ID: 999274359

View in Genome Browser
Species Human (GRCh38)
Location 5:150319163-150319185
Sequence CCTCCTGGAATGCAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999274359_999274364 -7 Left 999274359 5:150319163-150319185 CCCTCCAGCTGCATTCCAGGAGG 0: 1
1: 0
2: 1
3: 30
4: 251
Right 999274364 5:150319179-150319201 CAGGAGGAAATCTGACCAAATGG 0: 1
1: 0
2: 2
3: 39
4: 376
999274359_999274365 5 Left 999274359 5:150319163-150319185 CCCTCCAGCTGCATTCCAGGAGG 0: 1
1: 0
2: 1
3: 30
4: 251
Right 999274365 5:150319191-150319213 TGACCAAATGGTTGAAACTGAGG 0: 1
1: 0
2: 2
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999274359 Original CRISPR CCTCCTGGAATGCAGCTGGA GGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
901200899 1:7466908-7466930 CCTCTTGCAATCCAGCTGGAAGG - Intronic
901628222 1:10635501-10635523 CCTCCTGGAATGCAGCCCACAGG - Intergenic
902370749 1:16005423-16005445 GTTCCTGGAAGGCAGATGGATGG + Intronic
902771981 1:18650438-18650460 CATCCTGGGATGGTGCTGGAAGG + Intronic
902916064 1:19640448-19640470 CCTCCAGGTATGGAGCTGGGAGG - Intronic
903510825 1:23873800-23873822 CCACCAGGACTGCTGCTGGAAGG + Exonic
903927229 1:26839216-26839238 CTGCCTGGAAGGCAGCAGGAGGG + Intronic
905899800 1:41574007-41574029 CCTCCAGAAAGGCAGCTGGCAGG - Intronic
906529746 1:46516973-46516995 TTTCTTGAAATGCAGCTGGAGGG - Intergenic
907388338 1:54140092-54140114 CCTCCTGGCATTCTCCTGGATGG + Exonic
907832319 1:58076885-58076907 GTTCATGGAATGAAGCTGGAAGG + Intronic
908805549 1:67927650-67927672 CCTCCTGGAAAGCTGCAGGGTGG - Intergenic
911043267 1:93608541-93608563 CCTCCAGGACTGCAGAGGGATGG - Intronic
912735456 1:112146082-112146104 CTTCCTGGAATGAGGGTGGAGGG - Intergenic
914220629 1:145678774-145678796 CTTCCTGGGATGCTGGTGGAAGG - Intronic
914473208 1:148001644-148001666 CTTCCTGGGATGCTGGTGGAAGG - Intergenic
916512089 1:165481606-165481628 GCAGCTGGAGTGCAGCTGGAGGG - Intergenic
916712876 1:167427499-167427521 CCTCCTGGAGTGCAGGAGGAAGG - Intergenic
916918024 1:169431088-169431110 CTTCCTAGAATGCAGTTGAAAGG - Intronic
919518052 1:198551400-198551422 GCTCCTGAAATGCAGCTGGCTGG + Intergenic
919924724 1:202186403-202186425 CCTCCTGCAGTGCACCAGGATGG - Intergenic
922090472 1:222390735-222390757 CCTCCTGGGATGGACCTGAATGG + Intergenic
922703350 1:227775116-227775138 CCTCCAGGAATGCAGCGGAGGGG + Intronic
922798059 1:228351302-228351324 CCACCTGGAATCCACCCGGAGGG - Exonic
923084199 1:230689995-230690017 CCTCCTGGAATGATGATGGTAGG - Exonic
924570960 1:245237386-245237408 GCTCCTGGAAGCCATCTGGATGG + Intronic
