ID: 999287847

View in Genome Browser
Species Human (GRCh38)
Location 5:150404872-150404894
Sequence CTGCAGCTGGACCCGGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999287847_999287854 4 Left 999287847 5:150404872-150404894 CCAACACCCGGGTCCAGCTGCAG 0: 1
1: 0
2: 2
3: 19
4: 219
Right 999287854 5:150404899-150404921 GTTCCCTCTTAAAGACCCCTGGG 0: 1
1: 0
2: 2
3: 3
4: 76
999287847_999287853 3 Left 999287847 5:150404872-150404894 CCAACACCCGGGTCCAGCTGCAG 0: 1
1: 0
2: 2
3: 19
4: 219
Right 999287853 5:150404898-150404920 GGTTCCCTCTTAAAGACCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 74
999287847_999287855 5 Left 999287847 5:150404872-150404894 CCAACACCCGGGTCCAGCTGCAG 0: 1
1: 0
2: 2
3: 19
4: 219
Right 999287855 5:150404900-150404922 TTCCCTCTTAAAGACCCCTGGGG 0: 1
1: 0
2: 0
3: 8
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999287847 Original CRISPR CTGCAGCTGGACCCGGGTGT TGG (reversed) Intronic
900117132 1:1033654-1033676 CTGAAGCTGGGGCCGGGGGTGGG - Intronic
900246276 1:1637565-1637587 CAGCAGCTGCACCCGGGTGCAGG - Intronic
900270087 1:1782554-1782576 CTGCAGCTCGCTCCGGCTGTGGG - Intergenic
900356683 1:2268339-2268361 CTGCACCCTGGCCCGGGTGTGGG + Intronic
901336093 1:8450603-8450625 CTGCAGCAGGGCTCGGGGGTTGG - Intronic
901626315 1:10627188-10627210 CTGCAGGAGGACCTGGGTGGGGG - Intronic
902192934 1:14776292-14776314 CTGCACCTGGACTCCGTTGTGGG + Intronic
902417432 1:16249003-16249025 CTGCAGCTGGCCCTGGGTCCTGG - Exonic
903749378 1:25611251-25611273 CTGCTGCAGGACCGGGGTCTCGG + Intergenic
904246852 1:29194091-29194113 CTGCAGCGGGACCTGGGAGCAGG + Exonic
904431164 1:30465368-30465390 CTGCAGCAGGACCTGGTTCTTGG + Intergenic
904830079 1:33300704-33300726 CTGTACCTGCACCCGGGTGGCGG + Exonic
904912646 1:33947032-33947054 CTGCAGCTGGACAGGGATGTGGG - Intronic
904967139 1:34383926-34383948 CTGCTGCTGGACCCAGAAGTAGG + Intergenic
905795726 1:40815458-40815480 CTGCAGCTGAAGCAGGGTTTAGG - Intronic
907651039 1:56295061-56295083 CTGCGGCTGGAACAAGGTGTAGG - Intergenic
909585513 1:77283114-77283136 CTGCACCGGGACCCGGGAATGGG + Intronic
915264656 1:154708117-154708139 CTGCTGCTGGCGCAGGGTGTCGG + Exonic
916332555 1:163633907-163633929 CTGCTGCTGCACCAGGGTCTCGG + Intergenic
918171123 1:181998441-181998463 CTGCAGCTGGAATGGGGTGGGGG - Intergenic
919785345 1:201254918-201254940 CTGCACCTGGCCCCGGGTGAGGG + Intergenic
920574687 1:207050820-207050842 GTCCAGCCGGACCCGGGTGCGGG - Exonic
923025377 1:230199749-230199771 CTTCAACAGGACCCTGGTGTGGG - Intronic
