ID: 999282722

View in Genome Browser
Species Human (GRCh38)
Location 5:150375664-150375686
Sequence ATGTCTGCACACACCTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999282719_999282722 20 Left 999282719 5:150375621-150375643 CCCAACCTCACACTGGGACTCTG 0: 1
1: 0
2: 1
3: 21
4: 210
Right 999282722 5:150375664-150375686 ATGTCTGCACACACCTACCCTGG 0: 1
1: 0
2: 0
3: 22
4: 163
999282721_999282722 15 Left 999282721 5:150375626-150375648 CCTCACACTGGGACTCTGTCTAC 0: 1
1: 0
2: 1
3: 18
4: 251
Right 999282722 5:150375664-150375686 ATGTCTGCACACACCTACCCTGG 0: 1
1: 0
2: 0
3: 22
4: 163
999282720_999282722 19 Left 999282720 5:150375622-150375644 CCAACCTCACACTGGGACTCTGT 0: 1
1: 0
2: 2
3: 17
4: 258
Right 999282722 5:150375664-150375686 ATGTCTGCACACACCTACCCTGG 0: 1
1: 0
2: 0
3: 22
4: 163
999282718_999282722 23 Left 999282718 5:150375618-150375640 CCTCCCAACCTCACACTGGGACT 0: 1
1: 0
2: 0
3: 29
4: 248
Right 999282722 5:150375664-150375686 ATGTCTGCACACACCTACCCTGG 0: 1
1: 0
2: 0
3: 22
4: 163
999282715_999282722 30 Left 999282715 5:150375611-150375633 CCTGTGGCCTCCCAACCTCACAC 0: 1
1: 0
2: 2
3: 26
4: 275
Right 999282722 5:150375664-150375686 ATGTCTGCACACACCTACCCTGG 0: 1
1: 0
2: 0
3: 22
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999282722 Original CRISPR ATGTCTGCACACACCTACCC TGG Intronic
900313078 1:2043769-2043791 AGCTCTGCACACAGCTTCCCTGG - Intergenic
901849068 1:12003862-12003884 AGGGCTGCACACACGCACCCAGG - Intronic
903643058 1:24872819-24872841 ATGTCTGGACACATCTCCCAAGG - Intergenic
904749692 1:32733874-32733896 ATGTCTGCAAACACCTAGAGAGG + Intergenic
904869750 1:33609079-33609101 GAGCCTGCACACACCTTCCCTGG + Intronic
905038247 1:34930611-34930633 GTGTTTCCTCACACCTACCCTGG - Intergenic
905290003 1:36914852-36914874 ATGTGTGCTCACACCTGCCCAGG - Intronic
911420673 1:97636857-97636879 ATGCCTTGACAAACCTACCCAGG + Intronic
919205800 1:194420638-194420660 AAGGGTGCACACACCTACCCAGG + Intergenic
919591172 1:199504475-199504497 ATGTCTGCACCCTCTTCCCCAGG + Intergenic
919805735 1:201380073-201380095 ATGCCTGCACCCCCCTCCCCTGG - Intronic
920118642 1:203639017-203639039 ATCTCTGCACACCTCTTCCCAGG - Intronic
924179387 1:241424895-241424917 GTGTGTGCACACACCTGGCCGGG - Intergenic
1063290355 10:4739576-4739598 ATGGCTGCATAGACCTACTCGGG + Intergenic
1063513090 10:6665894-6665916 ATGTTTGCACAGACCAACTCTGG - Intergenic
1064227702 10:13501867-13501889 ATGTTTACACACACATACCCTGG - Intronic
1069476359 10:68736471-68736493 ATGTCTGCCCAATCCTGCCCTGG + Intronic
1072945038 10:99802381-99802403 ATGCCTGCAAACACATAGCCAGG + Intronic
1075648022 10:124109222-124109244 ATGTCTGGAGTCACCTGCCCTGG - Intergenic
1076425300 10:130363250-130363272 AAGACGGAACACACCTACCCTGG - Intergenic
1076794326 10:132791364-132791386 ATCTCTGAACACCCCTTCCCTGG - Intergenic
1077144716 11:1039790-1039812 AGGTCTGCTCACACCTGTCCAGG - Intergenic