924707967 1:246513452-246513474 CCTCCTGGCCTCCAGCTGGCTGG - Intergenic
1062828742 10:590861-590883 GCTCCTGGACTCCTGCTGGAGGG - Intronic
1064026180 10:11850474-11850496 CCTCCTGGAATGTACAGGGAAGG + Intronic
1067275875 10:44833784-44833806 GCTCCTGGAGTGTAACTGGATGG + Intergenic
1067512242 10:46905778-46905800 CCTGGTGGAATGCCTCTGGAAGG - Intergenic
1067526117 10:47039677-47039699 CCTCGTGGAATGATGCTGCAGGG + Intergenic
1067650002 10:48146044-48146066 CCTGGTGGAATGCCTCTGGAAGG + Intergenic
1070756882 10:78998752-78998774 TTTCCTGGGAAGCAGCTGGAGGG + Intergenic
1071033467 10:81213492-81213514 TTTGCTGGAATGCAGTTGGATGG + Intergenic
1071384702 10:85107383-85107405 CCTCCTGCTATTAAGCTGGAGGG + Intergenic
1071440140 10:85682809-85682831 GCTCCTGGAATGTAGCTGCTTGG + Intronic
1075608095 10:123830647-123830669 CCTGTTGGAATGCAGCTGTCAGG - Intronic
1075634013 10:124018160-124018182 CCTCCAGGAATGAATCTTGAGGG - Intronic
1075792384 10:125094381-125094403 TCTCCTTGATTGCAGATGGAAGG - Intronic
1077103989 11:833953-833975 CATCATGGAATGGAGCTGGAGGG - Intronic
1077194579 11:1272735-1272757 CCTGCGGGAATGCAGGAGGAGGG + Intergenic
1077270779 11:1678670-1678692 CCTGCTGCAATGGAGCTGTAGGG - Intergenic
1080571993 11:33565177-33565199 CCACCTGGAAGGCAGCAGAAAGG - Intronic
1084332956 11:68440316-68440338 CTTCCTGGAAAACAGCTGGATGG + Intronic
1086143559 11:83525653-83525675 CCCCCTGGAGTGCAGCAGTATGG + Intronic
1087022549 11:93617940-93617962 CCACCTGGAATGCAGATGCATGG + Intergenic
1087081230 11:94172919-94172941 CATTCTGGAGTGCAGCTGGAGGG - Intronic
1089975962 11:122731633-122731655 CCTAGTGGAATGGAGTTGGATGG + Intronic
1090421268 11:126576824-126576846 CCTACTGGAATGCAGAAGGAAGG + Intronic
1091293521 11:134456133-134456155 CCTCCTAAAATGCAGGTAGATGG - Intergenic
1094276560 12:28683507-28683529 ATTCCTGGAATGCCGCTGGCTGG + Intergenic
1096194428 12:49640750-49640772 CCTCTTGAAATGCAGCAGAAAGG - Exonic
1096731657 12:53618303-53618325 TCTCCTGGAAAGCAGAAGGATGG - Intronic
1096876235 12:54632550-54632572 TCTCTTGGAATGCAGCGGGCAGG + Intronic
1097422474 12:59397366-59397388 CCTTCTGGAATGCCTCTTGAGGG - Intergenic
1097959657 12:65520153-65520175 CCTCCTGGGATGCCGTTGAAAGG + Intergenic
1102470179 12:113155307-113155329 GCTCCTGGGACGCAGCAGGATGG + Exonic
1102705991 12:114880980-114881002 TTTCCTGGGATGAAGCTGGATGG - Intergenic
1103454443 12:121053807-121053829 CTTCCTGGACTGGACCTGGAGGG + Intergenic
1104459184 12:128940657-128940679 CCTTCAGGAATGCAACAGGACGG + Intronic
1104483603 12:129130172-129130194 CCTCCAGGAGTTCTGCTGGAGGG + Intronic
