ID: 999276705

View in Genome Browser
Species Human (GRCh38)
Location 5:150336063-150336085
Sequence GAATCAAGAAGGGCCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999276697_999276705 11 Left 999276697 5:150336029-150336051 CCACAACCTCCATGATTAGATGT 0: 1
1: 0
2: 0
3: 20
4: 191
Right 999276705 5:150336063-150336085 GAATCAAGAAGGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 111
999276700_999276705 2 Left 999276700 5:150336038-150336060 CCATGATTAGATGTAGACAGGCA 0: 1
1: 0
2: 0
3: 7
4: 95
Right 999276705 5:150336063-150336085 GAATCAAGAAGGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 111
999276696_999276705 24 Left 999276696 5:150336016-150336038 CCAGGCTGAGAATCCACAACCTC 0: 1
1: 0
2: 2
3: 13
4: 168
Right 999276705 5:150336063-150336085 GAATCAAGAAGGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 111
999276698_999276705 5 Left 999276698 5:150336035-150336057 CCTCCATGATTAGATGTAGACAG 0: 1
1: 0
2: 1
3: 5
4: 103
Right 999276705 5:150336063-150336085 GAATCAAGAAGGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999276705 Original CRISPR GAATCAAGAAGGGCCCCTGT GGG Intronic
903269025 1:22176412-22176434 GAAACAAAAAGGGCCTCTGAAGG - Intergenic
903448690 1:23438171-23438193 GAATCAGGAAAGGCTCCTGGAGG - Intronic
904134007 1:28296968-28296990 GAATTAAGTAGGGCCCCCGAGGG + Intergenic
907951276 1:59186457-59186479 GAATCAAGCAGGACCCCTCTTGG - Intergenic
908023686 1:59925983-59926005 GCATCAAGAAGGGTCCCAGGTGG + Intronic
908588750 1:65605210-65605232 GAATCAGGAAGGACACATGTTGG - Exonic
908772252 1:67607776-67607798 GAGTCAGGAAAGGCCCCAGTGGG + Intergenic
913971934 1:143422858-143422880 CAGCCATGAAGGGCCCCTGTGGG - Intergenic
914066313 1:144248471-144248493 CAGCCATGAAGGGCCCCTGTGGG - Intergenic
914112840 1:144717883-144717905 CAGCCATGAAGGGCCCCTGTGGG + Intergenic
922812930 1:228428042-228428064 GCATCAACAAGGGGCGCTGTAGG - Intergenic
1064717654 10:18193531-18193553 GATTCCAGAAGGGCCTCTGCAGG + Intronic
1070179410 10:73999163-73999185 GAGTCTAGAAAGGCCCCAGTGGG - Intronic
1070993698 10:80755907-80755929 AAAGCACTAAGGGCCCCTGTAGG - Intergenic
1072767516 10:98107770-98107792 AGATCAAGTAGGGCCCTTGTAGG + Intergenic
1074770230 10:116728910-116728932 GCATTAAGATGGGCCCCTGGAGG - Intronic
1081589016 11:44407909-44407931 GGAACTAGAAGGGCCCCTATGGG + Intergenic
1081994066 11:47352465-47352487 GAATCAAAAAAGGACCCTGGAGG + Intronic
1086760641 11:90626310-90626332 GACTCAAGAAAGGCCAATGTGGG - Intergenic
1086946296 11:92847028-92847050 GATTCAAGAAAGGGCCCTCTTGG + Intronic
1088929301 11:114333630-114333652 GAATCAAGTAGAGCTCCTGGGGG - Intergenic
1097692637 12:62747572-62747594 GAATCAAGTAGGGCAAATGTAGG + Intronic
1102929883 12:116854087-116854109 GGATCAGAAAGGGCCTCTGTGGG + Intergenic
1105650782 13:22374717-22374739 GCAAAAAGAAGGGCCCCAGTTGG + Intergenic
1110076532 13:71251772-71251794 TGAACAAGAAGGGCCACTGTAGG - Intergenic
1110399378 13:75071958-75071980 TAATCAAGAAGGGACCCTTGGGG - Intergenic
1112429440 13:99337737-99337759 GAACCAAGGAGGGTCCATGTGGG - Intronic
1116284357 14:42953103-42953125 GAATCAAGAAAGTCTTCTGTAGG + Intergenic