923176756 1:231474345-231474367 CTGAAGCAGGAGCCGGGGGTGGG + Intergenic
923808655 1:237288483-237288505 CTGCAGCTGCTCTCGGGGGTGGG + Intronic
1063420714 10:5910833-5910855 CAGCAGCTGGACCCGTGGCTCGG + Intronic
1063945742 10:11174697-11174719 CTGCAGCTTTACCCGCATGTGGG + Intronic
1065020196 10:21496510-21496532 CTGCAGCGGGTCCCAGGGGTCGG - Intronic
1067330086 10:45307158-45307180 CTGCAGCTGTACCTGGGAGATGG + Intronic
1075442981 10:122494204-122494226 CTGCAGCTGGACTGCGGGGTTGG + Intronic
1075656875 10:124167867-124167889 CTGGAGCTGGACACTGATGTAGG - Intergenic
1075972162 10:126664065-126664087 TTGCAGCTGGCCCCAGGAGTAGG + Intronic
1077161474 11:1114652-1114674 CTGCACCTGGCCCCGAGTCTTGG + Intergenic
1080364401 11:31554091-31554113 CTGCAGCTAGACAGGGGTGATGG - Intronic
1082693427 11:56331981-56332003 CAGCAGCTGTACCCGGGTCAGGG + Intergenic
1083949756 11:65947457-65947479 TTGCAGCTGGACCTGCTTGTCGG - Exonic
1084603825 11:70161552-70161574 CAGAAGCTGGACCAGGCTGTTGG + Intronic
1084667974 11:70586747-70586769 TCGCAGCTGGAGCCGGGAGTGGG + Intronic
1084683231 11:70679329-70679351 CTGCAGTTGGCCTCGGGGGTTGG - Intronic
1084685925 11:70695220-70695242 CTGGAGCTGGACGGTGGTGTCGG + Intronic
1095684030 12:45011882-45011904 CTTGAGGTGGACCAGGGTGTGGG - Intergenic
1095838850 12:46669803-46669825 CTGCAGCTGGAGCCAGGAGCTGG + Intergenic
1096874274 12:54615088-54615110 CTGCTGTGGGACCCTGGTGTAGG + Intergenic
1102651774 12:114447522-114447544 GCGCAGCTGGACCGGGGTGAGGG + Intergenic
1103280277 12:119752335-119752357 CTGCAGCTGAAACCTGGTCTTGG + Intronic
1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG + Intronic
1104040716 12:125128546-125128568 CTGCATCTGAACCCTGGTGCTGG + Intronic
1104606400 12:130192765-130192787 ATGCAGCTGGGCCTGGGTGGGGG + Intergenic
1104739998 12:131165190-131165212 CTGCATCTGGACACAGCTGTGGG - Intergenic
1104792481 12:131492775-131492797 CTGCATCTGGACACAGCTGTGGG + Intergenic
1104809283 12:131610855-131610877 CTGGAGCTGGAACTGTGTGTAGG - Intergenic
1105274480 13:18906632-18906654 CTGCAGCTTGACCAGAGTGGTGG + Intergenic
1106413508 13:29527012-29527034 CTTCAGGAGGACCCGGGTGCCGG + Intronic
1112286755 13:98111545-98111567 CTGCAGGTGGACACAAGTGTAGG + Intergenic
1114948470 14:27716305-27716327 CATCAGCGTGACCCGGGTGTGGG + Intergenic
1117288641 14:54311230-54311252 CTGCTGCTTGATCTGGGTGTTGG - Intergenic
1119472268 14:74907474-74907496 GGGCAGCTGGAGCTGGGTGTGGG + Exonic
1122228404 14:100292826-100292848 CTGCAGCTGCAGCCGCGTCTTGG + Exonic
1122306071 14:100767572-100767594 CTGCAGCGGGTCGCGGCTGTTGG + Intergenic
