ID: 999271365

View in Genome Browser
Species Human (GRCh38)
Location 5:150298113-150298135
Sequence CGCGGCCATGGTGACCTGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999271365_999271373 10 Left 999271365 5:150298113-150298135 CCATGCAGGTCACCATGGCCGCG 0: 1
1: 0
2: 0
3: 12
4: 106
Right 999271373 5:150298146-150298168 GGGCCACATTGCCCATGGTGCGG 0: 1
1: 0
2: 2
3: 31
4: 167
999271365_999271368 -10 Left 999271365 5:150298113-150298135 CCATGCAGGTCACCATGGCCGCG 0: 1
1: 0
2: 0
3: 12
4: 106
Right 999271368 5:150298126-150298148 CATGGCCGCGTACTTCCGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 63
999271365_999271378 22 Left 999271365 5:150298113-150298135 CCATGCAGGTCACCATGGCCGCG 0: 1
1: 0
2: 0
3: 12
4: 106
Right 999271378 5:150298158-150298180 CCATGGTGCGGTAGCGGTACAGG 0: 1
1: 0
2: 0
3: 1
4: 30
999271365_999271371 5 Left 999271365 5:150298113-150298135 CCATGCAGGTCACCATGGCCGCG 0: 1
1: 0
2: 0
3: 12
4: 106
Right 999271371 5:150298141-150298163 CCGCCGGGCCACATTGCCCATGG 0: 1
1: 0
2: 0
3: 1
4: 75
999271365_999271375 16 Left 999271365 5:150298113-150298135 CCATGCAGGTCACCATGGCCGCG 0: 1
1: 0
2: 0
3: 12
4: 106
Right 999271375 5:150298152-150298174 CATTGCCCATGGTGCGGTAGCGG 0: 1
1: 0
2: 1
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999271365 Original CRISPR CGCGGCCATGGTGACCTGCA TGG (reversed) Exonic