1122092353 14:99348913-99348935 GAAGCAAGAAGGGCCCCCAGTGG + Intergenic
1122997401 14:105272676-105272698 GCATCAAGATGGGGCCCTCTGGG + Intronic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1130913417 15:88286428-88286450 GGATTTAGAAGGGCCTCTGTGGG + Intergenic
1133045739 16:3087408-3087430 GAAGCAAGCAGGGCCCCTCAGGG - Intergenic
1139325279 16:66147877-66147899 CAATGTAGCAGGGCCCCTGTGGG + Intergenic
1139669799 16:68485041-68485063 GGAGCAGGAAGGGCCCCTGGGGG + Intergenic
1142314181 16:89333046-89333068 CAGGGAAGAAGGGCCCCTGTGGG + Intronic
1144515311 17:15913483-15913505 CAAACAAGAAGGACCCCTGGAGG + Intergenic
1145018484 17:19413454-19413476 GAATCAAGAAGGGCGTCTCTGGG + Intronic
1145960627 17:28884720-28884742 GAATGGGCAAGGGCCCCTGTGGG - Intronic
1147607548 17:41782750-41782772 GAATTCAGAAGGGCCCATGAAGG - Intronic
1151366122 17:73617441-73617463 GGAGCCAGAAGGGCCCCTGGGGG - Intronic
1151467690 17:74298200-74298222 GCTCCAAGAAGGGCCCCTCTAGG + Intronic
1153203627 18:2672066-2672088 AAATGAAGAAGGGACACTGTAGG - Intronic
1154105939 18:11523175-11523197 GAATCAAGAAGGGACTGAGTTGG - Intergenic
1157685585 18:49640232-49640254 GAACCCAGAAAGGTCCCTGTGGG + Intergenic
1160793894 19:935052-935074 GAGTCAACAGGGGCCCCAGTAGG - Intronic
1163415378 19:17183326-17183348 GGTTCCAGAAGGGCCTCTGTGGG + Intronic
1163737778 19:18991944-18991966 GAAGCAAGCAGAGCCCCTGGGGG + Intronic
1167573761 19:50307360-50307382 GCATCTAGAAAGGGCCCTGTAGG + Intronic
932109585 2:68984628-68984650 AAATCATGAAGAGCCCCTTTGGG + Intergenic
934176626 2:89583790-89583812 CAGCCATGAAGGGCCCCTGTGGG - Intergenic
934286935 2:91658151-91658173 CAGCCATGAAGGGCCCCTGTGGG - Intergenic
945042866 2:205756688-205756710 GAATCATCAAGGGCCCCTGGTGG - Intronic
947597984 2:231426020-231426042 GACTCATGATGGGCCCCTGAGGG + Intergenic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
1169869994 20:10239887-10239909 GGTTCCAGAAAGGCCCCTGTAGG - Intronic
1171030683 20:21673862-21673884 GAATCCAGAAAGGCCACTGTGGG + Intergenic
1174980472 20:55388708-55388730 GAATCAGGACGGGCCTCTCTGGG - Intergenic
1175567385 20:59991202-59991224 GAATTAGGAAAGGCTCCTGTTGG - Intronic
1177648975 21:23936619-23936641 GAATCTCGAGGGGCCCCAGTGGG - Intergenic
1178631527 21:34265407-34265429 GAATCTAGATAGGCCCCTGGAGG + Intergenic
1180133775 21:45846733-45846755 GCATCAAGAAGTGCCCTTCTTGG + Intronic
950569674 3:13792248-13792270 GAATCAGGAAGGGCCCTGGCAGG - Intergenic
952904566 3:38131273-38131295 GAATCAACAAGGGCCCCCAAAGG + Intronic
954190345 3:48955478-48955500 GAATCAAGAAGAGCTCTTGCTGG - Intronic
955404704 3:58618753-58618775 GAGTGAAGAAGGGCCCTGGTGGG + Intronic
960192123 3:114719205-114719227 GAAGCAAGAAGGGAGCCTGGAGG + Intronic
961084911 3:124058495-124058517 AAAGCAGGAAGGGCCCCTCTTGG - Intergenic
962864956 3:139440812-139440834 GAATGAAGAAGGGCCTGTGTCGG + Intergenic
966295045 3:178409796-178409818 AAATCATGCAGGGCACCTGTGGG - Intergenic
966926582 3:184648381-184648403 GAATCAAGAAGGGCCTGGATAGG - Intronic
968265355 3:197358635-197358657 GGATCAAGAAGGATTCCTGTTGG + Intergenic
969422798 4:7107216-7107238 GAATCCAGATGGGGCCCTGGGGG - Intergenic
