GAGTATACATGTAGGGATGAAGG + Intronic
1056548460 9:87632566-87632588 GAGTATACATGTAGGGATGAAGG + Intronic
1056548463 9:87632594-87632616 GAGTATGTATATAGGAATGAAGG + Intronic
1056548467 9:87632622-87632644 CAGTATATATGTAGGGATGAAGG + Intronic
1056548478 9:87632734-87632756 GAGTATATATGTAGGGAAGAAGG + Intronic
1056548483 9:87632790-87632812 CAGTGTATATGTAGGGATGAAGG + Intronic
1056548491 9:87632874-87632896 GAGTATACATGTAGGGATGAAGG + Intronic
1056548497 9:87632936-87632958 CAGTATATACGTAGGGATGAAGG + Intronic
1056548506 9:87633018-87633040 GAGTATATATGTAGGGATGAAGG + Intronic
1056548514 9:87633129-87633151 GAGTGTACATGTAGGGATGAAGG + Intronic
1056548518 9:87633157-87633179 GAGTATATATGTAGGGATGAAGG + Intronic
1056548522 9:87633185-87633207 CAGTATATATGTAGGGATGAAGG + Intronic
1056548525 9:87633213-87633235 GAGTACATATGTAGGGATGAAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1061847760 9:133397437-133397459 CAGTGTGTAGGGATGGATGGAGG - Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062288505 9:135784392-135784414 CTGTGTGTGTGTATGCATGAGGG + Intronic
1186312667 X:8337648-8337670 CAATGTGTCTGCAGGGATGCAGG + Intergenic
1186350942 X:8738969-8738991 CAGTGTGACTGTAGAGATGCAGG - Intergenic
1186672280 X:11780040-11780062 GTGTGTGTGTGTAGAGATGAGGG - Intergenic
1186855467 X:13621946-13621968 GAGTGTGTAAATTGGGATGATGG - Intronic
1187281045 X:17859018-17859040 CTGTGTGTATGTGGGGGTGTGGG + Intronic
1190407621 X:50103311-50103333 CTGTGTGTATGTGGAAATGAGGG + Intergenic
1190420817 X:50282495-50282517 CAGTGTGTATGTAGGGGACATGG + Intronic
1195084363 X:101400355-101400377 CAGGGTGCATGTAGTGAAGATGG + Intronic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1195713064 X:107790588-107790610 CAGTGTGTATGAAGGCATGAAGG - Intronic
1196023937 X:111020489-111020511 CAATGTGAATGTAGGCCTGAGGG + Intronic
1196530468 X:116780753-116780775 CAGTGTGAGTGTAGTTATGATGG + Intergenic
1196602163 X:117614710-117614732 CAGTGAGTATGGAGGTATTAGGG - Intergenic
1198329893 X:135612581-135612603 CAGTGTCTATGAAGTGAGGATGG + Intergenic
1199571091 X:149267992-149268014 GTGTGTGTATGTATGGGTGAGGG + Intergenic
1201414894 Y:13738610-13738632 CAGTGTGACTGTAGAGATGCAGG + Intergenic