ID: 999287943

View in Genome Browser
Species Human (GRCh38)
Location 5:150405308-150405330
Sequence TCCCATCATGGCTGAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999287943_999287952 -10 Left 999287943 5:150405308-150405330 CCTGGACTTCAGCCATGATGGGA 0: 1
1: 0
2: 0
3: 12
4: 175
Right 999287952 5:150405321-150405343 CATGATGGGAGGGGAGGGGAGGG 0: 1
1: 4
2: 58
3: 644
4: 5236
999287943_999287954 -4 Left 999287943 5:150405308-150405330 CCTGGACTTCAGCCATGATGGGA 0: 1
1: 0
2: 0
3: 12
4: 175
Right 999287954 5:150405327-150405349 GGGAGGGGAGGGGAGGGTACGGG 0: 1
1: 35
2: 2114
3: 4352
4: 8248
999287943_999287955 1 Left 999287943 5:150405308-150405330 CCTGGACTTCAGCCATGATGGGA 0: 1
1: 0
2: 0
3: 12
4: 175
Right 999287955 5:150405332-150405354 GGGAGGGGAGGGTACGGGTAAGG 0: 1
1: 1
2: 15
3: 620
4: 4337
999287943_999287956 2 Left 999287943 5:150405308-150405330 CCTGGACTTCAGCCATGATGGGA 0: 1
1: 0
2: 0
3: 12
4: 175
Right 999287956 5:150405333-150405355 GGAGGGGAGGGTACGGGTAAGGG 0: 1
1: 1
2: 3
3: 98
4: 891
999287943_999287953 -5 Left 999287943 5:150405308-150405330 CCTGGACTTCAGCCATGATGGGA 0: 1
1: 0
2: 0
3: 12
4: 175
Right 999287953 5:150405326-150405348 TGGGAGGGGAGGGGAGGGTACGG 0: 1
1: 39
2: 2519
3: 4878
4: 9391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999287943 Original CRISPR TCCCATCATGGCTGAAGTCC AGG (reversed) Intronic
901808752 1:11753808-11753830 CCCGTCCATGGCTGAAGTCCTGG - Intronic
902337898 1:15764511-15764533 TCCTAGAAGGGCTGAAGTCCTGG - Exonic
903213998 1:21833183-21833205 TGCCATCATGGCAGGAGCCCTGG - Intronic
909763907 1:79330658-79330680 AGCCATCTTAGCTGAAGTCCTGG + Intergenic
912371896 1:109180027-109180049 TGGCATCATTGCTGATGTCCAGG + Intronic
915986162 1:160467089-160467111 TCGCCTCATGTCAGAAGTCCTGG - Intergenic
916841652 1:168607754-168607776 TCCCAGGATGTCTTAAGTCCTGG - Intergenic
916947601 1:169744440-169744462 CCTCATCATGGCAAAAGTCCTGG + Intronic
917200374 1:172508362-172508384 TCACATCTTAGCTGAAGCCCGGG + Intergenic
917497638 1:175555813-175555835 TCCTATCAAGGCTGAACTCAGGG - Intronic
918463833 1:184801709-184801731 GCCCAGCATCCCTGAAGTCCTGG - Intronic
922862970 1:228835175-228835197 TCCCATCATGGTGGAAGGCAAGG + Intergenic
923934231 1:238743921-238743943 TCCCTTCCTGCCTGAAATCCTGG + Intergenic
1072946337 10:99813086-99813108 TCCCAGCATGGCTGATATCAAGG - Exonic
1074920363 10:118002654-118002676 CCCCATCATCCCTGAAGTCCTGG + Intergenic
1075375629 10:121975650-121975672 TGCCATCATGGCTGGGGTCGGGG + Intergenic
1078606225 11:12778249-12778271 TCCTATCCTGGCTCCAGTCCTGG + Intronic
1079744542 11:24107855-24107877 TACAATCATGGCTGAAGGCAAGG - Intergenic
1080516520 11:33026817-33026839 TCCCATTATGGTTCAAGACCAGG + Intronic
1086287627 11:85267273-85267295 TACCAGCATGTCTGAATTCCTGG - Intronic
1087608624 11:100407393-100407415 TGCCATCATGGCAGAAGCCCTGG + Intergenic
1088784986 11:113173371-113173393 TACCATTAGGGCTGAGGTCCAGG - Intronic
1090364978 11:126198146-126198168 TCCCATCATAGCTGAAGGGTGGG + Intergenic
1091014429 11:132037308-132037330 TCCCCTCATGGCTGAGGTGAAGG - Intronic
1093054501 12:14542218-14542240 TTCCATCATGGATAAAGTGCAGG - Exonic
