ID: 999275238

View in Genome Browser
Species Human (GRCh38)
Location 5:150325654-150325676
Sequence CTTGGTGTGCAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 399}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999275238_999275252 29 Left 999275238 5:150325654-150325676 CCCTCCACCCTCTGCACACCAAG 0: 1
1: 0
2: 4
3: 41
4: 399
Right 999275252 5:150325706-150325728 TCTCCCTTGCCGTGGACTTCCGG 0: 1
1: 0
2: 2
3: 10
4: 99
999275238_999275250 21 Left 999275238 5:150325654-150325676 CCCTCCACCCTCTGCACACCAAG 0: 1
1: 0
2: 4
3: 41
4: 399
Right 999275250 5:150325698-150325720 GAGCTGCCTCTCCCTTGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999275238 Original CRISPR CTTGGTGTGCAGAGGGTGGA GGG (reversed) Intronic
900110393 1:1003040-1003062 CTTGCTGAGCAGAGGCAGGAGGG + Intergenic
900231652 1:1561921-1561943 CTTGGTGTGTGGTGGGGGGAAGG - Intronic
900339796 1:2182589-2182611 CTTGGTCTGCAGGGGCTGGGGGG + Intronic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
903027230 1:20438125-20438147 CTTGGTGGGCAGGAGGTGGGAGG - Intergenic
903349970 1:22711380-22711402 CTTGCTCCGCACAGGGTGGAGGG + Intronic
904004310 1:27355704-27355726 ATAGGTGAGCAGAGTGTGGAGGG + Exonic
904129248 1:28263385-28263407 CTTGGAGTGGGCAGGGTGGAGGG - Intronic
904364462 1:30001669-30001691 CTGGGTGTGGAGTGAGTGGAGGG - Intergenic
904585916 1:31580517-31580539 CCTGGTGTGCAGAGAGGGAAAGG + Intronic
904624036 1:31792237-31792259 CCTGGTGGGCAGGGGCTGGAAGG + Exonic
905002038 1:34680117-34680139 CTAGGGCTGCACAGGGTGGAGGG + Intergenic
905411985 1:37776906-37776928 CTTGGTCTGCAGCGTGTTGAAGG - Intergenic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
909593831 1:77381981-77382003 CTCCCTGTGCAGAGGGTGGGTGG - Intronic
911664267 1:100536288-100536310 CTTGCTATTCAGAGGGTTGAAGG - Intergenic
912525562 1:110280330-110280352 CTTGGTGGCCACAGGGTGGGAGG + Intronic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913283671 1:117208853-117208875 CTGGGTCTGCAGAGGATGGCAGG + Intronic
914393427 1:147242501-147242523 CTTGCAGTGCGGAGCGTGGAAGG - Intronic
915048589 1:153042081-153042103 GTAGGTGTGCAGAGTGAGGAAGG + Intergenic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
916974583 1:170062013-170062035 CGTGGTGGGGAGAGGGGGGAGGG + Intronic
918798041 1:188930801-188930823 TTTGGAGGGTAGAGGGTGGAAGG + Intergenic
919801795 1:201358867-201358889 CTAGCTGGGGAGAGGGTGGAGGG - Intergenic
919888229 1:201950585-201950607 CTTGGGGTGCTGAGGCGGGAGGG + Intergenic
920496872 1:206461179-206461201 CTGGGTGTGCAGAGGGCTGGAGG - Exonic
920975422 1:210781210-210781232 CTCAGTGTACAGAGTGTGGAAGG - Intronic
921709528 1:218359767-218359789 GTTTGTGTGGAGAGGCTGGAGGG + Intronic
922136324 1:222830682-222830704 CTTGTTTTAAAGAGGGTGGAAGG - Intergenic
923286242 1:232498647-232498669 CTTGCTGTGAAGATGGAGGAAGG - Intronic
923460507 1:234205896-234205918 CTGGGGGTGCAGGGGGTGGTGGG + Intronic
923608059 1:235463220-235463242 CTTGGTGGGGACAGGGTGGGAGG + Intronic
1063246422 10:4224364-4224386 CTTTGGGTGCCGAGGGTGGGTGG + Intergenic
1063353166 10:5374481-5374503 CTTGCTGTGGGGAGGGAGGAAGG - Exonic
1064370436 10:14747929-14747951 CTTGGTGGGCTGGGGATGGAGGG - Intronic
1065181567 10:23131343-23131365 GTTGGAGGGCAGAGGGTGGAAGG + Intergenic
1065516224 10:26527050-26527072 CTTGGTGGGCTGAGGGAGGCTGG - Intronic
1067066460 10:43106696-43106718 AGTGCTGGGCAGAGGGTGGAGGG - Intronic
1068025479 10:51637761-51637783 CCTGTTGGGCAGGGGGTGGAAGG + Intronic
1068710796 10:60131727-60131749 GTTGATGTGCAGAAGGTGGGTGG + Intronic
1069086892 10:64151117-64151139 GCTGGTGGGCAGAGGGTGTAGGG - Intergenic
1069835158 10:71303585-71303607 CTTGAGGTCCACAGGGTGGAGGG - Intergenic
