ID: 999273030

View in Genome Browser
Species Human (GRCh38)
Location 5:150309081-150309103
Sequence CATTATCTGCATCTTGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999273029_999273030 2 Left 999273029 5:150309056-150309078 CCTATAAGGTAGGTAAAATTATT 0: 1
1: 2
2: 48
3: 302
4: 1337
Right 999273030 5:150309081-150309103 CATTATCTGCATCTTGCCCATGG No data
999273028_999273030 6 Left 999273028 5:150309052-150309074 CCTACCTATAAGGTAGGTAAAAT 0: 1
1: 0
2: 2
3: 18
4: 200
Right 999273030 5:150309081-150309103 CATTATCTGCATCTTGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999273030 Original CRISPR CATTATCTGCATCTTGCCCA TGG Intronic
No off target data available for this crispr