ID: 999285128

View in Genome Browser
Species Human (GRCh38)
Location 5:150390070-150390092
Sequence ATGTGGGTAAGTATGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999285128_999285132 -8 Left 999285128 5:150390070-150390092 CCTACTTCCATACTTACCCACAT 0: 1
1: 0
2: 1
3: 19
4: 231
Right 999285132 5:150390085-150390107 ACCCACATGTGCTGATGGGATGG 0: 1
1: 0
2: 0
3: 11
4: 177
999285128_999285136 25 Left 999285128 5:150390070-150390092 CCTACTTCCATACTTACCCACAT 0: 1
1: 0
2: 1
3: 19
4: 231
Right 999285136 5:150390118-150390140 CTGTCACGCCCACACTCCAGAGG 0: 1
1: 0
2: 2
3: 5
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999285128 Original CRISPR ATGTGGGTAAGTATGGAAGT AGG (reversed) Intronic
901097296 1:6692465-6692487 TTGGGGCTAAGTATGGGAGTAGG - Intronic
901365842 1:8747356-8747378 ATGGGGGTGGGCATGGAAGTGGG + Intronic
902247549 1:15130984-15131006 ACGTGGGTAAGCCTGGAAGCAGG + Intergenic
905124111 1:35705233-35705255 ATCTGGGTGAGTATGGGGGTAGG + Intergenic
906827529 1:48997357-48997379 GTGTGGGTAAGCATACAAGTAGG + Intronic
907768254 1:57432657-57432679 ATCTGGGGAACAATGGAAGTTGG - Intronic
907888668 1:58617642-58617664 ATTTGGGAAAGTTGGGAAGTTGG - Intergenic
908520764 1:64939384-64939406 TTGTGTGAATGTATGGAAGTTGG - Intronic
909218827 1:72927929-72927951 ATCTGGGCAAGGAAGGAAGTAGG - Intergenic
909554002 1:76932469-76932491 CTTTAGGTAAGTATGTAAGTAGG + Intronic
910303942 1:85740402-85740424 ATGTGGGTAGATATGATAGTGGG - Intronic
911664998 1:100541849-100541871 ATCTGAATAATTATGGAAGTTGG + Exonic
912948039 1:114100915-114100937 ATGTGGGAGTGTATGGAAATAGG - Intronic
913244318 1:116858312-116858334 ATGTGGGTCAGTATGGGTGAGGG - Intergenic
916335755 1:163669350-163669372 ATGTGGGAGAGTATGGCAGGGGG + Intergenic
917058680 1:171012951-171012973 TTGAGGGCAAGTATGGAAGGTGG - Intronic
918735645 1:188059376-188059398 ATGTTGGTGAGTATGTAAATTGG - Intergenic
920612669 1:207456700-207456722 ATGGAGGTAAGTTTGTAAGTTGG - Intronic
920847511 1:209606438-209606460 ACGTGGGTAAGTCTGGGAGCAGG + Exonic
921199745 1:212793137-212793159 AGGTGGGTCAGTAAGGAATTTGG + Intronic
922202472 1:223417660-223417682 ATTGAGGTAAGTATGGAATTTGG + Intergenic
922262420 1:223954456-223954478 ATGTGAGTAAGCATGGATTTTGG - Intergenic
1062949234 10:1484928-1484950 ATGCAGGTAGGTATGGAAATGGG + Intronic
1068434215 10:56970037-56970059 ATGTGGGTAAGTAAAGAAAGAGG - Intergenic
1068496099 10:57786948-57786970 ATGTGGGTAAGAAGGAAAGGAGG - Intergenic
1068525858 10:58128715-58128737 ATGTTGATAACTATGGAAGCTGG - Intergenic
1068612255 10:59073211-59073233 AGGTGGATAAGTATGGTATTGGG - Intergenic
1068645177 10:59458040-59458062 ATGATGGTAACAATGGAAGTGGG + Intergenic
1069938317 10:71935056-71935078 TGGTGGGGAAGGATGGAAGTGGG - Intergenic
1070356589 10:75646041-75646063 ATGGGGGTGAGGATGGAGGTGGG - Intronic
1070469129 10:76760496-76760518 ATATGAGTAAGCATGGAAGCAGG - Intergenic
1071182380 10:83002039-83002061 ATTTGGGTAGGAATGGAAGTTGG + Intergenic
1071360305 10:84839861-84839883 ATGTTGGTTAGTATAGAAATTGG - Intergenic