1070868667 10:79727981-79728003 TTTGGGGTGCAGAGGAAGGATGG + Intergenic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1072699873 10:97633114-97633136 GTTAGCGAGCAGAGGGTGGAGGG - Intronic
1073025780 10:100486427-100486449 CTGGGTGTGTTGAGGGTGGGGGG - Intergenic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1074188593 10:111116886-111116908 CTCGATGTGCAGAGGGAGGGAGG - Intergenic
1074379404 10:112966621-112966643 CTTGGTGTGGAAAGGCTGGCTGG + Intronic
1074780430 10:116798291-116798313 CTTGGTTTGCCCAGGGTGGAGGG + Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075729530 10:124628034-124628056 CTTGTTGGGCTGAGGCTGGACGG - Intronic
1076070000 10:127481828-127481850 CATGGGGTACAGAGAGTGGAAGG - Intergenic
1076545563 10:131243688-131243710 CTTGGTGAACAGAGGGTGTCTGG - Intronic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1077344795 11:2041680-2041702 CTGGGTCTGCACAGAGTGGAGGG + Intergenic
1077406148 11:2383372-2383394 CTTGGTGGGCAGAGAGTGAGGGG + Intronic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1078758848 11:14235569-14235591 TTTGGTATGCTGAGGGTAGAAGG + Intronic
1081365424 11:42229504-42229526 CTTGGTGTGGAGAGTGGAGATGG + Intergenic
1082865977 11:57900525-57900547 CTGGGTGTGTACAGGGTGGTTGG + Intergenic
1083161268 11:60855709-60855731 CTTGGTGCTCAGAGGAGGGAAGG - Intronic
1083679077 11:64343009-64343031 CTTGGTGGGAAGAAGATGGAAGG + Intronic
1083894725 11:65614132-65614154 CTTTTTGCGCAGGGGGTGGAGGG + Exonic
1084043933 11:66558221-66558243 ATTGGTGTGCAGGGGCAGGAGGG + Intronic
1084402605 11:68953706-68953728 CTAGGTGTGCGGATGGGGGAAGG + Intergenic
1084664558 11:70569447-70569469 TGTGCTGGGCAGAGGGTGGATGG + Intronic
1084754211 11:71224532-71224554 TTGGGTGGGAAGAGGGTGGATGG - Intronic
1084979374 11:72821220-72821242 CCTGGTGTGGTGAGGATGGAAGG + Intronic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1086739725 11:90352378-90352400 CTTGGTGTGCAGCCTGTGTATGG + Intergenic
1087592864 11:100214682-100214704 TTAGGTGTGCAAAGGTTGGAAGG - Intronic
1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG + Intergenic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1091106277 11:132922423-132922445 CTCTGTTTGCACAGGGTGGAAGG - Intronic
1091358464 11:134956215-134956237 ATTGATGGGCAGAGGGTGAAGGG + Intergenic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1202827781 11_KI270721v1_random:96870-96892 CTGGGTCTGCACAGAGTGGAGGG + Intergenic
1091455968 12:608047-608069 CTCGGTGTGCTGTGGATGGATGG + Intronic
1091574451 12:1720334-1720356 ACTGGTGGGCAGGGGGTGGAGGG + Intronic
1093373055 12:18387623-18387645 CTTGGTGTGAGAAGAGTGGAGGG - Intronic
1093675388 12:21933213-21933235 TTTGCTTTTCAGAGGGTGGAGGG + Intronic
1093858561 12:24135666-24135688 CTGGATGTTCAGAGGATGGAGGG + Intergenic
1095542504 12:43327250-43327272 ATTGGAGGGCAGAGGGTGAAAGG - Intergenic
1099861735 12:88231142-88231164 CTTAGTTTGCAGAGGTGGGAGGG - Intergenic
1100214379 12:92432743-92432765 GTTGGTGGGCAGAAGTTGGAAGG - Intergenic
1101015449 12:100495863-100495885 CTTCATGTGCGTAGGGTGGAAGG + Intronic
1102203052 12:111070775-111070797 ACTGGTGTCCAGAGGTTGGAGGG - Intronic
1102713944 12:114953331-114953353 CTTAGTGTGCAGAGGCAGGGAGG + Intergenic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1103505610 12:121440872-121440894 CTGGATGTCCAGTGGGTGGAGGG - Exonic
1105057122 12:133112230-133112252 CTCCATGGGCAGAGGGTGGAGGG - Exonic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107217186 13:37935082-37935104 GTTGGGGTGCAGGCGGTGGATGG + Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1108212751 13:48154872-48154894 CTGGTTGTGCAGAGAGGGGAGGG + Intergenic
