ID: 999282043

View in Genome Browser
Species Human (GRCh38)
Location 5:150372379-150372401
Sequence GGAGTGCAAGACTCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999282043_999282049 26 Left 999282043 5:150372379-150372401 CCCACAGGGGAGTCTTGCACTCC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 999282049 5:150372428-150372450 AGTTTCTCTGCCTAGTAAATGGG 0: 1
1: 0
2: 1
3: 41
4: 357
999282043_999282048 25 Left 999282043 5:150372379-150372401 CCCACAGGGGAGTCTTGCACTCC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 999282048 5:150372427-150372449 CAGTTTCTCTGCCTAGTAAATGG 0: 1
1: 0
2: 4
3: 42
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999282043 Original CRISPR GGAGTGCAAGACTCCCCTGT GGG (reversed) Intronic
902155898 1:14485959-14485981 GCAGAGCAAGACTACCCTGTGGG - Intergenic
902894000 1:19466215-19466237 GGAGTGAAAGACCCTCCTGGCGG - Intronic
905531739 1:38685287-38685309 GGAGGTAAAGACCCCCCTGTGGG + Intergenic
905879554 1:41454748-41454770 GGAGCCCAAGATTCCCATGTGGG + Intergenic
906117401 1:43365965-43365987 GGAGTTCAAGAGCTCCCTGTTGG - Intronic
907934220 1:59027750-59027772 GGAGTTCAAGAGACCCCTATAGG - Intergenic
909048952 1:70745522-70745544 GGCCTGCCAGGCTCCCCTGTGGG - Intergenic
913287579 1:117240971-117240993 GGAGTGGAAGACTCACCAGCAGG - Intergenic
913498440 1:119449238-119449260 GGACTCCATGAATCCCCTGTGGG - Intergenic
914920020 1:151840049-151840071 GGAGTGCTGGCCTCACCTGTGGG + Intronic
915922452 1:159986763-159986785 AAAGTGCAGGCCTCCCCTGTGGG - Intergenic
916332648 1:163634491-163634513 GGATTGCACAACTCCCCTGTAGG + Intergenic
923299132 1:232624745-232624767 AGAGTTCAAGACACCCCTTTTGG + Intergenic
1064740097 10:18424274-18424296 GCAGAGCAAGGCTACCCTGTAGG + Intronic
1071246692 10:83773012-83773034 GGATTGCATGATTCCTCTGTGGG - Intergenic
1073523528 10:104157196-104157218 CCAGGGAAAGACTCCCCTGTGGG - Intronic
1076172495 10:128333614-128333636 GGAGTTCAAGACTTCACTGGGGG + Intergenic
1077284590 11:1760005-1760027 GGCCTGGAAGACTCCCCTGGTGG + Intronic
1078977409 11:16494793-16494815 GGAGTGCAGGAGTTCACTGTGGG - Intronic
1082922826 11:58514187-58514209 GGACTGTAAGTCTCACCTGTAGG - Intergenic
1085120711 11:73965646-73965668 GGAGTGGAAGGATCCCCAGTGGG + Intronic
1086281428 11:85194186-85194208 AGACTGCAAGACTCTCATGTTGG + Intronic
1088518581 11:110667802-110667824 GGAGTTCAAGACTCCAGTGGGGG + Intronic
1091671623 12:2456345-2456367 GTTGTGGGAGACTCCCCTGTCGG - Intronic
1094627092 12:32134543-32134565 GGAGAGAGAGACTTCCCTGTTGG + Intronic
1095453953 12:42362791-42362813 GGAGTGCAAGACACCCATGGAGG - Intronic
1095785971 12:46109480-46109502 GGATTGCCTGGCTCCCCTGTGGG - Intergenic
1100140315 12:91610683-91610705 GGAGAGACAGACTCCCCTGCTGG + Intergenic
1102352733 12:112206286-112206308 GGAGTTCAAGACCACCCTGAGGG + Intronic
1113750473 13:112773420-112773442 GGAAAGCAAGACTCACCCGTGGG - Intronic
1115936774 14:38561187-38561209 GGATTGCATGATTCCCCAGTGGG - Intergenic
1116016441 14:39413402-39413424 GGAGTTCAAGACTTCAGTGTAGG - Intronic
1118940523 14:70332300-70332322 GGAGTATAGGCCTCCCCTGTGGG + Intronic
1119264528 14:73256106-73256128 GGAGTCCAAGGCTCTCCTGCTGG - Intronic
1124121047 15:26888851-26888873 GGAGAGCAAGTCCCCCCGGTAGG + Intronic
1125006693 15:34824744-34824766 GGAGTGCACTTCTCCCCTGAAGG - Intergenic
