ID: 999271371

View in Genome Browser
Species Human (GRCh38)
Location 5:150298141-150298163
Sequence CCGCCGGGCCACATTGCCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999271363_999271371 11 Left 999271363 5:150298107-150298129 CCTCATCCATGCAGGTCACCATG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 999271371 5:150298141-150298163 CCGCCGGGCCACATTGCCCATGG 0: 1
1: 0
2: 0
3: 1
4: 75
999271366_999271371 -7 Left 999271366 5:150298125-150298147 CCATGGCCGCGTACTTCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 18
Right 999271371 5:150298141-150298163 CCGCCGGGCCACATTGCCCATGG 0: 1
1: 0
2: 0
3: 1
4: 75
999271365_999271371 5 Left 999271365 5:150298113-150298135 CCATGCAGGTCACCATGGCCGCG 0: 1
1: 0
2: 0
3: 12
4: 106
Right 999271371 5:150298141-150298163 CCGCCGGGCCACATTGCCCATGG 0: 1
1: 0
2: 0
3: 1
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999271371 Original CRISPR CCGCCGGGCCACATTGCCCA TGG Exonic