1108352040 13:49596618-49596640 CTTGTCGAGCAGAGGGTGGGGGG + Intergenic
1108558897 13:51623910-51623932 CTTGGTGTGCAGGGCAGGGATGG - Intronic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1113087227 13:106581134-106581156 GTTGGTGGGCAGGGGGTGCAAGG - Intergenic
1113409548 13:110072733-110072755 GATGGTGGGCAGAGGATGGAAGG + Intergenic
1114479453 14:23023261-23023283 CCTGGTGTGCAGATGCTGGAAGG + Intronic
1116159889 14:41254341-41254363 CTTGGTGTTCAGGAGGTGGTGGG + Intergenic
1118615942 14:67574463-67574485 ATTGGGGTGCCGAGGGTGGTGGG + Intronic
1118793316 14:69116017-69116039 CTTGGTGTGGGGTGGGTGGAGGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118862475 14:69675239-69675261 CTTGGTGTGCAGGTGGAAGAGGG + Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119713245 14:76838346-76838368 CTTGGTGTGGAGAGGAGGGGAGG - Intronic
1120097831 14:80408931-80408953 TTTGGTGTGGAGAGGAAGGAGGG + Intergenic
1121319993 14:92986670-92986692 GTTGGTGGGCTGTGGGTGGAGGG + Intronic
1121824164 14:96997059-96997081 CTTTGTGTGAAGAGGGTGTGTGG - Intergenic
1122141611 14:99666387-99666409 CTGTGTGTGCAGAGGGTTGGGGG + Intronic
1123130871 14:105984302-105984324 CTTGGTGAACAGAGGATGGGAGG - Intergenic
1123581098 15:21715523-21715545 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1123617747 15:22158146-22158168 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1126244117 15:46483799-46483821 TATGGTGTGCAGAGGGAAGATGG + Intergenic
1127211018 15:56774769-56774791 CTTCCTGTTCAGAGGGTGGAGGG - Intronic
1128251848 15:66169325-66169347 TTTGTTGGGCAGACGGTGGAGGG - Intronic
1128635159 15:69298436-69298458 CTTGGAGTGCTCAGGGTGGCGGG - Intergenic
1128772336 15:70291755-70291777 CTAGGTGTGCAGAAGGTGCTTGG - Intergenic
1129114778 15:73359208-73359230 CTGGGGGAGCAGTGGGTGGAGGG + Intronic
1129875540 15:78973216-78973238 CTTGGGGGGCAGAGTGTGGGTGG + Intronic
1130070089 15:80639830-80639852 CTTGTAGTGAAGAGGGAGGATGG + Intergenic
1130978184 15:88793105-88793127 CTTGGCATGCAGAGGGGGCAGGG + Intergenic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131114095 15:89783677-89783699 TTTGATGTGCAGATGGTGGTGGG + Intergenic
1131340524 15:91596476-91596498 ACTGGTGTTCTGAGGGTGGAGGG + Intergenic
1132018510 15:98339793-98339815 CTGGCTTTGAAGAGGGTGGAAGG - Intergenic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1133297563 16:4762386-4762408 CTTGGTGTGCAGGGGACGGCAGG - Intronic
1133336580 16:5010565-5010587 CCCGGTGGGGAGAGGGTGGAGGG + Intronic
1135562530 16:23487692-23487714 TTAGGTTTGCAGAGGGTGGGAGG - Intronic
1136568235 16:31082405-31082427 AAAGGTGTGCAGAGGGTGGCAGG - Intronic
1137826044 16:51496191-51496213 TTTGGTGTGGGGAGGGAGGACGG + Intergenic
1138230652 16:55333244-55333266 CTGGGTGTGCTGGGGGTGGGGGG - Intergenic
1138389669 16:56661303-56661325 GATGGTGCGCAGAGGGAGGAAGG - Intronic
1138430952 16:56969005-56969027 CCTGGTGTGCTGAAGATGGAGGG - Intronic
1139530916 16:67542346-67542368 CTAGGTGTGCAGATGGGGCAGGG - Exonic
1139539030 16:67599974-67599996 CTTGGTGTGCTCAGGGGGGCTGG + Intronic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1141164312 16:81650325-81650347 CTTGATGTGCAATGGGTGAATGG + Intronic
1141557197 16:84844022-84844044 CTGGGTGTGCAGAGGGCAGGAGG + Intronic
1142644829 17:1304917-1304939 CCTGGTGTGCTGAGGGTAGTTGG + Intergenic
1143372090 17:6446784-6446806 CTTGGTGTACAGGGGGTGCTGGG + Intronic
1143513828 17:7409450-7409472 CTTGGAGTGCTGAGGATGGAGGG - Intronic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1146756728 17:35439135-35439157 GTTTGTGTGCACAGGGAGGAAGG + Exonic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147670644 17:42174976-42174998 CTTGTTGGGCAGAGGCTGGAGGG - Intronic