1125263217 15:37850890-37850912 GGAGTTGAAGACCCACCTGTTGG + Intergenic
1132721422 16:1318144-1318166 AGAGTGAAAGCCTCCCCAGTGGG + Intronic
1136066335 16:27761434-27761456 GTAGTGCAAGTCTCCCCAGGAGG - Exonic
1136531451 16:30872380-30872402 GGAGTGTAAGGGACCCCTGTGGG + Intronic
1138223175 16:55270338-55270360 GGACTGCAGGGCTCCTCTGTAGG - Intergenic
1138282075 16:55779806-55779828 TGAGTGAAAGAATCCCCTCTCGG + Intergenic
1138558266 16:57785508-57785530 GGAGGGCCAGCCTCTCCTGTAGG + Intronic
1139906444 16:70369476-70369498 GGAGTAAAAGACTACCCTGGGGG - Intronic
1140376581 16:74449817-74449839 GGAGTGCATGGCTCCCCTGCCGG + Intergenic
1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG + Intronic
1147384070 17:40071544-40071566 GGACAGCAAGACCCACCTGTCGG - Intronic
1147451282 17:40506257-40506279 AGAGGGCAAGACTCCCAGGTGGG + Intergenic
1153293281 18:3522185-3522207 GGAGTGCAATAGTACCATGTCGG + Intronic
1153514641 18:5892075-5892097 GGAGTGCAGGACTAGCCTCTGGG + Exonic
1154312283 18:13276694-13276716 GGAGTGACAGACTCCCTTGCTGG - Intronic
1158978266 18:62732816-62732838 GGAGTTCAAGACTTCCATGGAGG + Intronic
1160311226 18:77792353-77792375 TGAGTGCAAGATTTTCCTGTAGG - Intergenic
1160733023 19:649733-649755 TGAGTGCAGGACTCCCCTGGAGG + Exonic
1161450042 19:4340332-4340354 GGAGTTCAAGACTAGCCTGAGGG - Intronic
1162844018 19:13378096-13378118 GGAGTTCAAGACTTCACTGGAGG + Intronic
1164207307 19:23069585-23069607 GGAGTTCAAGACTACCCTGGGGG + Intergenic
1167724331 19:51200359-51200381 GGAGGCCAAGACCCCACTGTGGG - Intergenic
925444443 2:3915657-3915679 GGAGGGCTGGGCTCCCCTGTGGG + Intergenic
925444453 2:3915689-3915711 GGAGGGCTGGGCTCCCCTGTGGG + Intergenic
925444463 2:3915721-3915743 GGAGGGCTGGGCTCCCCTGTGGG + Intergenic
925587242 2:5475873-5475895 GGAGTGTCAGAATCCCCTGCAGG + Intergenic
926036145 2:9637569-9637591 GGAGTGAAAGGGACCCCTGTGGG + Intergenic
930332376 2:50001912-50001934 GGAGTGCCAGACTCTCCTGCTGG + Intronic
932635820 2:73386589-73386611 GAATTGCAGGACTCCCCTGAGGG + Intronic
934659325 2:96134744-96134766 GGAAGGCAAGACTGTCCTGTTGG - Intronic
940385720 2:153069082-153069104 GCTGTGCAAGAATGCCCTGTAGG + Intergenic
942660803 2:178263270-178263292 GGAGTTCAAGACTAGCCTGACGG + Intronic
946055487 2:216897620-216897642 GGAGTTCAAGACCAGCCTGTAGG - Intergenic
946355551 2:219182258-219182280 GGAGTGAAATGCTCCCCTGGAGG + Exonic
946390011 2:219409439-219409461 GGAGTGGAAGGTGCCCCTGTGGG + Intergenic
948145299 2:235703881-235703903 GGAGTTCAAGACTAGCCTGCAGG - Intronic
948459180 2:238120939-238120961 GGAATGCACGAGTCCCCTGGGGG - Intronic
1171290756 20:23981704-23981726 TGACTACAAGACGCCCCTGTGGG + Intergenic
1172189041 20:33050470-33050492 GGTGTGTCAGAGTCCCCTGTTGG + Intergenic
1172465156 20:35150960-35150982 GGTGTTCAAGTCTTCCCTGTGGG + Intergenic
1175190681 20:57210520-57210542 GGGGAGTAAGACTCCCATGTGGG + Intronic
1175684214 20:61015477-61015499 GGAATGCAAAAATCCCCTGCTGG + Intergenic
1175993926 20:62804151-62804173 AGAGAGAAAGACTCCCCTGGTGG + Intergenic
1175998317 20:62821174-62821196 GGGGTCCCAGACTTCCCTGTGGG - Exonic
1179647416 21:42784358-42784380 GCTGTGCCAGACTGCCCTGTGGG - Intergenic
950362919 3:12462443-12462465 GGTGTGCAGGACACCCCTGGGGG - Intergenic
950700083 3:14738053-14738075 GGAGTTCAAGACTCCAGTGGAGG - Intronic