1081687710 11:45054245-45054267 CTGTCTGCACTCACATCCCCGGG + Intergenic
1082687771 11:56260690-56260712 TAGTTTGCACACACCTACCTGGG + Intergenic
1082934354 11:58640862-58640884 ATGTGTGCACACATGGACCCAGG + Intronic
1084095367 11:66907759-66907781 ATGTGTGGGCACCCCTACCCAGG + Intronic
1084440561 11:69170351-69170373 ATGTCTTCACCCACATCCCCAGG + Intergenic
1084458868 11:69285226-69285248 CTCTCTGGACACACCTGCCCTGG + Intergenic
1085741660 11:79082589-79082611 ATGTGTGCACACACACACACAGG + Intronic
1088365079 11:109032057-109032079 ATGTCTACCCACTCATACCCTGG + Intergenic
1089673599 11:120073980-120074002 ATGCTTGCACAGACCCACCCTGG + Intergenic
1091001815 11:131916186-131916208 ATGTCTGCTCACTTCCACCCAGG - Intronic
1092268754 12:7004631-7004653 ATGTGTATACACACATACCCAGG + Intronic
1094288267 12:28817901-28817923 ATGTCTGCACAAACCTCAGCAGG - Intergenic
1094520927 12:31187860-31187882 ATGTGTGCACACACACACACAGG - Intergenic
1095835762 12:46637537-46637559 ATGGCTGCCCACTCCTCCCCTGG - Intergenic
1097371617 12:58788578-58788600 ATGTATGCACACATATACCATGG - Intronic
1101274976 12:103189685-103189707 ATGCCTGCACCCACAAACCCAGG + Intergenic
1101351320 12:103931745-103931767 ATGTATGCACACAACTCACCGGG - Intronic
1101351729 12:103935966-103935988 ATGGCTGCTAACACCTATCCAGG + Intronic
1104299003 12:127546927-127546949 ATGTCTGTCCACACCTCACCAGG + Intergenic
1105707793 13:22979235-22979257 GTGTCTGCACACAGATATCCTGG - Intergenic
1107007186 13:35626055-35626077 ATGGCTGCACAAAACTCCCCTGG - Intronic
1112261485 13:97881917-97881939 ATGTATCCACACACGTACCCAGG + Intergenic
1112329423 13:98465421-98465443 ATGCCTGCACACATCTCCACTGG + Intronic
1113579578 13:111419529-111419551 AAGTTTGCAGACACCTTCCCTGG - Intergenic
1117640413 14:57792560-57792582 ATATATGCACACACATACCATGG + Intronic
1118158651 14:63266910-63266932 ATGTCTGCACACACACACTGTGG - Intronic
1122330955 14:100912206-100912228 TTGTCTGCACTCACCTTCTCTGG - Intergenic
1122803529 14:104245026-104245048 GTGTCTGCTCACACCTGCTCAGG - Intergenic
1123934103 15:25185881-25185903 GTGTCTGCACTCAGCTTCCCCGG + Intergenic
1129717348 15:77860042-77860064 CTGTCTGAACACCCCTACCTTGG - Intergenic
1130461405 15:84160143-84160165 CTGTCTGAACACCCCTACCTTGG + Intergenic
1130654872 15:85785633-85785655 ATGTGGACACACACCTACCCTGG - Intronic
1132076098 15:98821859-98821881 ATGTGTGCACACACACACACAGG + Intronic
1135351275 16:21731150-21731172 CTGTCTGCACACATCTGCCTGGG - Intronic
1135449755 16:22547276-22547298 CTGTCTGCACACATCTGCCTGGG - Intergenic
1139810800 16:69615550-69615572 ATGTCTGTACACACACACACAGG + Intronic
1139908274 16:70381183-70381205 GGGTCTGCACGCACCTATCCGGG + Exonic
1140686971 16:77443000-77443022 ATGTGTGCACACACTCACCTGGG - Intergenic
1140773742 16:78230225-78230247 ATGTTTTCACAAACCTTCCCTGG - Intronic
1141576658 16:84968344-84968366 GTGCCTGCGCACACCCACCCAGG - Intergenic