1094129407 12:27059390-27059412 TCCCATTTTTGCTGAACTCCTGG + Intronic
1094175406 12:27536421-27536443 TCCGATCATGGCAGAAGGCAAGG + Intronic
1095229293 12:39718609-39718631 TCCCATCCTGCCTTAAATCCTGG + Intronic
1096554455 12:52394895-52394917 TCCCACCAGGGCTGAAGACAAGG - Exonic
1096778754 12:53979914-53979936 GCCCAGCAGGGCTGCAGTCCAGG + Intergenic
1100304383 12:93337224-93337246 TTCCATCATGGCTGGAGGCTAGG + Intergenic
1102145912 12:110655024-110655046 TCACATGATGGCTGGAATCCTGG - Intronic
1104295418 12:127507494-127507516 ATTCATCATGGCTGAACTCCAGG + Intergenic
1104912862 12:132248009-132248031 GCCGATCATGGCTGGGGTCCTGG + Intronic
1109928912 13:69186132-69186154 TACCATAATGGTTGAAGTCATGG + Intergenic
1110312600 13:74068415-74068437 ATCCATCATGGCTGTAATCCTGG + Intronic
1112228983 13:97568938-97568960 CACCACCATGGCTGCAGTCCAGG - Intergenic
1112774110 13:102825592-102825614 GCCCAGCATGGCTGAACACCAGG - Intronic
1116280768 14:42903837-42903859 TCCAATCATGGCAGAAGGCACGG - Intergenic
1118611227 14:67541861-67541883 TTCCATCATGGCAGAACTCAAGG + Exonic
1119464708 14:74847207-74847229 TCCCATCATGACTTAAATTCAGG + Intronic
1120767085 14:88338101-88338123 TACCATCATGGCAGAAGGCGAGG - Intergenic
1121754592 14:96392148-96392170 TCCCACCATGGCTGAAGAAGAGG + Exonic
1122598241 14:102908112-102908134 TCCCCTCTGGGTTGAAGTCCTGG + Exonic
1122850071 14:104523226-104523248 TCCCAGGATGGCTGATGTTCAGG - Intronic
1123024656 14:105419167-105419189 CCCCAACAGGGCTGGAGTCCAGG - Intronic
1124412547 15:29448272-29448294 TCCCATCATAGGTGAAGCACTGG - Intronic
1124641666 15:31399862-31399884 GCCCAGCATGGCAGAAGCCCCGG - Intronic
1126780627 15:52136282-52136304 TCCCAGCAGAGCTGAAATCCTGG + Intronic
1127535531 15:59886599-59886621 TCCCACCAGGGCTGAAAGCCAGG - Intergenic
1128330982 15:66755541-66755563 TCCCTTCATAGCTAAAATCCAGG - Intronic
1129084401 15:73073379-73073401 CCCCATCATGGCTAAATTTCTGG - Intronic
1129898195 15:79124062-79124084 TCCCAGCAAGACTGAAGTCCAGG - Intergenic
1130770382 15:86917810-86917832 TCCCAGCATGGCTCAAGGCAGGG + Intronic
1131680612 15:94718583-94718605 TCCCATCATTGCTGAGGGCTTGG + Intergenic
1133144673 16:3775831-3775853 TCCTATCCAGGCTGAAGTCCTGG + Intronic
1133478844 16:6149770-6149792 TCCCAACATTGCTAAAGTGCAGG - Intronic
1134784487 16:16929040-16929062 TTCCAACATGGCAGAAATCCAGG - Intergenic
1135294785 16:21269819-21269841 TCTCATAATGGCTGTAGGCCTGG + Exonic
1137583838 16:49651983-49652005 TCCTTTCAGGGCTGATGTCCTGG - Intronic
1138694901 16:58803987-58804009 TCCCTTCCTGGCTTAAGTCCTGG + Intergenic
1140268014 16:73436749-73436771 TGACATCCTGGCTGAAGTCAGGG + Intergenic
1140712368 16:77690474-77690496 TCCAATCATGGCAGAAGGCAAGG + Intergenic
1142591518 17:1008199-1008221 TGCCATCAGGGCTGGTGTCCAGG + Intronic
1143664517 17:8348897-8348919 TCACATCATATCTGAAGGCCAGG + Intergenic
1143740843 17:8952951-8952973 TCCCATCAAGGCTCCTGTCCAGG - Intronic
1144209956 17:13005785-13005807 TCCCATCATTGCTGCTGTCAAGG - Exonic
1144626762 17:16847893-16847915 TGCCATCGTGGAGGAAGTCCAGG - Intergenic
1144879671 17:18424817-18424839 TGCCATCGTGGAGGAAGTCCAGG + Intergenic