1122490064 14:102109062-102109084 CTGCATCTTGAGCTGGGTGTTGG - Intronic
1124002148 15:25768464-25768486 CTGGACCTGGACCTGGGTCTGGG - Intronic
1124348619 15:28939257-28939279 CTGCTGCTGGACACGTGGGTTGG + Intronic
1125603653 15:40928451-40928473 CTGAAGCTGGACTCAGGTGAGGG + Intergenic
1127376512 15:58389708-58389730 CTTCAGCTGGATCAGGGTCTGGG - Intronic
1128094589 15:64944123-64944145 CTGAAGCTGGACCTGGGAGGGGG + Intronic
1129200770 15:73997912-73997934 TTACAGCTGGACCCTGGAGTAGG - Intronic
1129261414 15:74369990-74370012 CTGAAGCTTGACCAGGGTGTAGG + Intergenic
1132403557 15:101528670-101528692 CTGCAGCTGGGCCTGGGTGGTGG + Intergenic
1132617338 16:848135-848157 CGCCAGGTGGGCCCGGGTGTGGG + Intergenic
1133001925 16:2856208-2856230 CAGCAGCTGAACCGGGTTGTGGG - Exonic
1133851589 16:9509487-9509509 CTGCATCTGGCCCTGGGTGAGGG - Intergenic
1134078537 16:11309000-11309022 CTGCAGCTGTACCCAGGAGGGGG + Intronic
1134515386 16:14882693-14882715 CTGCCGCTGCACCTGGGTGTGGG + Intronic
1134703059 16:16281338-16281360 CTGCCGCTGCACCTGGGTGTGGG + Intronic
1134964484 16:18430777-18430799 CTGCCGCTGCACCTGGGTGTGGG - Intronic
1134968771 16:18513312-18513334 CTGCCGCTGCACCTGGGTGTGGG - Intronic
1138175353 16:54893103-54893125 CTGCAGCTGGAGATGGGTGGAGG - Intergenic
1139563925 16:67761029-67761051 CTGCAGCCCCACCCTGGTGTCGG - Intronic
1140307888 16:73820584-73820606 CTGGAGCTGGACTCATGTGTGGG - Intergenic
1141507642 16:84489312-84489334 CAGCACCTGCACCCGGGGGTTGG + Exonic
1141665838 16:85464715-85464737 CTGCACCTGGACAGGGGAGTTGG - Intergenic
1142003188 16:87675732-87675754 CTGCAGCAGGAAGCAGGTGTGGG + Intronic
1142500036 17:327181-327203 AGTCAGCTGGACCCAGGTGTGGG + Intronic
1142673154 17:1496798-1496820 CTTCAGCTAGACACGGGGGTGGG + Exonic
1142967022 17:3588107-3588129 CTGGAGCTGGACCAGGGGCTGGG + Intronic
1143402866 17:6657298-6657320 CTGCAGCTGGATCTCCGTGTAGG + Intergenic
1143515490 17:7417524-7417546 CTGCAGCTGAAGCGGGGTGGTGG + Exonic
1144729641 17:17519122-17519144 CTGGAGCCGGACCGGGCTGTTGG - Intronic
1144783487 17:17819443-17819465 CTGCAGCAGGACCTGAGGGTGGG + Exonic
1148367517 17:47067449-47067471 CTGCCGTTGGGCCCCGGTGTTGG + Intergenic
1148638825 17:49169661-49169683 CTTGAACTGGACCCGGGTGAGGG - Exonic
1150227428 17:63531556-63531578 TTGCTGCTGGAACCAGGTGTGGG + Intronic
1154466169 18:14643887-14643909 CTGCAGCTTGACCGGAGTGGTGG + Intergenic
1154507879 18:15060650-15060672 CTGCAGCTGCACCCGGGAGTGGG - Intergenic
1155983972 18:32210071-32210093 TTGGAGCTGGACCAGGGTTTTGG + Intronic