1107970200 13:45633994-45634016 GCTGGTGGAATGCAGGTGGAAGG + Intergenic
1108558244 13:51617682-51617704 CCTCCTGGATTGCAGATGAAAGG - Intronic
1109221763 13:59647206-59647228 ACTCCGTGAAAGCAGCTGGAAGG + Intergenic
1112190647 13:97174181-97174203 GCTTCTGGAATGAAGCTGGTGGG + Intergenic
1114706678 14:24734379-24734401 CATCCTGTAATGCAGTTGGAGGG + Intergenic
1115853293 14:37604136-37604158 CCTCCTGGACTGTAGCTTGGAGG - Intronic
1116739434 14:48735625-48735647 TCTCCTTCAATGCAGCTGCAAGG - Intergenic
1116957091 14:50935865-50935887 AGTCCTGCAATCCAGCTGGATGG + Intronic
1117273206 14:54166121-54166143 CCTCCTGAATTCCAGCTGTAGGG - Intergenic
1119122348 14:72091093-72091115 CCTGGAGGAAGGCAGCTGGAGGG - Intronic
1119280500 14:73403162-73403184 CTTCCTTGAATGTAGGTGGAAGG + Intronic
1120722572 14:87904693-87904715 CCTCATGGAAGGCTGCTGGGAGG - Intronic
1120990069 14:90367590-90367612 CCTTCTGGGAGGCAGCAGGAAGG + Intergenic
1121635889 14:95453686-95453708 CCTGCAGGAATTCAGCAGGAAGG + Intronic
1121674102 14:95738550-95738572 CCTCCAGGATTTCAGCAGGAGGG - Intergenic
1121712017 14:96045496-96045518 CCTCATGGAGTGGAGTTGGATGG + Intronic
1121713696 14:96057789-96057811 CCTCCTGCATTGTACCTGGAAGG + Intronic
1122861398 14:104584219-104584241 CCCCCTGGAATGCTGCTGCAGGG + Intronic
1122880373 14:104688111-104688133 ATTCTTGGAATGCACCTGGAAGG - Intergenic
1125358899 15:38845431-38845453 CCTTCTGGGAGGCAGCAGGAAGG + Intergenic
1126556517 15:49994221-49994243 CCTCCTGGAAGGCAGGTGTCTGG - Intronic
1126875195 15:53033888-53033910 GCTCCAGGTTTGCAGCTGGAAGG + Intergenic
1127585574 15:60374859-60374881 CCTCCTGGAAGGGAACGGGAGGG - Intronic
1129670588 15:77605749-77605771 TCTCCTGCAGGGCAGCTGGAAGG - Intergenic
1129809902 15:78501841-78501863 GCTCCTGGATGGCATCTGGATGG - Intergenic
1130608123 15:85335860-85335882 CCTCCTGGAATCCTGTAGGATGG + Intergenic
1132041202 15:98525620-98525642 CTTCCTGGGATGGAGATGGAGGG - Intergenic
1132774706 16:1586663-1586685 CCTCCTGAAATGCCACGGGAAGG - Intronic
1132936225 16:2482713-2482735 ACACCTGGGAAGCAGCTGGAGGG + Intronic
1133288017 16:4699670-4699692 CCTTCTGGAATGCCACTGTATGG + Intronic
1133489847 16:6256963-6256985 ACTCATGGAATGCAGGTGTAAGG - Intronic
1134683373 16:16141969-16141991 CCTCCTGGAAGGGACCTGGTTGG + Exonic
1136113636 16:28080666-28080688 CCACCTGGAAGGCAGCTGTGAGG + Intergenic
1136299122 16:29321341-29321363 CCTCCTGGAAGTCTTCTGGATGG + Intergenic
1136458371 16:30395221-30395243 CCTCCTGGGCTGCAGCTGGGTGG - Exonic
1137252213 16:46748597-46748619 CCTCCTGGAGCCCAGCTGGCAGG - Intronic
1138696080 16:58814779-58814801 CCTCCTGGAAAGGAGCGGGGTGG + Intergenic