1145152565 17:20519568-20519590 TGCCATCGTGGAGGAAGTCCAGG - Intergenic
1146163901 17:30573732-30573754 TGCCATCACGGAGGAAGTCCAGG - Intergenic
1147314961 17:39615663-39615685 TCCCATCAGTGCTGAACTGCAGG - Intergenic
1147580906 17:41626586-41626608 TGCCATCGTGGAGGAAGTCCAGG - Intergenic
1149449267 17:56737358-56737380 TGCCATCATTACTTAAGTCCTGG - Intergenic
1150667049 17:67150336-67150358 TCCCAGTCTGGCTGAACTCCTGG + Intronic
1152382180 17:79947737-79947759 GCCCATCTTGGCCGAGGTCCTGG - Exonic
1152497469 17:80683843-80683865 TACCCGCATGGCTCAAGTCCTGG + Intronic
1152927246 17:83092879-83092901 GCCCATCATGGCCGAGGTGCAGG + Intronic
1159431884 18:68362841-68362863 TCCCAGCATGGCTGAGTTCAGGG - Intergenic
1162917448 19:13882000-13882022 TGCAAACATGGCTGAAGTCGTGG - Intergenic
1164230387 19:23282171-23282193 TCACATCATGGCTTGAGTGCAGG - Intergenic
1164558992 19:29275598-29275620 TCCCTTTATGCCTGAAGACCTGG - Intergenic
1165771315 19:38382006-38382028 TGCCATCAGTGCTGAACTCCAGG + Intronic
924991459 2:316187-316209 TCCAAACATGGCAGAAGGCCAGG - Intergenic
926994278 2:18717075-18717097 TCTCATCCAGGCTGTAGTCCAGG + Intergenic
927706908 2:25302067-25302089 GACCATCATGGCTCAAGTTCTGG + Intronic
930717889 2:54609970-54609992 TCCCTTTATGCCTTAAGTCCTGG + Intronic
932002455 2:67897122-67897144 TCCCACCATGGCTGATTTCAAGG - Intergenic
932865178 2:75334188-75334210 TCTCCCCATGGCTGAAGGCCAGG + Intergenic
935218118 2:100990417-100990439 GCCGATCATGGCTGAAGTCTGGG - Exonic
937031766 2:118746588-118746610 TCCCATAATGGCTGACTTCCAGG - Intergenic
937535356 2:122879821-122879843 ACCCATCAAGTCTGAAGTACAGG - Intergenic
945783843 2:214209219-214209241 TCTCTTCATGCCTGATGTCCTGG + Intronic
947482997 2:230520477-230520499 TCCCATCGTGGTGGAAGTTCTGG - Intronic
947888871 2:233597901-233597923 TCCCTTCCTGGCTTAAATCCTGG + Intergenic
1171142757 20:22757326-22757348 TCTCATCATGTCTGGACTCCTGG - Intergenic
1176075853 20:63247920-63247942 CCCCACCATGGCTGGAGCCCTGG - Intronic
1185125301 22:49007178-49007200 TCCCCTCATGGCTGATGTACAGG - Intergenic
1185250070 22:49796744-49796766 TCCCCTCATGGCAGCAGTGCTGG - Intronic
949163533 3:910281-910303 TCCAATCATGGCAGAAGGTCGGG - Intergenic
950430385 3:12947571-12947593 TCCCATCTTTGCTGGAGGCCAGG - Intronic
950536521 3:13582136-13582158 TCCACTCATGGCTGGCGTCCCGG + Intronic
950650485 3:14403834-14403856 TCCAGTCCAGGCTGAAGTCCAGG - Intronic
952997040 3:38894628-38894650 TCCAATCATGCCTGACGCCCAGG + Exonic
953337717 3:42107971-42107993 AGCCATCATGTCTGAATTCCAGG + Intronic
955949322 3:64226210-64226232 ACCCATCCTTGCTGAAATCCTGG - Intronic
958446598 3:94223089-94223111 TCCCACCATGGCTGATTTCAAGG - Intergenic
960054058 3:113264177-113264199 TCCCAACAGGTCAGAAGTCCTGG - Intronic
962133540 3:132708767-132708789 TCCCTTCATGGCTGAATCACAGG + Intronic
962135824 3:132731061-132731083 TCACATCTTGGCTGAAGTTCTGG + Intergenic
962334125 3:134510775-134510797 TCCCACCCTGGCTGCAGTTCTGG + Intronic
963526807 3:146425382-146425404 TCCTTTCATGGTTTAAGTCCTGG - Intronic
963894162 3:150667493-150667515 TCCCATCATGGCTGAATGTGGGG + Intronic