1148856927 17:50583996-50584018 CTTAGTGTCCAGAGGGAGGAAGG + Intronic
1149442657 17:56688009-56688031 ATTAGTGGACAGAGGGTGGATGG + Intergenic
1150481983 17:65517755-65517777 CTGGGTGTGGAGGGGGTGGTAGG - Intergenic
1150571531 17:66391148-66391170 CTTGGAGAGCAGCGGGTGGGAGG + Intronic
1151517792 17:74607597-74607619 CATGGAGGGCAGAGTGTGGAAGG + Intergenic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152527271 17:80895515-80895537 CTGGGTGTGGACAGGGTGGGAGG - Intronic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1153205222 18:2692103-2692125 CTTGGGCTGCAGAGGTTGGAAGG - Intronic
1154111219 18:11570148-11570170 CTTGGTGTGCAGAGGGGGAATGG - Intergenic
1154122778 18:11665067-11665089 GATGCTGTGCAGAGGGTGGCAGG - Intergenic
1154496481 18:14965003-14965025 ATTGATGGGCAGAGGGTGAAGGG - Intergenic
1155165738 18:23230973-23230995 CTTGGGGTGCTGATGGTGCAAGG + Intronic
1155308094 18:24498668-24498690 CTTGGCCTGCCGAGGGTGGAGGG + Intergenic
1155987649 18:32247229-32247251 CTTGGTGTGGGGAGAGTGGGAGG - Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157339375 18:46765751-46765773 CTTGGTGAGCAGAGAGTGTAGGG - Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158640669 18:59201035-59201057 CTTAGTGTGGGGAGGTTGGATGG - Intergenic
1158934203 18:62349505-62349527 TTTTGGGTGCAGAGGGTGGTTGG + Intronic
1159935492 18:74363571-74363593 CATGGTGTCCTGCGGGTGGAGGG - Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1163382201 19:16976547-16976569 CTTGGTGGGCAGGGGGTGCATGG - Intronic
1163819403 19:19487482-19487504 CTTGCTGGGCCGAGGGTGGGTGG + Intronic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1165374339 19:35431267-35431289 CTGGGGGTGGAGGGGGTGGAGGG - Intergenic
1165523437 19:36332092-36332114 CTTGGTGTTCACCGGGTGGCAGG - Intergenic
1166205399 19:41265585-41265607 CCTGGTGTCCAGAGGCTGGCGGG + Intronic
1166254439 19:41592304-41592326 GTTCGTGTGCAGAGCTTGGAGGG - Intronic
1167781221 19:51600696-51600718 CTTGGTATACAGTAGGTGGATGG + Intergenic
1168353413 19:55688733-55688755 CTTGGCCTGCAGAGGTTGTAGGG + Intronic
925056360 2:860550-860572 CATGGAGGGGAGAGGGTGGAGGG - Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926175598 2:10588921-10588943 ATGGAGGTGCAGAGGGTGGAGGG - Intronic
928200783 2:29246479-29246501 CATGGTGTCTAGAGGGTGGGTGG - Intronic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
930966914 2:57340032-57340054 CTTGGAGGGTGGAGGGTGGAGGG - Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931725312 2:65104303-65104325 CTCAGGGTGCTGAGGGTGGAAGG - Intronic
932904798 2:75738337-75738359 CTTGGTTTGCAGTGGGCGGGTGG - Intergenic
933167897 2:79095481-79095503 CTTAGTTTGCAGAGGTGGGAAGG + Intergenic
935317536 2:101850698-101850720 GTTGGTATGCAGAAGGTGGCTGG + Intronic
935561901 2:104568152-104568174 CTTGGTGGGAAGAGGGGCGAAGG + Intergenic
935815744 2:106844226-106844248 CTTGTTTTGCAGAGGTTGGTGGG - Intronic
937160304 2:119754853-119754875 CTAGGTTTGAAGATGGTGGAAGG + Intergenic
938127098 2:128682454-128682476 CTTGCTGTGCAGAGAGGGGGTGG + Intergenic
939460402 2:142490896-142490918 CTTGATGTGCAGAGAAGGGAGGG + Intergenic
939496525 2:142933512-142933534 CTTAGTTTGCAGAGGCAGGAGGG + Intronic
940786978 2:157991864-157991886 CTTGGTGAGCAAAGTATGGAGGG + Intronic
941720031 2:168802701-168802723 CTGCGTGTGAGGAGGGTGGAGGG + Intronic
942232342 2:173872252-173872274 CTTTGTGTGCATAAGGTGCACGG + Intergenic
942411682 2:175716133-175716155 GTTGGTGAGCAGAGTGCGGACGG - Intergenic
944894115 2:204146469-204146491 CTTGGTGTTGAAAGTGTGGAAGG - Intergenic
945810673 2:214546079-214546101 CTTGGGGTTGAGGGGGTGGAGGG + Intronic
946001995 2:216490093-216490115 CTTGGTGAGAAGTGGGAGGATGG - Intergenic