1139849636 16:69942985-69943007 CCTCCTGGAAGGCATCAGGGTGG - Intergenic
1141184936 16:81780073-81780095 GCTCCTGGATTCCAGCAGGACGG + Intronic
1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG + Intronic
1142899863 17:3005144-3005166 CCTCCAGGAATGCAGATGAGAGG + Intronic
1143635412 17:8161673-8161695 CCGCCTGGAGTGCATCTGCACGG + Exonic
1144406486 17:14957358-14957380 CCTCCTGGGATAGAGCTTGAGGG + Intergenic
1144665589 17:17100026-17100048 CCTCCTGGGATGGCGCTGGGTGG + Intronic
1144832967 17:18141955-18141977 CCTCCTGGAGCGGGGCTGGAGGG - Intronic
1146940987 17:36844385-36844407 CTTCCTGGAATGGGGCTGAATGG - Intergenic
1147331067 17:39699939-39699961 CTTGTTGGAATGCAGTTGGAGGG + Intronic
1148088709 17:45009783-45009805 CCTCCTGGTCAGCAGCTGTAGGG + Intergenic
1150472161 17:65446579-65446601 CCTACTGCACTGCATCTGGAAGG - Intergenic
1151400868 17:73855210-73855232 CCTTGTTGAATGCAGCTGGCTGG - Intergenic
1153048053 18:874400-874422 CATCTGGGAATGCAGCTGGTAGG + Intergenic
1153129098 18:1834284-1834306 CCTCCTGGAAGGGAGCAAGATGG + Intergenic
1153672816 18:7428716-7428738 GCTCCAGGGCTGCAGCTGGAAGG + Intergenic
1156476325 18:37408050-37408072 GCGGCTGGGATGCAGCTGGAAGG + Intronic
1156788133 18:40939867-40939889 CCTCCTGGAAAGCAGCAGCCGGG + Intergenic
1157327810 18:46681485-46681507 CCTCCTGGGGTTCATCTGGAAGG - Intronic
1160563475 18:79772825-79772847 CCAGCTGGAAAGCAGCAGGAAGG + Intergenic
1160958841 19:1708241-1708263 CCTCCTGGAAGGAGGCAGGAAGG - Intergenic
1161572162 19:5036530-5036552 CCGCCTGGGAGGCAGCTGGTGGG - Intronic
1162060140 19:8089945-8089967 GCTCCTGAAAGGCAGCTGGACGG + Exonic
1162099610 19:8331914-8331936 CCTCCTACTTTGCAGCTGGAGGG - Intronic
1165391328 19:35540637-35540659 CCTGCTGGAGTGCAGGTGGCTGG - Intronic
1165506910 19:36238827-36238849 CCTCCTGCCATGCAGCTGGGGGG - Intronic
1165790987 19:38492483-38492505 CTTCCAGGAATTCAGCTAGATGG + Exonic
1166416182 19:42596173-42596195 CCTCCTGGGGTGCAGAGGGAAGG + Intronic
1166945156 19:46391740-46391762 CCTCCTGAACTGCAGCGGCAGGG - Intronic
1168313493 19:55473374-55473396 CCTCCTGGGATGGGGGTGGATGG + Intergenic
925166656 2:1719722-1719744 CCTCCTGGACCGCAGCTGGTTGG - Intronic
925166821 2:1720834-1720856 CCTCCCGGACCGCAGCTGGTTGG + Intronic
925223873 2:2165032-2165054 CATCCAGGAAAGCAGCTGGCAGG - Intronic
925812190 2:7711639-7711661 CTTCCTGGTTTGCAGGTGGAGGG - Intergenic
926408400 2:12577083-12577105 CCTGCTGGACTGCAGCTTGAGGG - Intergenic
926579048 2:14614767-14614789 CCCCCAGGAATGCAGAAGGAAGG - Intergenic
927144478 2:20153567-20153589 CCTCCAGGTCTTCAGCTGGATGG - Intergenic