1160202539 18:76807495-76807517 CTGCAGAGGAACCTGGGTGTTGG + Intronic
1160875091 19:1293170-1293192 CTGCAGGGTGACCTGGGTGTGGG + Intronic
1160923127 19:1529794-1529816 CTGCAGCTGTGCCTGGATGTAGG + Exonic
1160939176 19:1612142-1612164 CAGCATCTGCACCTGGGTGTGGG + Intronic
1161269442 19:3381764-3381786 CTGCAGGTTGAACCAGGTGTAGG - Exonic
1162784377 19:13025073-13025095 CTGCAGGTTGAACCAGGTGTAGG - Exonic
1164531888 19:29055125-29055147 CTGCAGCTGGACCTGTGTTAGGG + Intergenic
1164609769 19:29624120-29624142 CTGCAGCTTAACCAGGGTGTCGG + Intergenic
1164682946 19:30148010-30148032 ATGCAGCTGTCCCTGGGTGTGGG + Intergenic
1165349824 19:35269373-35269395 CTGCAGCTGGGCGCGGGGGCGGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165923672 19:39314286-39314308 CTCCAGCCGGACCCGGGTCCGGG - Exonic
1166328360 19:42065048-42065070 CTGCTGCTGGGCCTGGGGGTTGG - Intronic
1167036090 19:46995767-46995789 CTGCAGCTGGAGCCTAGAGTAGG + Intronic
1167429821 19:49447820-49447842 TTGCAGCTGAATCCGGGTGAGGG - Exonic
925118129 2:1397703-1397725 CTGCATCAGGACCCGGGGGTGGG - Intronic
927210261 2:20634859-20634881 CAGCACGGGGACCCGGGTGTGGG + Intronic
928181863 2:29073614-29073636 CTGCAGCAGCTCCCGGGTCTGGG + Exonic
928838375 2:35575385-35575407 CAGCAGCAGGACCCGAGGGTTGG + Intergenic
930071583 2:47370009-47370031 TTGCAGCGGGCCCCGGATGTGGG + Intronic
931231086 2:60375425-60375447 GTGCAGCTGGTCCTGAGTGTTGG - Intergenic
934756605 2:96828611-96828633 CTGCAGCCCGACCCAGGTGACGG + Exonic
935941088 2:108240000-108240022 CTGGAGCTGGACCTGGCTCTGGG + Intergenic
936089072 2:109489328-109489350 TTGCAGCTGTACCAGGGTCTGGG - Intronic
940382571 2:153032919-153032941 CACCAGCTGGACCCGGCAGTGGG + Intergenic
941929321 2:170924639-170924661 CTGCAGCTGCACCCAGGAGTTGG + Intergenic
943367784 2:186982047-186982069 CTGCAGCTGGAGCAAGGAGTTGG - Intergenic
944586572 2:201178658-201178680 CTGCAGCCACACCCTGGTGTTGG - Intergenic
947916168 2:233833149-233833171 CTACAGCTGGACCCGGATCCCGG + Exonic
947966431 2:234285714-234285736 CTGCAGCTGGTCCTTTGTGTTGG + Intergenic
948557290 2:238822127-238822149 ATGCTTCTGGACCTGGGTGTGGG - Intergenic
948694307 2:239725520-239725542 CTGAAGCTGCACCAGGGTGGAGG - Intergenic
948694748 2:239727540-239727562 CTGATGCTGCACCCGGGTGGAGG - Intergenic
948785290 2:240349132-240349154 CTGGAGCTGGACGCTGGTGAAGG + Intergenic
1169345150 20:4823314-4823336 ATGCAGCTGGCCCGGGGTGAAGG - Intronic
1173817846 20:46001371-46001393 CTGAAGCTGGCACCGGGTGGTGG - Intergenic
1174112227 20:48204785-48204807 GTGGAGCTGGACCAGGGTGGAGG + Intergenic