947590009 2:231380098-231380120 CGTGATGTGGAGAGGGTGGGTGG + Intergenic
947982287 2:234420693-234420715 CTTGCAGTGCAGAGGCTGCAAGG + Intergenic
948045486 2:234940556-234940578 CTGGGAGGGCAGAGAGTGGAGGG - Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948641037 2:239376102-239376124 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641045 2:239376146-239376168 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641060 2:239376231-239376253 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641068 2:239376275-239376297 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641076 2:239376319-239376341 CTTGGTGTTTGGATGGTGGAGGG - Intronic
1170257381 20:14360095-14360117 CTTGCTGGGCACAGGGTGGTGGG + Intronic
1170523687 20:17215312-17215334 CCTGGTCTGCAGAGGCAGGAAGG + Intergenic
1172629018 20:36365972-36365994 ATTGGAGGGGAGAGGGTGGAGGG + Intronic
1172852303 20:37975371-37975393 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1174313387 20:49677326-49677348 GATGGTGTGCAGAGGGTGGTTGG - Intronic
1174508738 20:51034938-51034960 CCTGGTGTGCAGAGGGCTGCTGG - Intergenic
1174750727 20:53108949-53108971 CTTGGAGGGTAGAGGGTGGAGGG - Intronic
1175385497 20:58592419-58592441 CTGGAAGTGCACAGGGTGGAAGG - Intergenic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1178787391 21:35666414-35666436 CTTGGTGTGAAGGAGGAGGAAGG - Intronic
1180081729 21:45490356-45490378 CTTGGTGGGCCCAGGGTGCAGGG + Intronic
1180262216 21:46679733-46679755 CTTGGTGTGGAGGGTGGGGAAGG + Intergenic
1180681912 22:17633952-17633974 GGTGGTGTGCAAAGGGAGGAGGG - Intronic
1180841018 22:18958894-18958916 CATGGCGGGCAGAGTGTGGAGGG - Intergenic
1181410983 22:22719505-22719527 TTTGGAGTCCAGAGGGTGGGGGG + Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181741682 22:24926119-24926141 CCTGGTGTGCTCAGGGTGGGAGG - Intronic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183295264 22:37025442-37025464 CTTGGAGAACTGAGGGTGGAAGG + Intronic
1183318580 22:37149959-37149981 CTTCCTGTGCAGAGGATAGAGGG + Exonic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183701303 22:39452729-39452751 CTGGGAGGGTAGAGGGTGGAGGG + Intergenic
1184172738 22:42769283-42769305 CTTGAGGGGCAGAGGGTGGGGGG + Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184357000 22:43988618-43988640 CTCGCTGTGCAGTGGGTGGCAGG + Intronic
1184648529 22:45908982-45909004 TTTGGGGTGCAGAGTGTGGGAGG - Intergenic
1185128072 22:49022741-49022763 CTTGGTGTGGAGAAAGAGGAGGG + Intergenic
950535390 3:13575403-13575425 TTTGGTGTGCAGGGAATGGAAGG - Intronic
951098548 3:18659773-18659795 ATTTGTGGGTAGAGGGTGGAAGG + Intergenic
951301306 3:21000459-21000481 GTTGTTGTGGAGATGGTGGATGG + Intergenic
952534323 3:34294340-34294362 CTTGGTATGTGGATGGTGGATGG + Intergenic
953210856 3:40873787-40873809 CTGGGTTTGCAGAGGGAGCAAGG - Intergenic
953437159 3:42887222-42887244 CTTGGGTTGCAGGGGGTGGGGGG - Intronic
954214138 3:49115151-49115173 CTGGGTGTGCAGTGGGTGCTAGG - Intronic
954590024 3:51775332-51775354 CTCCGTGTGCAGAGGGTGGCAGG - Intergenic
954622787 3:52005376-52005398 CCTGGTGGGCAGAGGCTGGTGGG + Intergenic
954630108 3:52043513-52043535 CCTGGAGTGCACAGGCTGGAGGG - Intergenic
955034132 3:55249842-55249864 GTTGGAGAGCAGAGGGTGGGAGG - Intergenic
955320949 3:57973811-57973833 CTTGGGATGCAGGGGGTGGGAGG + Intergenic
955818860 3:62875067-62875089 CTTGGAGTGCAAAAGGTGGGGGG + Exonic
956048073 3:65217822-65217844 CCTGTTGTGGAGTGGGTGGAAGG - Intergenic
956250629 3:67230623-67230645 CTTGGTGAACAGAGGATGGGTGG - Intergenic
956701696 3:71964766-71964788 GGTGGTGTGCAGCTGGTGGAAGG - Intergenic
957274758 3:78076535-78076557 CCTGGTTTGCAGAGGTTGGGAGG + Intergenic