927504360 2:23603504-23603526 CCACCTGGAAAGCAACTGGCTGG - Intronic
928331246 2:30359659-30359681 TCTCATGGAACGCAGCTGGAAGG + Intergenic
929611408 2:43273524-43273546 CCTACTGGAAGGCAGGAGGAAGG + Intronic
936695896 2:114948140-114948162 GCTCCCAGAATGCAACTGGAAGG - Intronic
938114968 2:128596613-128596635 CTGACTGGAATGCCGCTGGACGG + Intergenic
938685928 2:133737554-133737576 CCTGTGGGAATGCAGCAGGAGGG - Intergenic
939446840 2:142321338-142321360 CCTAGTGGAATGCCCCTGGAAGG - Intergenic
943756303 2:191560770-191560792 CCTCCGGGAAGCCAGCTGGCTGG - Intergenic
943940379 2:193986691-193986713 CTTCCTGGATTGCAGATGGCAGG - Intergenic
944362541 2:198875204-198875226 ACTCCTGGAATGCAGCTTTATGG - Intergenic
947274442 2:228374174-228374196 ACTCCTGGACTGCAGCAGAACGG - Intergenic
947356560 2:229301945-229301967 CCTCATTGAATACAGTTGGATGG + Intergenic
948873455 2:240815423-240815445 GCTCCTGAAATGCAGCTCTAGGG - Intronic
1170566378 20:17610172-17610194 CCAGCTGGACTGCAGCTGGAAGG + Intergenic
1170807080 20:19641628-19641650 CCTCATGGGGTGCAGCAGGAGGG + Intronic
1170850585 20:20000618-20000640 CCTCCTGAAATGCAACTCGGAGG - Exonic
1171475770 20:25407601-25407623 CCTCTTGGAATGCGGCTGAGCGG + Intergenic
1173249610 20:41357649-41357671 CCTACTGGCCTGCAGCCGGAGGG + Intronic
1173870490 20:46338969-46338991 ACTCCTGGAGTGGAGATGGATGG + Intergenic
1173873379 20:46355361-46355383 CCCCCTGGGATGGAGCTGAAGGG - Intronic
1175461311 20:59153647-59153669 CCTCCTGGAGTTCAGCTTGATGG - Intergenic
1175758217 20:61543849-61543871 CCTGATGGAATGGAGCTGGCAGG + Intronic
1176021520 20:62964551-62964573 CCTCCAGGAAGGCACCTGGAGGG + Intronic
1176293683 21:5059429-5059451 GCTCATGGAAGGCAGCCGGATGG + Intergenic
1176415846 21:6474414-6474436 GCTCCTGGAATGCTGCTGAGAGG + Intergenic
1176670414 21:9728816-9728838 CCACCTGGAATGAAGCAGGAAGG + Intergenic
1177081333 21:16641787-16641809 CCTCCAGGCATCCATCTGGAAGG - Intergenic
1177398069 21:20563328-20563350 CCTCTTGGAATGCTGCTGCTGGG - Intergenic
1178522050 21:33294640-33294662 CCTCCTGGCATGGACCTGTAGGG - Intronic
1178887107 21:36493182-36493204 CCTCCTGGAGAGCAGCTGTGAGG + Intronic
1179247814 21:39648891-39648913 CCTCCTGGCTTGCAGATGGTCGG - Intronic
1179623991 21:42637952-42637974 CCTCCTGCAATGGGGCTGGGCGG - Intergenic
1179691346 21:43082748-43082770 GCTCCTGGAATGCTGCTGAGAGG + Intergenic
1179863576 21:44204219-44204241 GCTCATGGAAGGCAGCCGGATGG - Intergenic
1179971645 21:44839131-44839153 CCTCTGGGAATGCTGCTGGGTGG - Intergenic
1180025570 21:45159632-45159654 ACACCAGGAATGAAGCTGGAGGG - Intronic