1175220579 20:57414362-57414384 CTGCAGCTGGCCCAGGCTGGGGG - Intergenic
1176019049 20:62953294-62953316 CTGCAGCTGGACGGGGTTGGGGG + Intronic
1176790203 21:13311149-13311171 CTGCAGCTGCACCCGGGAGTGGG + Intergenic
1176808418 21:13514709-13514731 CTGCAGCTTGACCGGAGTGGTGG - Intergenic
1179530936 21:42019223-42019245 GTGCACCTGGCCCCGGGTGAGGG + Intergenic
1179962944 21:44781007-44781029 CTTCAGCTGCACGCAGGTGTTGG + Intronic
1181265615 22:21629109-21629131 CTGCCGCTGGAGCGCGGTGTGGG - Exonic
1181671612 22:24427969-24427991 CTGCAGCTGCACCCGGGCTGTGG + Intronic
1183683721 22:39350060-39350082 CGGCTGCCGGACCAGGGTGTAGG - Exonic
1183984113 22:41560202-41560224 CTCCAGCTGGCCCTGGGTTTAGG + Intergenic
1184733037 22:46381483-46381505 CTGCTGCTGGCCCCGGGGTTAGG - Intronic
1185031026 22:48442963-48442985 CTGCACCTGGAGCCTGGGGTGGG + Intergenic
1185099039 22:48827901-48827923 CTTCAGGTGGAGGCGGGTGTGGG + Intronic
1185388664 22:50547800-50547822 CTGCAGCTGGACTTGGGGCTGGG - Intergenic
950135644 3:10578961-10578983 CTACAGCTGGATCTGGGTATTGG + Intronic
950322633 3:12070762-12070784 CTGCATCTGGACCTGGCTGGTGG + Intronic
950547676 3:13648267-13648289 CCCCAGCAGGTCCCGGGTGTGGG + Intergenic
953997788 3:47534049-47534071 AGGTAGCTGGAACCGGGTGTGGG - Intergenic
954873809 3:53787567-53787589 CTGCAGCAGGGCCCAGGTGGAGG - Intronic
956462435 3:69485375-69485397 CTGGAGCTGCACCAGGGTGGGGG + Intronic
958992310 3:100860958-100860980 ATGCAGCTGCACCTGGGTGATGG + Intronic
959162723 3:102740171-102740193 CTGCAGCTGGATGAGGGTGGAGG - Intergenic
961194916 3:124993527-124993549 CTGCAGCAGGACGTGGGAGTGGG + Intronic
961525913 3:127497239-127497261 CTGCAGCTGGACCAGGCTTCTGG - Intergenic
961827384 3:129606236-129606258 CTGCAGCTGGACCCCGGCCAGGG - Exonic
962826035 3:139101677-139101699 CTGCAGCTGCTCCTGGGTGGTGG + Intronic
963763478 3:149308889-149308911 GTGCAGATGGACCCAGCTGTAGG - Intergenic
968472467 4:788322-788344 CTGCAGGTGGCTCTGGGTGTGGG + Intronic
968598712 4:1499009-1499031 CTGCACCTGGACCTGGGTGAAGG + Intergenic
969084041 4:4642014-4642036 CAGCCGCTGGACCGGGGTGGGGG - Intergenic
969112048 4:4850332-4850354 GGGCAGCTGCACCCGGGTGGTGG - Intergenic
969244621 4:5924455-5924477 CTCCTGCTGGCCCTGGGTGTGGG - Intronic
969344879 4:6564100-6564122 CTGCCGCTGGACCGGTGGGTGGG - Intergenic
969376965 4:6769301-6769323 CCGCAGCTGCACCCAGGTATGGG - Intergenic
969684645 4:8664367-8664389 GTGCAGCTGGGCCCGGGAGCAGG - Intergenic
970061576 4:12039736-12039758 CTGCAGCTGTCCAAGGGTGTGGG + Intergenic
975710832 4:77158143-77158165 CTGCAGCGGGTCCCGGGGATGGG - Intronic