1072305590 10:94103726-94103748 GTGTGGGTAAGGATAGAAGGAGG - Intronic
1075911437 10:126128543-126128565 ATGTGGGAATGTGTGCAAGTGGG + Intronic
1075911451 10:126128645-126128667 ATGTGGGAATGTGTGCAAGTGGG + Intronic
1077935060 11:6775205-6775227 ATGTGGGTGAGAATGTAAATTGG - Intergenic
1078010252 11:7567962-7567984 ATGTGGGTTAGGATTGGAGTTGG + Intronic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1078818697 11:14853543-14853565 ATGTGGTTAAGTAACAAAGTAGG + Intronic
1079822556 11:25148827-25148849 ATGAGGATAAGTGTGGTAGTGGG + Intergenic
1081078353 11:38705456-38705478 ATGTGCTTAAGTAGGTAAGTGGG + Intergenic
1081841344 11:46203646-46203668 AAGTGGGTAAGTTTAGCAGTGGG + Intergenic
1084713533 11:70859205-70859227 ATGAGGGTAAGTAGGCAAGTGGG + Intronic
1086376741 11:86208431-86208453 ATGTGGGTCAGAATGTAAATTGG + Intergenic
1088634039 11:111802114-111802136 AAGTTGGTAAGGAGGGAAGTTGG - Intronic
1090537585 11:127661297-127661319 TTGTGGGGAAGAGTGGAAGTGGG - Intergenic
1091150941 11:133327209-133327231 ATGTGGGTATGTGTGTATGTGGG + Intronic
1091244522 11:134080851-134080873 ATGTGGGAAAGTTTGGAACTCGG + Intronic
1092011384 12:5115571-5115593 ATGTGGGTGTGTATGGAAAAGGG + Intergenic
1094124623 12:27010801-27010823 TTCTGGGTAAGAATGGAAGATGG - Intronic
1095821353 12:46482189-46482211 ATGAGGGTAAGAATAGAAATGGG - Intergenic
1098521323 12:71437982-71438004 ATGTGGGAAAATATGGTATTTGG - Intronic
1102154206 12:110711501-110711523 AGATGGGTAAGTATGTAACTGGG + Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1104820759 12:131675993-131676015 ATGTGGGAAAGGATGCATGTGGG - Intergenic
1108120278 13:47178330-47178352 ATCAGTGTAAGTATGGAATTTGG + Intergenic
1108163049 13:47662796-47662818 ATGTGTGTATGTATGTATGTAGG - Intergenic
1110553747 13:76835401-76835423 ATGTGGGTAACTATGTGAGTTGG + Intergenic
1112569754 13:100583079-100583101 ATGTTGCTAAGTGTTGAAGTTGG - Intronic
1114664776 14:24370930-24370952 ATGTGGCTGAGTGTGGAACTTGG + Intronic
1115590654 14:34861467-34861489 ATGTGAGAAAGTATGAAAGAAGG + Intronic
1117533666 14:56684176-56684198 ATCTGGGTAAGATTGGAGGTAGG + Intronic
1118397572 14:65350446-65350468 AAGTGGGTAGGACTGGAAGTCGG + Intergenic
1122775609 14:104115835-104115857 ATGGGGGTGGGGATGGAAGTGGG - Intergenic
1202893344 14_KI270722v1_random:180564-180586 ATGTGGCTAAGCATGTAAATAGG - Intergenic
1131563812 15:93467541-93467563 ATGTGAGTAAGCCTGGAAGCAGG - Intergenic
1131636274 15:94236131-94236153 ATGTTGGTGATTATGGAAGGTGG + Intronic
1132676357 16:1122930-1122952 CTGTGGGTGGGTATGGAGGTAGG - Intergenic
1133959054 16:10476419-10476441 ATATTGGAAAGTATGAAAGTTGG - Intronic
1134037237 16:11040300-11040322 TTGTGGGTAGGTATGGAAACAGG + Intronic
1137062614 16:35805371-35805393 AGCTGGGTAAGTAAGGAAGAAGG - Intergenic
1137339856 16:47590962-47590984 ATGGAGGTAAGTATGGATGAAGG - Intronic
1137632915 16:49960090-49960112 ATGAGGGTTTGTGTGGAAGTGGG - Intergenic
1138848179 16:60593031-60593053 ATGTAGGTAGGTATGTATGTAGG + Intergenic
1141928938 16:87187854-87187876 ATGTGGGTACGTGTGGGTGTGGG + Intronic
1144375289 17:14633917-14633939 TTATGAGTAAGTATGGAGGTGGG + Intergenic