1141854453 16:86671709-86671731 GTGTCTGCACACACCCTCCCCGG + Intergenic
1143921567 17:10334288-10334310 ATGTCTCCCCACAGCTACCAGGG - Intronic
1147421086 17:40322519-40322541 CTGTGTGTACACACCTACCTTGG + Intronic
1147684655 17:42279905-42279927 ATCTGTGCACACACCCAGCCAGG - Intergenic
1147959695 17:44159153-44159175 ATGTGGGCAGAAACCTACCCAGG + Intronic
1149555561 17:57571027-57571049 CTGAGTGCACACTCCTACCCTGG - Intronic
1149589144 17:57815586-57815608 ATGGATGCCCACACATACCCTGG + Intergenic
1151509825 17:74551324-74551346 ATGTCAGCACACACACACACGGG + Intergenic
1203167718 17_GL000205v2_random:113463-113485 ATGCCTGCACCCCCCAACCCAGG - Intergenic
1156358809 18:36365751-36365773 ATTTCTCCCCACACCTAGCCCGG - Intronic
1159941231 18:74410644-74410666 ATGTAGACACACACCTGCCCTGG + Intergenic
1160418533 18:78728338-78728360 CTGTCTGCTCAGACTTACCCCGG - Intergenic
1160986239 19:1840231-1840253 ATCTCTGCAGACACCTGCCCTGG - Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1163323774 19:16590031-16590053 GTGTCTGCACTCTCCTGCCCTGG + Intronic
1163536297 19:17878590-17878612 TTGTCTGCTCACACCTACTGAGG - Intronic
926157407 2:10464523-10464545 ATGTCGGCACACAGCCACTCAGG - Intergenic
938320385 2:130358740-130358762 GGGTCTGCACTCACCTCCCCAGG + Intronic
941695211 2:168544109-168544131 ATTTATGCACATACCTACCATGG + Intronic
941895040 2:170620677-170620699 CTGTGTGCACAGATCTACCCGGG - Intronic
943636239 2:190309907-190309929 ATACCTGCACAGACATACCCAGG - Intronic
948612357 2:239178069-239178091 CTGTCTGCACACACTTTCCTCGG + Intronic
948897583 2:240934510-240934532 CTGTCTGCCCCCACCCACCCTGG + Intronic
1170030763 20:11941607-11941629 ATATCTACACAAACCTATCCTGG - Intergenic
1170884432 20:20327927-20327949 ATGTCAGCACTCATCTGCCCCGG + Intronic
1172303492 20:33865650-33865672 ATGTCAGTACCCACCTGCCCGGG + Intergenic
1173075236 20:39812182-39812204 CTGTCTCCACACACATACCCTGG + Intergenic
1175571722 20:60028097-60028119 ATGATTACACAGACCTACCCAGG - Intronic
1175790610 20:61737915-61737937 AGCCCTGCGCACACCTACCCTGG - Intronic
1175821854 20:61914257-61914279 GGGGCTTCACACACCTACCCCGG + Intronic
1176333836 21:5577150-5577172 ATGTCTGCACCCCCCAACCCAGG + Intergenic
1176393921 21:6243802-6243824 ATGTCTGCACCCCCCAACCCAGG - Intergenic
1176404039 21:6345673-6345695 ATGCCTGCACCCCCCAACCCAGG + Intergenic
1176433118 21:6643431-6643453 ATGCCTGCACCCCCCAACCCAGG - Intergenic
1176467498 21:7072372-7072394 ATGTCTGCACCCCCCAACCCAGG + Intronic
1176491059 21:7454150-7454172 ATGTCTGCACCCCCCAACCCAGG + Intergenic
1176509583 21:7684233-7684255 ATGTCTGCACCCCCCAACCCAGG - Intergenic
1177298055 21:19202546-19202568 GTGTATGCACACACCTGCTCAGG - Intergenic
1179324849 21:40332243-40332265 ATTTCTCCCCACTCCTACCCTGG + Intronic
1179524972 21:41970060-41970082 ATGCATGCCCACAGCTACCCTGG + Intergenic
1181468370 22:23122910-23122932 ATGTCTTCACCCACCTCCCACGG - Intronic
1183507923 22:38219803-38219825 GTGTCTGCACCCACCCTCCCGGG + Exonic