1181130593 22:20729309-20729331 CCACCTGGCAGGCAGCTGCACGG + Exonic
1181431441 22:22884151-22884173 CTGCCTGGAGTGCAGCTGTAAGG - Intronic
1181681816 22:24500595-24500617 CCTCCTGGCAGGCAGCTGAGAGG - Intronic
1181947833 22:26532148-26532170 CCGGCTTGAATGCAGTTGGAGGG - Intronic
1183579426 22:38714869-38714891 CCTCATGGAAAGCAGCTGACGGG + Intronic
1184684022 22:46087949-46087971 CCTCCAGGGCTGCAGCTGCAGGG + Intronic
1184723256 22:46328325-46328347 CCTCCTCGCATGCAGCTAGTGGG - Intronic
1185193809 22:49455499-49455521 CCTCCTGGAATCTAGGTGGGGGG + Intronic
1185222710 22:49636947-49636969 GCCCCTGGCATGCGGCTGGAGGG - Intronic
949953315 3:9247561-9247583 CCTCCTTAAAAGCAGCGGGAAGG - Intronic
950708995 3:14801896-14801918 CCTGCTGGAAGGCAGCTTGGAGG + Intergenic
953768871 3:45763773-45763795 CCCCAGGGAAGGCAGCTGGAGGG - Intronic
954387486 3:50251922-50251944 CTACCAGGAATGCAGCTGGCAGG - Intronic
955374774 3:58385864-58385886 CCTGCTGAAATGAAGCTGGGTGG - Intronic
955671703 3:61409296-61409318 ACACCTGGAATGCATCTTGAAGG - Intergenic
957209589 3:77242111-77242133 CCTTATGGATTGCAGCTGGCAGG + Intronic
958105537 3:89067938-89067960 CCTGCTGGAAAAAAGCTGGAAGG - Intergenic
958720553 3:97837927-97837949 CCTCCTGTAATGCACCTGTTGGG - Intronic
961339400 3:126207425-126207447 CCTCCTGGAATTTAGCTGTCAGG - Intergenic
962382934 3:134911714-134911736 CCTCCTGGAGGGTAGCTGCATGG + Intronic
964127735 3:153253627-153253649 TCTCCTGGAATACCTCTGGAAGG + Intergenic
964624748 3:158748338-158748360 CTTCCTGGAATGCAGATGCTAGG + Intronic
966930752 3:184674052-184674074 CCACCTGGACTGGAGCAGGAAGG + Intronic
968265152 3:197356994-197357016 CCTGCAGGTATGCAGCTGAAGGG - Intergenic
970440732 4:16079126-16079148 CCTCCAGCACAGCAGCTGGAAGG + Intronic
970441088 4:16082101-16082123 GCACCTGGCACGCAGCTGGAAGG + Intronic
974892430 4:67897952-67897974 CCTCCTGCAATGGCCCTGGAGGG + Intergenic
977174901 4:93808047-93808069 CCTCCTGGACTGCTGCTTGTTGG - Intergenic
978836897 4:113161819-113161841 CCTCTTGTAATGCCCCTGGAAGG - Intronic
981644746 4:146986121-146986143 CCTCATGGAATACTCCTGGAAGG - Intergenic
982730820 4:158953670-158953692 CAGCCTGGAAAGCAGCTGGGAGG + Intronic
984218932 4:176949259-176949281 CCTCCTGTAGAGCATCTGGAAGG + Intergenic
985404359 4:189622724-189622746 CCACCTGGAATGAAGCAGGAGGG - Intergenic
986026529 5:3856199-3856221 CCTGCTGGGAGGCAGCAGGATGG + Intergenic
986130286 5:4923696-4923718 CCACCTGAAATGCATCTGCATGG + Intergenic
986195964 5:5536647-5536669 TCCTCTGCAATGCAGCTGGAGGG - Intergenic
987872206 5:23635176-23635198 CTTCCAGGAATGCAACTGGTAGG + Intergenic