1144534137 17:16070673-16070695 ATGTGGGAAAGTATGCAGCTTGG - Intronic
1144845966 17:18219249-18219271 ATTAGGGTCAGTAAGGAAGTGGG - Intergenic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1148945668 17:51260103-51260125 AGGAGGGTATGTAGGGAAGTGGG - Intronic
1150327928 17:64271722-64271744 ATGGGGGTCATTCTGGAAGTTGG - Intergenic
1150835620 17:68561631-68561653 ATGTGGATAAGTATACAAGTTGG - Intronic
1151281515 17:73078401-73078423 AGGTAGGTAAGTAAGGAGGTAGG + Intronic
1153948845 18:10040309-10040331 ATAAGGGTATGTATGGAAATAGG - Intergenic
1154263123 18:12855266-12855288 ATGTAGGTAAGAAAGGAAGTGGG + Intronic
1155098402 18:22582982-22583004 ATGTGTGATAGGATGGAAGTAGG + Intergenic
1156444997 18:37229920-37229942 AAGTGGGTAAGTTTGAAAATAGG - Intronic
1156753119 18:40485322-40485344 ATGGGGGTAGGGATGGAGGTGGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158331176 18:56364495-56364517 CTGTGGGGAAGAGTGGAAGTGGG - Intergenic
1161568019 19:5014030-5014052 CTGTGGGAAGATATGGAAGTCGG + Intronic
1163089566 19:15010468-15010490 ATGTCGGTAAGCATGGAAGAAGG - Intronic
1163518655 19:17779464-17779486 ATGGGGGTAAGGGTGGCAGTGGG + Intronic
1163953975 19:20616964-20616986 ATGTGGTTAAGCATGTAAATAGG - Intronic
1164148782 19:22530957-22530979 ATGTGGTTAAGCATGTAAATAGG - Intronic
1164490751 19:28711902-28711924 AAGTGGGTAATTCTTGAAGTTGG - Intergenic
1164535225 19:29081071-29081093 ATGTAGGAAAGTAGGAAAGTGGG - Intergenic
1165999024 19:39866720-39866742 GTGTGGGTAAGTTTGTGAGTAGG - Exonic
1167406763 19:49315000-49315022 TTGTGGGTAAGTTTGGAGATTGG - Intronic
1167669825 19:50844311-50844333 ATGTGGGTCACCAGGGAAGTGGG + Intergenic
1168456644 19:56516481-56516503 ATGTAGGTCAGAATGGAATTTGG + Intronic
926866512 2:17365171-17365193 ATGGGGGGAAGTGTGGAAGGGGG - Intergenic
929545666 2:42854104-42854126 ATGTGTGTGAGTATGGGAGATGG + Intergenic
931002324 2:57800796-57800818 ATTTGGGTAGGTATAGAAATTGG - Intergenic
931937384 2:67214207-67214229 ATGTGGGTGTGTATGTAAGTCGG - Intergenic
932943462 2:76197627-76197649 ATGTGAGTGAGTGTGGAAGCAGG + Intergenic
935319144 2:101868649-101868671 ATGTGGGTAAGGCTTGAAGGAGG + Intronic
935589570 2:104834181-104834203 ATGTCGGTAAGAAATGAAGTTGG - Intergenic
936767692 2:115873582-115873604 AGGAGGGTAAGTGTGGAAGAAGG - Intergenic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
939636066 2:144583959-144583981 ATGTGTGTGAGTATGAGAGTGGG + Intergenic
941170776 2:162132967-162132989 ATGTTGATAATTATTGAAGTTGG - Intergenic
941770352 2:169338129-169338151 ATGGGGGGAAGTAGGGAAGGAGG + Intronic
942719328 2:178932682-178932704 ATGTGGGTGTATATGGAAATAGG - Intronic
943063692 2:183064533-183064555 ATGTTGATAAGTATTGAAGCTGG - Intergenic
943468167 2:188256765-188256787 AAATGGGTAAGTATGAAAGCAGG + Intergenic
943757616 2:191573134-191573156 ATTTGGGTGAGTATAGAAATAGG - Intergenic
943809712 2:192169615-192169637 ACGTAGGCAAGTATGGAATTGGG + Intronic
943890810 2:193284619-193284641 CTTTGGGGAAGGATGGAAGTGGG - Intergenic
945310436 2:208306278-208306300 ATTTGGGTGAGTATGAAAGGAGG + Intronic