1183683472 22:39348983-39349005 ATGTCTGCAGTCACCTTCACTGG - Intergenic
1184749365 22:46475956-46475978 ATGTGTGAACACACCTTCCTGGG - Intronic
1185182509 22:49371582-49371604 ATGGCTGGAAACACCCACCCGGG - Intergenic
950205555 3:11077543-11077565 ATGTCTGCAAACACATACGCAGG + Intergenic
954421622 3:50421907-50421929 ATGTCTGCCGACACCTCCCCAGG - Intronic
954429114 3:50459813-50459835 ATGTCTGCTGACCCCTCCCCAGG - Intronic
954704594 3:52472585-52472607 TGGTCTGCACACACCTTCCCTGG + Intronic
956288022 3:67631152-67631174 ATGTCTTCACATACCTGCACTGG - Intronic
957369213 3:79269896-79269918 AACTCTGCAAACACCTAACCAGG - Intronic
959541883 3:107549468-107549490 ATCTTTGCACACACCTATCCTGG - Intronic
959897019 3:111617028-111617050 AAGTGTGCACACACCTGGCCAGG - Intronic
959940747 3:112078251-112078273 AAGTGTACACACACATACCCAGG - Intronic
960092143 3:113651912-113651934 ATGTCTGAACACAGCTAAGCAGG + Exonic
961395029 3:126580576-126580598 AGGTCGGCACCCACCCACCCTGG + Intronic
962911180 3:139851558-139851580 ATGCATGCACCCACCCACCCAGG - Intergenic
964461527 3:156936258-156936280 ATGTCTGCACTCAACCACACTGG + Intronic
966948642 3:184796048-184796070 ATGTCTGCCCCCACCCACACTGG - Intergenic
968116224 3:196092125-196092147 AGCTCTGCAGACACCTCCCCAGG + Intergenic
982148935 4:152430343-152430365 ATTTCTGGACACACCTAACAAGG - Intronic
985913588 5:2901275-2901297 AGGTCTGCACACACCCACGCAGG - Intergenic
987957289 5:24756541-24756563 ATGTATACACAAACATACCCTGG + Intergenic
988702606 5:33690130-33690152 ATGGATGCACACACCTGCACTGG - Intronic
988808548 5:34762893-34762915 ATATCTACACACACATGCCCAGG - Intronic
989247245 5:39268268-39268290 ATGTCACCACACTCCAACCCAGG - Intronic
990023673 5:51159731-51159753 AAGTGTGCACACACCCAGCCTGG - Intergenic
991030673 5:62078995-62079017 ATGTCTGCAGAGACCTAGCCTGG - Intergenic
992557782 5:77920165-77920187 ATGTGTGCACACATGTGCCCAGG - Intergenic
999282722 5:150375664-150375686 ATGTCTGCACACACCTACCCTGG + Intronic
1000835820 5:166152799-166152821 ATGTATGCACATACTTACACAGG + Intergenic
1001985924 5:176074412-176074434 ATGGCTGCAAACACCTGGCCTGG - Intronic
1002230947 5:177763712-177763734 ATGGCTGCAAACACCTGGCCTGG + Intronic
1002264391 5:178020036-178020058 ATGGCTGCAAACACCTGGCCTGG - Intronic
1002686824 5:181018931-181018953 ATGTCTACACTCAGCTAACCAGG - Intergenic
1006679418 6:35786822-35786844 CCGTCTGCACAGACTTACCCCGG + Intronic
1006876488 6:37301911-37301933 ATGCCTGGAGAGACCTACCCAGG - Intronic
1009435314 6:63610856-63610878 ATGTCTGTACTCAGCTACTCAGG + Intergenic
1013354189 6:109332805-109332827 ATGTCTGGGCACTCATACCCAGG + Intergenic
1015853970 6:137603908-137603930 ATGCCTGCACCCCTCTACCCAGG + Intergenic
1018434105 6:163745639-163745661 ATGTATGCAGACACATAACCTGG - Intergenic
1018906118 6:168077124-168077146 ATGTGTGCACACACCAACAGAGG + Intronic
1019127906 6:169853544-169853566 GTGTGTGCACACACGTGCCCTGG + Intergenic