959984144 3:112554437-112554459 TTTTGTGGGCAGGGGGTGGATGG - Intronic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
961237646 3:125381303-125381325 CTTGGTGGGCTGAGGTAGGAGGG + Intergenic
961714408 3:128848812-128848834 CTTGATGTGCATAGAGTAGAAGG + Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
963693657 3:148536906-148536928 TTTGGTGGGCAGGGGGTGCAGGG + Intergenic
964949084 3:162265101-162265123 CTCAGTGAGCAGGGGGTGGAAGG - Intergenic
965066094 3:163850629-163850651 CTTGTGGGGCAGGGGGTGGAGGG + Intergenic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967450366 3:189616335-189616357 CTTGTTGTGGAGAGGGTTCAAGG - Intergenic
968287059 3:197514925-197514947 GTTGGGGTGCAAAGGCTGGATGG + Intronic
969328060 4:6455413-6455435 CTGGGGGTGCAGATGGTGGCAGG - Intronic
970938224 4:21600085-21600107 CTTGGTTAGCAGAGGGAGTAAGG - Intronic
971862912 4:32131313-32131335 CTGGGTGTGGAGTGGGGGGAAGG - Intergenic
971867539 4:32191391-32191413 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
973064542 4:45772635-45772657 CTTGTTGTGGGGTGGGTGGAGGG - Intergenic
973906867 4:55540727-55540749 CGTGGAGTGGAGAGGGAGGAAGG + Intronic
974824078 4:67104357-67104379 CTTGCTGTGCAGGGCGTTGAAGG + Intergenic
975215009 4:71742971-71742993 CTTGGTGTGGGCAGGGTGGGGGG + Intronic
976091090 4:81458495-81458517 CTTGGTGTGCAAAGGATAGTTGG - Intronic
977077951 4:92482321-92482343 CTTAGAGGGCAGAGGGAGGAAGG + Intronic
977334807 4:95684395-95684417 CTGGGTGTGAAGATGGGGGAAGG + Intergenic
977817137 4:101427657-101427679 AATGGTGTGGAGAGGGTGTAGGG - Intronic
977904276 4:102457535-102457557 CTGGGTGTGGAGAGATTGGAAGG + Intergenic
979277141 4:118827157-118827179 CTTGGTGTGGAGAGGCTGGGAGG + Intronic
980334804 4:131457708-131457730 CTTGGTGTGCATAAAGTTGATGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
982080156 4:151781747-151781769 CTTTGTTTGCTGAGGCTGGAGGG + Intergenic
982112680 4:152071156-152071178 CTTGGTGGGCAGAGAGGGCAGGG + Intergenic
982551915 4:156812864-156812886 GTAGGTGTGCAGAGGTTGGAGGG - Intronic
983497825 4:168463430-168463452 ATTGGAGGGCGGAGGGTGGAGGG + Intronic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
984296718 4:177862561-177862583 CGTGGTGAGCGGAGGGTGGGGGG - Intronic
984729851 4:183057804-183057826 CTTTGGGTGCAGAGGATGGGAGG - Intergenic
985648802 5:1098088-1098110 CTGGGTGTGCAGAGGGTTGGAGG - Intronic
985648838 5:1098194-1098216 CTGGGTGTGCAGAGGGTTAGAGG - Intronic
985648847 5:1098221-1098243 CTGGGTGTGCAGAGGGTTAGAGG - Intronic
985648883 5:1098328-1098350 CTGGGTGTGCAGAGGGTTAGAGG - Intronic
985648917 5:1098437-1098459 CTGGGTGTGCAGAGGGTTAGAGG - Intronic
985648943 5:1098519-1098541 CTGGGTGTGCAGAGGGTTAGAGG - Intronic
985648952 5:1098546-1098568 CTTGGTGAGCAGAGGGTTAGAGG - Intronic
985648994 5:1098682-1098704 CTGGGTGTGCAGAGGGTTAGAGG - Intronic
985649012 5:1098736-1098758 CTGGGTGTGCAGAGGGTTAGAGG - Intronic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986631112 5:9775168-9775190 CTTTGTGTGCAGAAAGGGGAGGG - Intergenic
990185318 5:53204474-53204496 CTTAGTCTGCAGAGGCGGGAGGG - Intergenic
990514691 5:56520390-56520412 CTTGGTGTGAAGAATGTGGCAGG - Intronic
990878709 5:60517195-60517217 CTTGGTGCACAGAGTCTGGAGGG - Intronic
991214322 5:64144759-64144781 GCTGGTGATCAGAGGGTGGAAGG - Intergenic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
992739934 5:79763276-79763298 CTTGGTGAGCAGAAGTTAGAGGG - Intronic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
995752308 5:115465682-115465704 TTTGCTGTGCAGAGGGTGTTTGG - Intergenic
995781213 5:115777276-115777298 CTTGGTGTTCAGAGGGGTTATGG - Intergenic
996873506 5:128217024-128217046 CTTGGTGTCCACAGTGTTGAGGG + Intergenic