945883315 2:215349244-215349266 AAAAGGGTAAGTATGGAATTGGG + Exonic
948668122 2:239548957-239548979 ATGTGGGCACCTCTGGAAGTTGG - Intergenic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1170265211 20:14459510-14459532 ATGTGTGTATGTATGTAGGTAGG + Intronic
1170898816 20:20440248-20440270 ATTTGGGTTACTATGGAATTCGG + Intronic
1173120196 20:40282112-40282134 AAGTGGAAAGGTATGGAAGTGGG + Intergenic
1173215915 20:41083299-41083321 ATGTGGGTATGTTTGGGAGAAGG - Intronic
1173240102 20:41287683-41287705 ATGTGAGTAAGCTTGGTAGTGGG + Intronic
1173988794 20:47283871-47283893 ATGGGGGTAAAAGTGGAAGTGGG - Intronic
1175113339 20:56664465-56664487 CTGTGGGTAAGAGTGGAAGCCGG + Intergenic
1175583398 20:60118128-60118150 AGGTGGGTAATGATGGCAGTTGG + Intergenic
1177175030 21:17693923-17693945 ATGTGGGGAAGGATGGGAGAAGG + Intergenic
1177604156 21:23357187-23357209 ATTTGGGTAAGCATGCAGGTTGG + Intergenic
1177934805 21:27331274-27331296 ATATGGGTAAGTTTAGAAGGTGG + Intergenic
1180133833 21:45847385-45847407 GTGAGGGTAAGGATGGAGGTGGG - Intronic
1183038753 22:35160455-35160477 ATGTGGGGAAGAATGGTATTAGG - Intergenic
1183096390 22:35554626-35554648 ATGTGGGTGAGGATGGAAAGTGG + Intergenic
1183773285 22:39945448-39945470 ATTTGGGTAAATAAGGAAGGTGG - Intronic
951855347 3:27190361-27190383 ATCTGGGGAAGGAAGGAAGTAGG + Intronic
952422443 3:33144293-33144315 GGCTGGGTAAGTATGGAATTTGG + Exonic
952911915 3:38197418-38197440 GTGTGGGGAAGTATGGTACTTGG + Intronic
952980290 3:38728600-38728622 ATGTGGGCCTGCATGGAAGTTGG - Exonic
953690971 3:45119113-45119135 ATGTATGTACGTATGGTAGTGGG + Intronic
956362103 3:68459715-68459737 ATATGGGTAAATAGGGAATTAGG - Intronic
956639816 3:71405065-71405087 ATGTGTGGAAATTTGGAAGTTGG - Intronic
956733085 3:72214631-72214653 AGCTGGGTAAGGAGGGAAGTGGG - Intergenic
957352542 3:79044638-79044660 ATGGGAGTTAGTATGGAAATTGG + Intronic
959531842 3:107441931-107441953 AGCTGGGTAACGATGGAAGTGGG + Intergenic
960159574 3:114335526-114335548 ATGTGGGTCAGTTTGGAAAGTGG + Intergenic
961870190 3:129981925-129981947 ATGTGGGTAATAAGGGAAGGAGG - Intergenic
962237015 3:133715320-133715342 ATGTGGGTAGATATGGCAGCAGG - Intergenic
963591418 3:147264754-147264776 ATGTGGGTAAGTATTTTTGTTGG + Intergenic
963940200 3:151089660-151089682 ATGTGGAGAAGTATGGGGGTGGG + Intronic
964585393 3:158293310-158293332 ATGTATGTATGTATGGGAGTAGG + Intronic
966758263 3:183391645-183391667 ATGTGGATAATTATTGAAGCTGG + Intronic
968157556 3:196395082-196395104 ATATGGGTAAGTAACTAAGTTGG + Intronic
970666967 4:18347850-18347872 ATATTGTTAAGGATGGAAGTAGG + Intergenic
970872182 4:20828773-20828795 ATGTGTGTAGGTATGGAGGTAGG - Intronic
971723460 4:30277180-30277202 ATCTGGATAAGTTTTGAAGTCGG + Intergenic
973639773 4:52891352-52891374 CAGTGGGTAAGTAAGGAAGGTGG + Intronic
976447075 4:85142110-85142132 ATGTTGGTAATTTTTGAAGTTGG - Intergenic
977226194 4:94394644-94394666 TTGTGGGGAAGGATGGGAGTGGG + Intergenic
977540696 4:98315423-98315445 CTGTGTGTGAGTATTGAAGTAGG + Intronic
978867000 4:113524913-113524935 ATGTGGGTAAGAATGGATGAAGG + Intronic