975784936 4:77877643-77877665 GTGCAGCTGGACCTTGGGGTTGG + Intronic
977739692 4:100463655-100463677 CTGCAGCTGGAGATGGGAGTGGG - Intronic
979211046 4:118103564-118103586 CAGATGCTGGACCCTGGTGTGGG - Intronic
980180114 4:129392302-129392324 CTGCAGCTGTGCCTGGGTGTTGG - Intergenic
982136573 4:152278970-152278992 CTGCAGCAGGATTGGGGTGTTGG - Intergenic
984795869 4:183659419-183659441 CTGCAGCGGGCCCGGGGCGTGGG + Exonic
984919135 4:184748556-184748578 CTGCAGCTGGGCTCTGGGGTTGG + Intergenic
985427302 4:189843456-189843478 CTGCAGCTGGGGCTGGGTATAGG - Intergenic
985591431 5:767330-767352 CTTCAGCTGCGCCCTGGTGTGGG - Intergenic
985645679 5:1083707-1083729 CTGCAGCTGGAGCTGGGGGGTGG - Intronic
985656431 5:1133887-1133909 CTGCAGCTGGAGGTGGGGGTGGG + Intergenic
985739694 5:1607517-1607539 CTCCAGCTGGACCCGTGCCTGGG + Intergenic
989950644 5:50293261-50293283 CTCCACCTGCACCGGGGTGTGGG + Intergenic
991275825 5:64844953-64844975 CTGCAGTTGGGCCGGGCTGTAGG - Intronic
994379685 5:99056704-99056726 CTCCAGCTGGACCCTGTTTTAGG + Intergenic
994624140 5:102196650-102196672 CTGCAGCTGGACACGGGGAGGGG - Intergenic
998383767 5:141744115-141744137 CAGCAGCTGGACCTGAGAGTAGG - Intergenic
999287847 5:150404872-150404894 CTGCAGCTGGACCCGGGTGTTGG - Intronic
1000816331 5:165927137-165927159 CTGGAGCTGGAGCAGGGTGAGGG - Intergenic
1002045094 5:176537077-176537099 CTGCCCCCGGACCCGGGGGTGGG - Exonic
1002418729 5:179134741-179134763 CTGGAGCTGGAGCCGGGAGCTGG - Intronic
1002418773 5:179134860-179134882 CGGGAGCTGGACCCGGGAGCTGG - Intronic
1002418827 5:179135013-179135035 CTGGAGCTGGAGCCGGGAGCTGG - Intronic
1002418843 5:179135059-179135081 CGGGAGCTGGACCCGGGAGCTGG - Intronic
1007210503 6:40190175-40190197 CTGCAGCTGGAGCCCTGTGATGG + Intergenic
1007431493 6:41779845-41779867 CTGCAGCGGGACCCGGGAGCGGG - Exonic
1014578686 6:123107445-123107467 CTGCTGCCAGACCCAGGTGTGGG + Intergenic
1017914377 6:158819689-158819711 CTGCACCTGGCCCCGAGTCTCGG + Intergenic
1019294337 7:266095-266117 CTGCAGCTGGGCTGGGCTGTGGG - Intergenic
1019294354 7:266163-266185 CTGCAGCCGGACTCGGCTGTGGG - Intergenic
1019294370 7:266231-266253 CTGCAACCGGACTCGGCTGTGGG - Intergenic
1019936452 7:4261392-4261414 TTGCAGCTGGAGGCGGGGGTGGG - Intronic
1024563688 7:50664573-50664595 CTGGAGCTGGCCTCGGGTGTCGG - Intronic
1025027531 7:55529666-55529688 CTGAAGCTGGATTGGGGTGTTGG - Intronic
1026789787 7:73324217-73324239 CTGCAGCTCAACCCAGGTGCCGG - Intronic
1028303229 7:89228715-89228737 CTCCACCTGCACCCCGGTGTGGG - Intronic