1019567835 7:1693399-1693421 ATATGTGCACATACCTACTCAGG - Exonic
1019710523 7:2516333-2516355 ATGTCTCCACAGATCTTCCCAGG + Intronic
1019777709 7:2922386-2922408 ACGTCTGCACTCACCTGCCCAGG - Intronic
1020910895 7:14129659-14129681 ATTTCTTCACACACATACGCAGG - Intergenic
1021185746 7:17562767-17562789 ATGCCAGCAAACACCTACTCTGG + Intergenic
1021231723 7:18093207-18093229 AAGTCTCCACACACCTGCCAGGG - Intronic
1023140335 7:37095467-37095489 ATCTCTGCATTCACCTACTCTGG - Intronic
1023745979 7:43322772-43322794 ATGTGTGCACAAACCTACAATGG + Intronic
1026868856 7:73838779-73838801 ATGCCTGCCCAGACCTGCCCAGG + Intronic
1032616609 7:133479398-133479420 ATATTTGTTCACACCTACCCAGG - Intronic
1033658215 7:143387380-143387402 ATGTCTGGAAAAGCCTACCCAGG - Intronic
1035448961 7:158962771-158962793 GTGTATGCACACACATACACGGG - Intergenic
1036627695 8:10485055-10485077 ATGCCTGCACACAGCTGCCATGG - Intergenic
1037813431 8:22099659-22099681 CTGTCTGCACACACCGGGCCTGG + Intronic
1038014997 8:23507339-23507361 AGCTCTGCACACACCTCCCTGGG - Intergenic
1039009482 8:33076832-33076854 ATGTATGCACACACACACACAGG - Intergenic
1040271353 8:45949423-45949445 ATGTCTTCACTCAACTACCAGGG + Intergenic
1042687928 8:71462329-71462351 AAGTGTGCACACACCCAGCCGGG + Intronic
1043502505 8:80872345-80872367 ATTTCTGCCCACATCTACTCTGG + Intronic
1044388697 8:91622774-91622796 GTGTCTGCACACACACACACAGG + Intergenic
1045257134 8:100535713-100535735 ATGGATACACACAGCTACCCTGG - Intronic
1047697714 8:127419392-127419414 TTGTCTCCCCACATCTACCCAGG + Exonic
1047971765 8:130090791-130090813 ATGCTTGCACACACATAACCCGG + Intronic
1048543662 8:135366066-135366088 ATGGCAGCACACACCTGCCCTGG - Intergenic
1049220995 8:141428770-141428792 ATGTGTGCCCACACAGACCCAGG + Intronic
1049332241 8:142060804-142060826 ATCTCTGCAGCCACCTGCCCTGG + Intergenic
1049800435 8:144515164-144515186 ATGACTGCACGCTCCTGCCCAGG + Exonic
1051796728 9:20880053-20880075 ATTTCTGCATACACATACACAGG - Intronic
1053030918 9:34777315-34777337 ATGCCAGCACACACCAACCAGGG - Intergenic
1057612987 9:96563185-96563207 GTCTCTGCACACCCCTCCCCTGG - Intronic
1203427862 Un_GL000195v1:58067-58089 ATGTCTGCACCCCCCAACCCAGG - Intergenic
1203438417 Un_GL000195v1:165239-165261 ATGCCTGCACCCCCCAACCCAGG + Intergenic
1191800419 X:65073202-65073224 ATGCATGCACACACATACGCTGG + Intergenic
1192830080 X:74742105-74742127 ATGTCTGCAGATACCCTCCCGGG + Exonic
1194891536 X:99384977-99384999 AAGTGTGCACACACCTGGCCAGG + Intergenic
1199606563 X:149583886-149583908 ACATCTGCCCACACCTGCCCAGG + Intronic
1199632560 X:149785482-149785504 ACATCTGCCCACACCTGCCCAGG - Intronic
1199762141 X:150913057-150913079 ATTGCTGCACCCACCAACCCAGG + Intergenic
1199987586 X:152963662-152963684 ATGTCTCAACTCACCTAGCCTGG + Intronic
1201856233 Y:18546869-18546891 TTGTGTGAACACACCTTCCCTGG + Exonic
1201877088 Y:18773515-18773537 TTGTGTGAACACACCTTCCCTGG - Exonic