989139997 5:38192569-38192591 CATGCTTGAATGCAGCTGGGAGG + Intergenic
989293357 5:39794633-39794655 CCTCTTGGGAAGCAGCTGGGTGG + Intergenic
989385724 5:40853204-40853226 CTTCCTGGAGGGCAGCTTGAAGG - Exonic
991016241 5:61935709-61935731 TCTCCCGGAATGCAGCAGGAGGG - Intergenic
991090658 5:62690851-62690873 CATCCTGGACAGCATCTGGATGG + Intergenic
993955313 5:94225619-94225641 CTTCCTGGATTGCAGATGGCTGG - Intronic
994427993 5:99619585-99619607 TCTCCTTGAATACAGCTGCATGG - Intergenic
995470735 5:112499569-112499591 TCTCCTTGAATACTGCTGGAAGG + Intergenic
997086308 5:130804207-130804229 TCTCCTAGAATGTATCTGGATGG + Intergenic
997597350 5:135116019-135116041 CCTCTTATAAAGCAGCTGGAAGG - Intronic
999274359 5:150319163-150319185 CCTCCTGGAATGCAGCTGGAGGG - Intronic
1004042025 6:11988692-11988714 CTATCTGGTATGCAGCTGGAGGG + Intergenic
1004230041 6:13824440-13824462 CCTTCTGGACTGTGGCTGGAGGG + Intergenic
1005118504 6:22364623-22364645 CCCCCTGCAAAGCAGCTGGAAGG + Intergenic
1006383680 6:33716606-33716628 CTGCCTGGAATGCAGCTGGGTGG + Intergenic
1006683743 6:35815212-35815234 GCTCCTGCAGTGCAGCTGGTGGG + Intronic
1012296757 6:97533728-97533750 ACTCCTGGATGGCAGCAGGACGG + Intergenic
1013416966 6:109934009-109934031 CCTCATGGAGTGCTGCCGGAGGG + Intergenic
1013445832 6:110225611-110225633 CCTGCAGCAATGCAGGTGGATGG - Intronic
1014783219 6:125588205-125588227 CCTCCAGAAATTCAACTGGAAGG + Intergenic
1015072039 6:129106044-129106066 TCTCCTGGACTGCAGCTCAATGG + Intronic
1016473139 6:144396789-144396811 CCTCATGACATGCAGTTGGATGG - Intronic
1016908264 6:149172514-149172536 CCTCCTGGCTTACAGATGGATGG + Intergenic
1017457673 6:154616631-154616653 CCTCTCTGAATGCACCTGGAGGG + Intergenic
1018680823 6:166263389-166263411 CTTCCTGGAATGGAGGTGGGAGG + Intergenic
1018860232 6:167705886-167705908 CTTCCTAGAAGGCAGCGGGATGG + Intergenic
1018870143 6:167776425-167776447 CCAACTAGAAGGCAGCTGGAAGG + Intergenic
1019058667 6:169240808-169240830 TCTCCAGGAAGGCAGGTGGATGG - Intronic
1019337104 7:490731-490753 CCTTCTGAAATGCAGCTGTAGGG + Intergenic
1022092365 7:27115846-27115868 CGTCCTGGCATGCAGATGGTCGG + Intronic
1022990013 7:35697422-35697444 CCTCCTGGAAGACAGGTGTAGGG - Intergenic
1023976994 7:45037846-45037868 ACTCCAGGAAGGCAGGTGGAAGG - Intronic
1026569296 7:71515334-71515356 GCTAGTGGAATGCAGCTGGAAGG + Intronic
1026931326 7:74224419-74224441 ACTCCATGCATGCAGCTGGATGG - Intronic
1028840229 7:95421509-95421531 TCTTCTTGATTGCAGCTGGAAGG + Intronic
1033006075 7:137564841-137564863 CCACCTGGAATGCAGCTGGCTGG + Intronic