997937734 5:138129117-138129139 TTTGGGGGGCAGAGGGTGGCAGG - Intronic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
999256054 5:150210575-150210597 CTTGGGGTCCAGTGGGTGAAGGG - Exonic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1001001424 5:168010952-168010974 CTTTGTGTGAAAAGGATGGATGG + Intronic
1001244829 5:170098251-170098273 TGGGGGGTGCAGAGGGTGGATGG + Intergenic
1002120151 5:176997326-176997348 TTTGGTGTGTAGAGATTGGAGGG - Intronic
1002417088 5:179126296-179126318 CTTGGTGTGTCCCGGGTGGAGGG + Intronic
1002718546 5:181244239-181244261 CTTGGTGCGGGGAGGGTTGACGG + Intronic
1004840336 6:19576746-19576768 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
1004902140 6:20204675-20204697 GTGTGTGTGCAGAGGCTGGAGGG + Intronic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1007166498 6:39832157-39832179 CTTGGTGAGGAAAGGGTAGAGGG + Intronic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1009312245 6:62169892-62169914 CTTTGTCTGGTGAGGGTGGATGG - Intronic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1009946473 6:70347156-70347178 CTTGGTGAAGAGGGGGTGGAAGG + Intergenic
1010746319 6:79566064-79566086 CTTGGGGTGAGGAGGATGGAGGG + Intergenic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015554980 6:134451786-134451808 GTTGGGGAGCAGAGAGTGGAGGG + Intergenic
1016326854 6:142912773-142912795 CATGGTGTGGGGATGGTGGATGG - Intronic
1016355584 6:143214748-143214770 ATAGGTGTGCAGGGGGAGGAAGG - Intronic
1016618123 6:146076686-146076708 ATTGGAGTGGAGAGGTTGGATGG + Intronic
1017013341 6:150080008-150080030 CTTGGAGGGCAGATGGGGGAAGG - Intergenic
1017429755 6:154359426-154359448 TTTGCTGTGCAGAGGCTGGGCGG - Intronic
1018052890 6:160027022-160027044 CTTTGTTTGCAGAGGGTTAATGG + Intronic
1018129685 6:160717189-160717211 CTTGGGGAGCAGAGGGTGAGTGG + Intronic
1018948881 6:168365469-168365491 CTTGGCCTGCAGAGAGGGGAGGG + Intergenic
1019398056 7:834097-834119 CTTGGTGGGCAGGGGCTGGCTGG + Intronic
1019398070 7:834150-834172 CTTGGTGGGCAGGGGCTGGCCGG + Intronic
1019398085 7:834203-834225 CTTGGTGGGCAGGGGCTGGCCGG + Intronic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019692419 7:2423727-2423749 CTCAGTGTACAGAGGGTGGTGGG - Intronic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1020005712 7:4782948-4782970 CTGGGTGTGCAGAGTGAGGTGGG + Intronic
1020508781 7:9025715-9025737 ATTGATTTGCAGAGGGTGCATGG - Intergenic
1020937627 7:14487075-14487097 CGTGGTGGGCAGAGTGTGTAGGG + Intronic
1021609092 7:22439836-22439858 ATTGGGGTGTAGAGGGTGGTTGG - Intronic
1022443201 7:30450323-30450345 CATGGGGTGCAGGGGGTCGAAGG - Intronic
1024842905 7:53607854-53607876 CTTGGTGCGAAGAGCATGGACGG + Intergenic
1025190587 7:56892834-56892856 CTGGGTGTGCACAGTGTGGATGG + Intergenic
1025227476 7:57177878-57177900 CTTTGTCTGCAGTGGGTGAATGG - Intergenic
1025681365 7:63684142-63684164 CTGGGTGTGCGCAGTGTGGATGG - Intergenic
1026966696 7:74444693-74444715 CTTGGGGGGCTGAGGGAGGATGG - Intergenic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1027539178 7:79446159-79446181 CCTGTTGTGCAGTGGGAGGAGGG + Intronic
1027971264 7:85084757-85084779 TTTGGAGTGTGGAGGGTGGAAGG - Intronic
1028405474 7:90469347-90469369 CATGGAGTGCAGTGGGTGGTAGG + Intronic
1029976588 7:104840647-104840669 TTTGGTGTTCAGTGGGGGGAGGG - Intronic
1030112550 7:106039003-106039025 CTTGGTCTGCAGCGGGGGAATGG + Intergenic
1030246745 7:107391090-107391112 CTTGGTGGGAGGAGGGGGGAGGG + Intronic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1032358527 7:131232746-131232768 CTTGGTGTGCACACAGTGAAAGG + Intronic
1034746009 7:153524475-153524497 CTAGGTGTTCACAGGGTGGGAGG + Intergenic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1035850434 8:2914579-2914601 CTTGGAGGACAGCGGGTGGAAGG - Intergenic
