ID: 999282043

View in Genome Browser
Species Human (GRCh38)
Location 5:150372379-150372401
Sequence GGAGTGCAAGACTCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999282043_999282049 26 Left 999282043 5:150372379-150372401 CCCACAGGGGAGTCTTGCACTCC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 999282049 5:150372428-150372450 AGTTTCTCTGCCTAGTAAATGGG 0: 1
1: 0
2: 1
3: 41
4: 357
999282043_999282048 25 Left 999282043 5:150372379-150372401 CCCACAGGGGAGTCTTGCACTCC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 999282048 5:150372427-150372449 CAGTTTCTCTGCCTAGTAAATGG 0: 1
1: 0
2: 4
3: 42
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999282043 Original CRISPR GGAGTGCAAGACTCCCCTGT GGG (reversed) Intronic