952360322 3:32624603-32624625 GGAGTTCAAGACCAGCCTGTGGG - Intergenic
954527111 3:51281850-51281872 GAAGTGGAAGACTCCTCTCTGGG - Intronic
958162107 3:89830830-89830852 GGAGTGAGAGACTCTCCTGTTGG + Intergenic
959462521 3:106644150-106644172 GGAGTGCAGGTATGCCCTGTGGG + Intergenic
964194375 3:154045588-154045610 GTAGAGCAAAACTCCTCTGTGGG - Intergenic
964242693 3:154615602-154615624 GGACTGCAGGATTCTCCTGTAGG - Intergenic
975546672 4:75567701-75567723 GCAGAGCAAGGCTACCCTGTAGG + Intergenic
979534442 4:121803738-121803760 GGAGTTCAAGACTAGCCTGCTGG - Intronic
982021882 4:151212969-151212991 GGGGTTCAAGACTCCCGTGGAGG + Intronic
982191080 4:152855785-152855807 GGATTGCAAGAGTCCACAGTGGG + Intronic
986299605 5:6467629-6467651 GGAAAGCAAGGCTCTCCTGTGGG - Intronic
988613359 5:32749682-32749704 GGAGTGAAAGTCTCACCTTTAGG + Intronic
992021957 5:72633735-72633757 GGAGTGGATGACTCACATGTGGG - Intergenic
995031618 5:107488129-107488151 GGAGTACATGAGTCCCATGTGGG + Intronic
996155384 5:120093082-120093104 GGAGAGTAAGTCTCCCTTGTGGG + Intergenic
996177852 5:120381026-120381048 GGAGTTCAAGACTTCACTGAAGG - Intergenic
998856443 5:146399275-146399297 GCAGTTCAAGTCACCCCTGTCGG + Intergenic
999210709 5:149886163-149886185 GGACCACAAGACTTCCCTGTTGG + Intronic
999282043 5:150372379-150372401 GGAGTGCAAGACTCCCCTGTGGG - Intronic
999627116 5:153532567-153532589 GGAGTCCAAGACACTGCTGTGGG - Intronic
1003107740 6:3228464-3228486 GGAGTGCATAACGCCCCTGCTGG + Intronic
1003153666 6:3573273-3573295 GGAGGCTAAGACTGCCCTGTAGG - Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1008536618 6:52510919-52510941 GGAGTGCAATACACACCAGTTGG + Intronic
1010474857 6:76274709-76274731 GGACTGGAAGAATCCCCTGTGGG - Intergenic
1013031635 6:106339443-106339465 GGAGTCCAAGACTCCACAGAGGG - Intergenic
1015246904 6:131085151-131085173 GGAGTGCAGGGGTCCCCTGCTGG - Intergenic
1016438816 6:144063817-144063839 CGAGAGCAGGACTCCCCTGATGG - Intronic
1017744737 6:157436402-157436424 GGAGAGCATGACTTTCCTGTAGG + Intronic
1017819564 6:158039506-158039528 GAAGTGCCAGGCTCCCCTGAGGG - Intronic
1019452625 7:1107777-1107799 GGGGTGCAGGACTCCAGTGTGGG - Intronic
1019691436 7:2416305-2416327 GGAGTTCAAGACTCCGGTGCAGG - Intronic
1022495915 7:30853098-30853120 GGGGTGCAGCCCTCCCCTGTTGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1029460853 7:100693531-100693553 GGAGGGCAAGGCTTCCATGTTGG + Intergenic
1036417435 8:8563803-8563825 GCAGTGAAAGACATCCCTGTGGG + Intergenic
1052494568 9:29211747-29211769 GGAGTGCAAGACTCCAGGGATGG - Intergenic
1053007542 9:34614056-34614078 GGAGTCCAAGGCTCTCCTGGAGG - Exonic
1056877533 9:90349247-90349269 GGAGAGCATGAATCCCCTGAGGG - Intergenic
1056994784 9:91445655-91445677 GGGGCGCAAGACTGCTCTGTAGG + Intergenic
1059833774 9:118128048-118128070 GGATTGCAAGGCTCCCTAGTGGG - Intergenic
1061005925 9:127928407-127928429 GGAGGCCCAGACTCCCGTGTGGG - Intronic
1061386121 9:130290232-130290254 GCAGGGCCAGACCCCCCTGTAGG - Intronic
1062431606 9:136528998-136529020 GGAGCCCTAGACTCCCCTCTGGG - Intronic
1187045137 X:15640368-15640390 GCAGAGCAGGACTACCCTGTAGG - Intronic
1192190762 X:68989947-68989969 CGAGTGCCAGCTTCCCCTGTTGG - Intergenic
1198024682 X:132693517-132693539 GGAGTTCAAAACACCACTGTAGG - Intronic