1036111821 8:5911135-5911157 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1036552695 8:9828976-9828998 CCAGGTGTGCACAGGGTGGTGGG + Intergenic
1038095331 8:24302917-24302939 CTTGTTGTGGGGAGGGGGGAGGG - Intronic
1038965371 8:32565980-32566002 CTAGGTGTGCACAGGCTGGTAGG - Intronic
1043618741 8:82160845-82160867 CTTGCTGAGCAGCGGGTGGTGGG + Intergenic
1043937332 8:86156563-86156585 CATGCTGTGGAGGGGGTGGAGGG - Intergenic
1044505514 8:93012998-93013020 CTTTGTGTGCATAGTGTGAAGGG + Intronic
1045108979 8:98921440-98921462 CATGGAGTGCTGAGGGAGGAAGG + Intronic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1046932405 8:119854992-119855014 CTGGGGCTGCACAGGGTGGAGGG + Intronic
1046949435 8:120005732-120005754 CTTAGTGAGCACAGGATGGATGG + Intronic
1048533071 8:135268294-135268316 CTTGGTGTGAGGAAGCTGGAGGG + Intergenic
1048657860 8:136562168-136562190 CGTGGTGTGAGGAGGGGGGAGGG + Intergenic
1049274751 8:141714582-141714604 CTAGTAGTTCAGAGGGTGGAGGG + Intergenic
1049555191 8:143278101-143278123 CATGGTCTGGAGAGGGTGGCGGG - Intergenic
1050041568 9:1500517-1500539 CTTGTTGTGGGGAGGGGGGAGGG - Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1054835427 9:69671671-69671693 CTTGGTGTGTGAAGTGTGGAGGG - Intronic
1056100930 9:83300199-83300221 CTTGGTGTGTAGAGCAGGGATGG - Intronic
1057832500 9:98417986-98418008 GGTGGTGTGCATGGGGTGGAGGG + Intronic
1059693180 9:116706084-116706106 CTTAGAGTCCTGAGGGTGGAGGG + Intronic
1059714919 9:116904937-116904959 TTGGGGGTGCGGAGGGTGGAAGG - Intronic
1060495743 9:124117621-124117643 CTTGGAATGGAGAGGGTGGCTGG + Intergenic
1061323692 9:129849121-129849143 CTTCCTGTCCAGAGGGTTGATGG + Intronic
1061626656 9:131844382-131844404 CTCGGTGGCCAGAGGGCGGAGGG + Intergenic
1061806544 9:133140425-133140447 CTTTGTGTTCCGAGGGAGGAAGG - Intronic
1061859638 9:133461245-133461267 CCAGGTGGGTAGAGGGTGGAGGG + Intronic
1062080169 9:134619532-134619554 CTTGTTGTGTGGGGGGTGGAGGG + Intergenic
1062254278 9:135613819-135613841 CCGGGTGTGGGGAGGGTGGAGGG - Intergenic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1186483403 X:9913547-9913569 TTGTGTGTGCAGAGGGTCGATGG + Intronic
1187503938 X:19863717-19863739 CTTGGTGTCCCGAGGGAGGTTGG - Intronic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1189349181 X:40264201-40264223 CATGGTCTGCAGAGACTGGAAGG + Intergenic
1189375534 X:40463649-40463671 GTAGGTGTGCAGGTGGTGGAGGG + Intergenic
1189609865 X:42720892-42720914 GTGGGTGTGGAGAGGGGGGAGGG - Intergenic
1189642878 X:43092934-43092956 CTTGGGGGGCTGAGGGTGGGAGG - Intergenic
1189728285 X:43990807-43990829 ATTGGAGTGCAGCAGGTGGAAGG - Intergenic
1189789916 X:44593388-44593410 CTTTGTTTGCACATGGTGGAAGG + Intergenic
1190280608 X:48926751-48926773 CTATGTGTGCACCGGGTGGAGGG + Intronic
1191207822 X:57853109-57853131 ATTGGTGTGCACAGGGTTGCTGG + Intergenic
1192282349 X:69699965-69699987 CTTAGTTTGCAGAGGCAGGAGGG + Intronic
1192946002 X:75966190-75966212 CTTAGTTTGCAGAGGTGGGAGGG + Intergenic
1194476377 X:94364528-94364550 CTTGGTGTGGTGGGGGTGGGGGG + Intergenic
1196016233 X:110943673-110943695 CTTGGGGATCAGAGGGTTGAAGG - Intergenic
1200712242 Y:6497058-6497080 CTTGTTGTGGAGTGGGGGGAGGG - Intergenic
1201021678 Y:9664899-9664921 CTTGTTGTGGAGTGGGGGGAGGG + Intergenic
1201916313 Y:19185276-19185298 CCTGTTGTGCAGTGGGGGGAAGG - Intergenic
1202273017 Y:23088530-23088552 CTTGGTGTGCAGTGGGTGTCTGG + Intergenic
1202293009 Y:23332152-23332174 CTTGGTGTGCAGTGGGTGTCTGG - Intergenic
1202426014 Y:24722274-24722296 CTTGGTGTGCAGTGGGTGTCTGG + Intergenic
1202444775 Y:24947812-24947834 CTTGGTGTGCAGTGGGTGTCTGG - Intergenic