1033362409 7:140647017-140647039 CCTCCTGGATTGCATCTGATTGG - Intronic
1033785051 7:144719889-144719911 CCTCCAAGACTGAAGCTGGAGGG - Intronic
1035690462 8:1556367-1556389 CCTGCAGGAGTGCAGGTGGACGG + Intronic
1036643565 8:10598829-10598851 CCTTCTGGGATGCAGTGGGAAGG + Intergenic
1038004242 8:23416517-23416539 CCTCCTGGAGTGCAGGGGGCTGG - Intronic
1038965663 8:32568617-32568639 GCTCCTGGAATGAAGCTGTCCGG + Intronic
1039461643 8:37750263-37750285 CCTCCTGGAAGGCTGTTCGATGG - Intronic
1040491899 8:47931366-47931388 TCTGTTGGAATGAAGCTGGAAGG + Intronic
1042997947 8:74721635-74721657 CCTCTTGGAATGCAGCTTTCAGG - Intronic
1045049734 8:98311885-98311907 CTTCCTGGACTCCAGCTAGATGG - Intergenic
1045665600 8:104481020-104481042 CTGCATGGAATGAAGCTGGATGG + Intergenic
1046834972 8:118790194-118790216 CCTCCCAGAATGCTGCTTGAAGG + Intergenic
1048289229 8:133167494-133167516 CCTCCTGTAATGAAGCTGCCTGG - Intergenic
1048337942 8:133516900-133516922 ACTCCAGGCATCCAGCTGGAGGG + Intronic
1049340070 8:142107369-142107391 TCTCCCTGCATGCAGCTGGAGGG + Intergenic
1051265911 9:15307704-15307726 CCACCTGGACTGTAGGTGGAAGG + Intergenic
1051490283 9:17655846-17655868 CCTCTTGGAATGCATCAGGCTGG - Intronic
1053166070 9:35844831-35844853 CGTCATAGAATGCAGATGGATGG - Intronic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1056074499 9:83024595-83024617 CCTCCTGGAAGGCCCCTAGAAGG + Intronic
1057167852 9:92942453-92942475 CCCTCTGGACTGCATCTGGAGGG - Intergenic
1059157270 9:112001302-112001324 CCTCCTTGAGTGAAGCAGGACGG - Intergenic
1060887447 9:127165215-127165237 GCTCCTGGAGGGCAGCTGAAAGG + Intronic
1061624504 9:131833756-131833778 CCTCCAGGCACACAGCTGGATGG + Intergenic
1061877740 9:133553358-133553380 CCTCGTGTCCTGCAGCTGGAAGG - Intronic
1061954205 9:133953204-133953226 CCTCCAGGGCTGCTGCTGGAAGG + Intronic
1062033771 9:134373662-134373684 CCTACTGGGTTGTAGCTGGAGGG + Intronic
1062114223 9:134798984-134799006 CCCCCTGGATTGGAGCTGGAAGG - Intronic
1062198529 9:135288034-135288056 CCTCCTGTGAGGCAGCTGAAGGG - Intergenic
1062262303 9:135668969-135668991 CCTCCTGGAACACAGCTAGGGGG - Intergenic
1185735387 X:2491909-2491931 CCTCCTGAGTGGCAGCTGGAAGG - Intronic
1186073740 X:5853010-5853032 CCTCCTTGGAGGCAGCTGGCAGG - Intronic
1187118964 X:16384678-16384700 CAACATGGAATGCAGCTGGAGGG - Intergenic
1188482897 X:30653116-30653138 CCCCATGCCATGCAGCTGGATGG + Intergenic
1189219257 X:39357239-39357261 CCTCTGGGAAGGGAGCTGGAGGG - Intergenic
1199678609 X:150208306-150208328 CCTCCTCAAAAGCAGATGGAAGG + Intergenic
1202114319 Y:21455619-21455641 CCTCCTGAAATTGAGCTGAATGG + Intergenic