977788680 4:101071856-101071878 AAATCAAGAAGGTCATCTGTTGG + Intronic
987254399 5:16135228-16135250 GATTCAAAAGGGGCCCCTGCTGG + Intronic
990318990 5:54611470-54611492 GAATCTAGAAGGGGACCTGGAGG - Intergenic
999276705 5:150336063-150336085 GAATCAAGAAGGGCCCCTGTGGG + Intronic
999672096 5:153966817-153966839 GAATCAAGAAGAGGCCATTTTGG - Intergenic
1001320213 5:170674599-170674621 GAATGAAGAATGGGCCCTGCAGG + Intronic
1005244201 6:23862654-23862676 GCATCAAGGAAGGACCCTGTGGG + Intergenic
1005813789 6:29534394-29534416 AAATCAAGCATGGCCCCTGCTGG + Intergenic
1006407880 6:33855799-33855821 GAATCAGGAAGGGGCCCTAGAGG + Intergenic
1006679740 6:35788241-35788263 GAAGCAGGAAGGGACACTGTTGG + Intronic
1007360722 6:41353353-41353375 GGAACAGGAAGGGCCTCTGTGGG + Intergenic
1008429794 6:51402342-51402364 GACTCAAGAAGGGTCCTAGTGGG - Intergenic
1013619810 6:111877452-111877474 GAAACAAGAAGGGTGTCTGTGGG - Intergenic
1014757173 6:125314268-125314290 GAATCAAAGTGGCCCCCTGTGGG - Intergenic
1018842918 6:167531527-167531549 GAATGAAGCAGAGTCCCTGTAGG + Intergenic
1019700766 7:2474238-2474260 GAAACAGGAAAGGCCCCTGCAGG + Intergenic
1019781848 7:2945070-2945092 GGATCATGAAGGGTCCTTGTGGG + Intronic
1020189898 7:5987422-5987444 GAACCAAGAAGGAGCCCTCTAGG - Exonic
1020293025 7:6737252-6737274 GAACCAAGAAGGAGCCCTCTAGG + Intergenic
1021874143 7:25032848-25032870 GAACCAGGAACGGCCCCTGCAGG + Intergenic
1022267005 7:28766700-28766722 GAAACCAGAATGGCCCTTGTGGG + Intronic
1022497255 7:30860836-30860858 CAATCAAGCTGGGCACCTGTGGG + Intronic
1023557703 7:41440202-41440224 GAAACAAAAAGGGACCTTGTTGG + Intergenic
1024026234 7:45412315-45412337 GAGTCAGGAAGGCCCCCTGGAGG - Intergenic
1026100231 7:67378375-67378397 GAATCAAGAGTGACCCCTGGTGG - Intergenic
1031327050 7:120414838-120414860 GAATCAGGAAAGGCCCATGATGG - Intronic
1031608529 7:123797585-123797607 ATATGAAAAAGGGCCCCTGTTGG + Intergenic
1032417094 7:131744198-131744220 CAATGAAGAAGGGCCCCACTGGG - Intergenic
1034944848 7:155255292-155255314 GGCTCAAGCAGGGCCGCTGTGGG - Intergenic
1038478471 8:27885372-27885394 GTACCTAGAAGGGGCCCTGTTGG - Intronic
1038576299 8:28705911-28705933 CAATCTAGAAGTGCCTCTGTTGG + Intronic
1045802968 8:106123061-106123083 GAATGAAGCAGTGCCCATGTGGG + Intergenic
1055715928 9:79117876-79117898 GAATCAAGAACAGCCCTGGTGGG - Intergenic
1056717771 9:89046884-89046906 GTATCAAGAAAGCCCCCTGGAGG + Exonic
1061169300 9:128942869-128942891 CAAACAGGAAGGGCCCCTGAAGG - Intronic
1185987460 X:4851433-4851455 GCATCAAGAAGGGTCCATGGTGG + Intergenic
1186443045 X:9602459-9602481 GAATCAAGAAGGGCTTCTAAGGG - Intronic
1188351293 X:29134315-29134337 CAATGAATAAGGGTCCCTGTTGG + Intronic
1188428315 X:30075422-30075444 AGATCAGGAAGGGCCCATGTAGG - Intergenic
1190003398 X:46711090-46711112 AAATGGAGAAGGCCCCCTGTTGG + Intronic
1195928067 X:110046284-110046306 GGATAAAGAAGGCCCCCTGTTGG - Intronic
1199365100 X:146971630-146971652 GAGTCAGAAAGGGCCCCTATAGG - Intergenic
1199382270 X:147184141-147184163 GAGTCAGAAAGGGCCCCTATAGG + Intergenic
1201766121 Y:17574992-17575014 TAATCAACCAGGGCCCCTGGGGG + Intergenic
1201835431 Y:18330997-18331019 TAATCAACCAGGGCCCCTGGGGG - Intergenic