ID: 999274869

View in Genome Browser
Species Human (GRCh38)
Location 5:150323505-150323527
Sequence GGTCCAGGTGTCCTGGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999274869_999274875 4 Left 999274869 5:150323505-150323527 CCGGGAACCAGGACACCTGGACC No data
Right 999274875 5:150323532-150323554 CTTCAGCTCATTCTTCTTCATGG No data
999274869_999274876 14 Left 999274869 5:150323505-150323527 CCGGGAACCAGGACACCTGGACC No data
Right 999274876 5:150323542-150323564 TTCTTCTTCATGGTAAGATGAGG 0: 1
1: 0
2: 3
3: 16
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999274869 Original CRISPR GGTCCAGGTGTCCTGGTTCC CGG (reversed) Intronic