1032059779 7:128714962-128714984 CTGCAGATCCACCAGGGTGTCGG + Intronic
1032534426 7:132650063-132650085 GAGCAGCTGGACCCAGGTGTTGG - Intronic
1033156448 7:138961077-138961099 CTGCACTTGGATCCGGGTGACGG + Intronic
1034133856 7:148746916-148746938 CTTCAGGTGGACCCGAGAGTGGG + Intronic
1034746100 7:153525106-153525128 CCTCAGCTGGGCCCTGGTGTAGG + Intergenic
1035074627 7:156169547-156169569 CCGCAGCTTGTCCCGGGGGTAGG + Intergenic
1035733241 8:1867546-1867568 CGGAAGCTGGAGCCGCGTGTTGG - Intronic
1036184655 8:6613126-6613148 CTGCAGCAGGTGCCGGGTGCCGG + Intronic
1036810642 8:11866182-11866204 CAGCTGCTGGACCTGGGAGTTGG - Intronic
1039567708 8:38563450-38563472 CTGCTGCTGGAGCCAGGTGCTGG + Intergenic
1040569554 8:48595712-48595734 CTCCAGCTGTACCCGGGTTGAGG - Intergenic
1049780025 8:144424646-144424668 CTGCAGCTGGGCACGAGCGTAGG - Intronic
1052051275 9:23851448-23851470 CTGAAGCGGGACGGGGGTGTTGG - Intergenic
1054764987 9:69035850-69035872 CGGCCGCGGGACCCGGGTGAGGG - Exonic
1055261070 9:74434392-74434414 CTGCAGCTGGAGGCTGGTGTAGG - Intergenic
1057239197 9:93393103-93393125 CTGTAGCTGGATGCGGGTGGCGG + Intergenic
1060116795 9:120948101-120948123 CTGCAGATGGAGCAGGTTGTGGG - Intergenic
1061202677 9:129146672-129146694 CTGCAGCTGGAAGCTGGGGTTGG + Intronic
1061432916 9:130542741-130542763 GTGCAGCAGGACCCAGGTGAGGG - Intergenic
1061805522 9:133135545-133135567 CTGGAGCTGGACCTGGGGGCAGG - Intronic
1061934594 9:133850310-133850332 CTGCAGCTGTACCTGGGTCAGGG - Intronic
1061957606 9:133971697-133971719 CAGGAGCTGGTCCAGGGTGTGGG + Intronic
1061995682 9:134181590-134181612 CTGCAGCAGGACCCGTGGGCAGG - Intergenic
1062133674 9:134913518-134913540 GTGCAGCTGGCCCCAGGGGTGGG + Intronic
1062315506 9:135965186-135965208 CTCCCGCTGTACCCGGGGGTTGG - Intergenic
1062466567 9:136684258-136684280 CTGTAGCTGAACCCAGCTGTAGG + Intronic
1062473016 9:136714473-136714495 CTGCAGCTGGCCTCGGGCCTAGG - Intronic
1187505599 X:19875862-19875884 CAGCAGCTGGAGCTAGGTGTGGG - Intronic
1192005646 X:67209247-67209269 ATGCAGATGGATCTGGGTGTTGG - Intergenic
1192034335 X:67546399-67546421 GTGCAGCGGGACCCGGTTCTGGG + Exonic
1194801644 X:98280750-98280772 TTGCAGGTGGTCCTGGGTGTTGG - Intergenic
1195144512 X:101999902-101999924 CTGCAGCGGGAGAAGGGTGTAGG - Intergenic
1199559377 X:149146856-149146878 CTACAGCTGCACCCGGGAGCAGG - Intergenic
1199765232 X:150936535-150936557 CACCAGCTGGACCCAGTTGTTGG + Intergenic
1200164026 X:154023872-154023894 CCGGAGCTGGCCCCGGATGTGGG + Intronic
1201911694 Y:19139300-19139322 GAGCAGCTGGAAACGGGTGTTGG - Intergenic