ID: 999271363

View in Genome Browser
Species Human (GRCh38)
Location 5:150298107-150298129
Sequence CATGGTGACCTGCATGGATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999271363_999271378 28 Left 999271363 5:150298107-150298129 CCTCATCCATGCAGGTCACCATG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 999271378 5:150298158-150298180 CCATGGTGCGGTAGCGGTACAGG 0: 1
1: 0
2: 0
3: 1
4: 30
999271363_999271373 16 Left 999271363 5:150298107-150298129 CCTCATCCATGCAGGTCACCATG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 999271373 5:150298146-150298168 GGGCCACATTGCCCATGGTGCGG 0: 1
1: 0
2: 2
3: 31
4: 167
999271363_999271371 11 Left 999271363 5:150298107-150298129 CCTCATCCATGCAGGTCACCATG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 999271371 5:150298141-150298163 CCGCCGGGCCACATTGCCCATGG 0: 1
1: 0
2: 0
3: 1
4: 75
999271363_999271367 -5 Left 999271363 5:150298107-150298129 CCTCATCCATGCAGGTCACCATG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 999271367 5:150298125-150298147 CCATGGCCGCGTACTTCCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 23
999271363_999271375 22 Left 999271363 5:150298107-150298129 CCTCATCCATGCAGGTCACCATG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 999271375 5:150298152-150298174 CATTGCCCATGGTGCGGTAGCGG 0: 1
1: 0
2: 1
3: 4
4: 68
999271363_999271368 -4 Left 999271363 5:150298107-150298129 CCTCATCCATGCAGGTCACCATG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 999271368 5:150298126-150298148 CATGGCCGCGTACTTCCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999271363 Original CRISPR CATGGTGACCTGCATGGATG AGG (reversed) Exonic