979025828 4:115573727-115573749 ATGTATGTAAGTATGTATGTAGG + Intergenic
981559419 4:146030689-146030711 AAGTGGGTAAGAATGAAAATGGG + Intergenic
982126116 4:152185340-152185362 AGCTGGGGAAGCATGGAAGTAGG + Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
984019551 4:174468482-174468504 ATGTGGGTCAGAGTGGAGGTAGG - Intergenic
984231054 4:177099553-177099575 ATGTGTGTATGTATATAAGTAGG - Intergenic
984623120 4:181975736-181975758 TTGTGGATAAATATGGAAGCCGG + Intergenic
984978036 4:185247847-185247869 ATATGGCTATGTCTGGAAGTGGG + Intronic
985562608 5:598179-598201 ATGTTGGCAAGGATGGGAGTGGG - Intergenic
985776302 5:1844758-1844780 ATGTGCGTAGGTATAGATGTAGG - Intergenic
986233230 5:5885670-5885692 ATGAGGGTAAGGGTGGAAGGGGG + Intergenic
986632435 5:9786837-9786859 ATGTGGGGAAGAATGGAAGGTGG - Intergenic
986686751 5:10281618-10281640 TTGTGGGTTAGCATGGAGGTGGG + Intronic
989122749 5:38020656-38020678 ATGTGGGGATGGATGGGAGTAGG - Intergenic
990386220 5:55265858-55265880 AGGTTGGTAATTATGAAAGTGGG + Intronic
990647086 5:57857250-57857272 ATGTGGGTAAACATGAGAGTGGG - Intergenic
990800181 5:59593257-59593279 ATATGAGTAAGTTTTGAAGTTGG - Intronic
997085859 5:130797643-130797665 GTGTGGGTATGTATGGGTGTGGG - Intergenic
998988439 5:147788570-147788592 ATGAGGGGAAGTTTGGAAGGTGG + Intergenic
999285128 5:150390070-150390092 ATGTGGGTAAGTATGGAAGTAGG - Intronic
999324956 5:150638086-150638108 ATGGGGGTAGGTAGGGGAGTGGG + Intronic
1000404011 5:160866732-160866754 TTGTGGGGAAGGATGGGAGTGGG + Intergenic
1000655789 5:163876446-163876468 ACATGAGTAAGTTTGGAAGTTGG - Intergenic
1002922694 6:1584309-1584331 ATGTCATTAAGTATGGAAGTGGG - Intergenic
1003582513 6:7353936-7353958 TTGTGGGGAAGTGTGGAAGGGGG + Intronic
1005187514 6:23179885-23179907 CTGTGGGTGAGTATGTAGGTCGG - Intergenic
1006076036 6:31533045-31533067 ATGTGGGTATTTTTGGGAGTGGG - Intronic
1006394735 6:33779948-33779970 ATGTGGGTTAGGATGGAAGTGGG - Intronic
1006606933 6:35264497-35264519 ATGTTGGTAATTTTTGAAGTTGG + Intronic
1008985248 6:57534553-57534575 ATGAGAGTAAGAATGGAAGCAGG - Intronic
1009173285 6:60427508-60427530 ATGAGAGTAAGAATGGAAGCAGG - Intergenic
1010043549 6:71415870-71415892 AGGTGTGCAAGAATGGAAGTGGG + Intergenic
1012161391 6:95889240-95889262 ATGTGGGAAAGTTTGAAACTTGG - Intergenic
1013979444 6:116112334-116112356 ATGTAGAGAAGTATGGAAGAAGG + Intronic
1014835112 6:126152124-126152146 GATTGGGTAAGTATGGTAGTGGG + Intergenic
1014979028 6:127924447-127924469 ATGGAGGCAAGTATGGAAGCTGG - Intergenic
1015156891 6:130106722-130106744 ATGTGAGTCAGGATGGAAGATGG - Intronic
1015722884 6:136263762-136263784 AAGTGGGAAAGTACTGAAGTAGG - Intronic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1021409144 7:20308735-20308757 ATGTAGACAAGTATAGAAGTTGG - Intergenic
1022485478 7:30774253-30774275 AGGTGAGTAAGTGTGGTAGTGGG - Intronic
1022635987 7:32135654-32135676 TTGTTGGTAAGCATGTAAGTTGG + Intronic
1023584654 7:41716621-41716643 ATGGGGGCAAGGATGGGAGTAGG - Intergenic
1024878784 7:54060435-54060457 ATGTGTGTATGTATGGAAAGGGG - Intergenic
