ID: 999271366

View in Genome Browser
Species Human (GRCh38)
Location 5:150298125-150298147
Sequence CCGGCGGAAGTACGCGGCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 18}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999271366_999271381 23 Left 999271366 5:150298125-150298147 CCATGGCCGCGTACTTCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 999271381 5:150298171-150298193 GCGGTACAGGTACTCACGAGGGG 0: 1
1: 0
2: 0
3: 0
4: 19
999271366_999271380 22 Left 999271366 5:150298125-150298147 CCATGGCCGCGTACTTCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 999271380 5:150298170-150298192 AGCGGTACAGGTACTCACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 16
999271366_999271379 21 Left 999271366 5:150298125-150298147 CCATGGCCGCGTACTTCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 999271379 5:150298169-150298191 TAGCGGTACAGGTACTCACGAGG 0: 1
1: 0
2: 0
3: 2
4: 14
999271366_999271371 -7 Left 999271366 5:150298125-150298147 CCATGGCCGCGTACTTCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 999271371 5:150298141-150298163 CCGCCGGGCCACATTGCCCATGG 0: 1
1: 0
2: 0
3: 1
4: 75
999271366_999271375 4 Left 999271366 5:150298125-150298147 CCATGGCCGCGTACTTCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 999271375 5:150298152-150298174 CATTGCCCATGGTGCGGTAGCGG 0: 1
1: 0
2: 1
3: 4
4: 68
999271366_999271373 -2 Left 999271366 5:150298125-150298147 CCATGGCCGCGTACTTCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 999271373 5:150298146-150298168 GGGCCACATTGCCCATGGTGCGG 0: 1
1: 0
2: 2
3: 31
4: 167
999271366_999271378 10 Left 999271366 5:150298125-150298147 CCATGGCCGCGTACTTCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 999271378 5:150298158-150298180 CCATGGTGCGGTAGCGGTACAGG 0: 1
1: 0
2: 0
3: 1
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999271366 Original CRISPR CCGGCGGAAGTACGCGGCCA TGG (reversed) Exonic