1027580264 7:79984607-79984629 ATGTTGGTAACTGTAGAAGTTGG - Intergenic
1029630075 7:101744584-101744606 ATGTAGGTAAGAGTGGAAGCAGG + Intergenic
1030938378 7:115614924-115614946 AGGGGGGTAGCTATGGAAGTAGG - Intergenic
1031134263 7:117868952-117868974 ATGTGGGGAAGTTTGGAAACAGG - Intronic
1031672353 7:124564923-124564945 ATGTGAGTGAGCTTGGAAGTAGG - Intergenic
1033365272 7:140668393-140668415 ATGTGGTTAAGCATGTAAATTGG - Intronic
1034746956 7:153531380-153531402 ATGTGGGCAAGGATGAAAGAGGG - Intergenic
1034754263 7:153600408-153600430 ATGGGGGGAAGCATGGTAGTAGG - Intergenic
1037424106 8:18736168-18736190 GAGTTTGTAAGTATGGAAGTTGG - Intronic
1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG + Intergenic
1041591472 8:59590312-59590334 TTGTTGGTAACTATGAAAGTTGG + Intergenic
1041701777 8:60798165-60798187 ATGTGGGAAAGTATTGCAGATGG + Intronic
1044451387 8:92339460-92339482 ATGTGGGGAAGGATGGGAGTGGG + Intergenic
1046309796 8:112420216-112420238 ATGTTGATAAGTGTTGAAGTTGG - Intronic
1047293546 8:123551295-123551317 ATGGAGGTAAGGATGGGAGTGGG + Intergenic
1047317475 8:123747827-123747849 ATGGGGGCAGGTTTGGAAGTGGG + Intergenic
1048137079 8:131756968-131756990 ATGTGGGTAAGTTGGGGAGTGGG - Intergenic
1050430015 9:5552822-5552844 TTGTGGATAGGTAGGGAAGTGGG - Intronic
1053178123 9:35944203-35944225 ATGTGGATAAGTATGTAATTGGG + Intergenic
1057312223 9:93949642-93949664 CTGTGGGTCAGTGGGGAAGTTGG - Intergenic
1057581189 9:96289221-96289243 ATGTGTGTGTGTATGGAAGTGGG + Intronic
1057588034 9:96347159-96347181 ATGTGGGTAGGTAAGAAATTTGG - Intronic
1058095693 9:100857749-100857771 AAGTGGGTCAGAATGGAAATGGG + Intergenic
1058675943 9:107400139-107400161 ATCTGGGAAAGGATGGCAGTGGG + Intergenic
1058733431 9:107872621-107872643 ATGTGGTTAAGAAGGGAATTAGG - Intergenic
1059906912 9:118997255-118997277 ATTTGGGGGAGTATGGAAGCAGG + Intergenic
1060595749 9:124847639-124847661 ATGTGGGGAAGTAGGGGAGAGGG - Intergenic
1062593199 9:137284049-137284071 ATGTAGGTAAGTGTGGACCTTGG - Intergenic
1185933574 X:4230411-4230433 AGGTGGGTAAGTAGGTAGGTAGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1189401847 X:40676956-40676978 ATATGGGTACCTTTGGAAGTGGG + Intronic
1189814081 X:44807208-44807230 ATGTTGATAATTATTGAAGTTGG - Intergenic
1191853608 X:65604885-65604907 AGGGAGGTAAGTATGGAAGCAGG - Intronic
1191971186 X:66817922-66817944 AAGTGTGAAAGTATGAAAGTGGG - Intergenic
1192421205 X:71033218-71033240 ATGTGTGTAACTAGAGAAGTAGG - Intergenic
1192612163 X:72577486-72577508 ATGGGGGTAAGGATGACAGTAGG - Intergenic
1195201168 X:102551424-102551446 ATGTGGGTTGGAATGGAGGTGGG - Intergenic
1195514791 X:105761383-105761405 ATGTGTGTAACTATGCCAGTAGG + Intronic
1195796917 X:108660297-108660319 ATGTTGGTAAATATGAAAATTGG - Intronic
1195976758 X:110535353-110535375 ATCTGAGTAAGTAGGGAAGTTGG + Intergenic
1197483583 X:127018587-127018609 ATGTGGTTAATTATGTAAGTAGG + Intergenic
1199348480 X:146771024-146771046 AAGTGGGAAAATATGGAAATGGG + Intergenic
1201726048 Y:17153119-17153141 ACGTGTGTAAGTATGAAACTGGG + Intergenic