965083459 3:164064960-164064982 TCCCATCCTGGCTGATTTCATGG - Intergenic
969681419 4:8645419-8645441 CCCCACCATGGCTGAAGACATGG - Intergenic
969853922 4:9983787-9983809 TGCCATCATGGCTTAAGTTTCGG + Intronic
971679596 4:29679492-29679514 TCCAATCTTGGTTGAAATCCAGG - Intergenic
971812476 4:31444577-31444599 TTCCACCATGGCTGATTTCCAGG + Intergenic
976373465 4:84317297-84317319 TCCCATAATGTCTGAGTTCCAGG + Intergenic
977277244 4:94992918-94992940 TGCCATCCAGGCTGGAGTCCAGG + Intronic
979322352 4:119338937-119338959 TCCCATGATGCCTAAAATCCTGG - Intergenic
980299922 4:130976234-130976256 TCCCTTCATGGCTGAAATTTTGG + Intergenic
980480823 4:133385266-133385288 TCCCAGCGTGGCTGCAGACCCGG + Intergenic
982499752 4:156138322-156138344 TCCCTTCTTGGCTGAACTACTGG - Intergenic
982833215 4:160089515-160089537 TAGGATCAAGGCTGAAGTCCTGG + Intergenic
983240331 4:165224551-165224573 TCCCATGATGCCTAAAATCCTGG - Intronic
983827082 4:172276344-172276366 TCCCAGCATGACTGAGGTCTTGG + Intronic
985583072 5:710185-710207 TTCCATCATGGCTGAAGGTGGGG - Intergenic
985832396 5:2243754-2243776 TCCCTTCATGGCTGTCCTCCAGG - Intergenic
985884795 5:2669062-2669084 TGTCATGATGGCTGAAGTCCAGG - Intergenic
988878158 5:35471101-35471123 TGCTCTCATGGCTGAATTCCTGG - Intergenic
992465991 5:77005311-77005333 TCCCATTATGGCTTTAGTCTGGG + Intergenic
992791164 5:80215320-80215342 TCCAATCATGGCGGAAGACAAGG - Intronic
995582180 5:113613684-113613706 TCACATCATGGCAGAAGGCAAGG - Intergenic
995909689 5:117170671-117170693 TCCCACCATGGATGAATTCAAGG - Intergenic
996440473 5:123484731-123484753 TCCTATCCTTGCTGAAGTCTGGG - Intergenic
998133281 5:139661766-139661788 ACACAACATGGCTGAAGGCCGGG - Intronic
999287943 5:150405308-150405330 TCCCATCATGGCTGAAGTCCAGG - Intronic
999480256 5:151941492-151941514 TCCCATGAAGGCAGAAGTACTGG - Intergenic
1001092135 5:168749469-168749491 TACCATCACAGGTGAAGTCCTGG + Exonic
1001971741 5:175961108-175961130 TCCCATCATGGCTGAAACTGAGG + Exonic
1002235553 5:177800220-177800242 TCCCTTGAAGCCTGAAGTCCTGG - Intergenic
1002245702 5:177882673-177882695 TCCCATCATGGCTGAAACTGAGG - Intergenic
1002457858 5:179355966-179355988 GCCCAGCAAGGCTGAAGTCTAGG - Intergenic
1002523617 5:179804349-179804371 GTCCATCATTGCTGAAGTCCAGG + Intronic
1002869534 6:1154418-1154440 TCCCCTCATTCCAGAAGTCCAGG + Intergenic
1003062774 6:2875881-2875903 TCCGAACCTGGCTGAACTCCAGG + Intergenic
1003835570 6:10069162-10069184 TAGCATCAAGGCTGAACTCCTGG - Intronic
1005679320 6:28190041-28190063 GGCCATCATGGCTAAAGCCCAGG + Intergenic
1006145184 6:31954714-31954736 TCCTCTCATGGCTGCGGTCCCGG + Exonic
1008056370 6:46950121-46950143 GCCCATAATGGGTGGAGTCCGGG - Intronic
1008356073 6:50555132-50555154 TGTCATCATGCCTGAAGCCCAGG + Intergenic
1008742569 6:54627335-54627357 TCCTTTCCTGCCTGAAGTCCTGG - Intergenic
1010450256 6:75994535-75994557 TTCCATCATGGCAGAAGGCAAGG + Intronic
1012809387 6:103938400-103938422 TCCAATCATGGCAGAAGACAAGG + Intergenic
1020985193 7:15124835-15124857 TCCCACAAAGGCTGAAGTCATGG + Intergenic
1021472130 7:21015707-21015729 TTCCATCATGGATGAATTCGAGG - Intergenic
1022177959 7:27890235-27890257 TCCCACCATGGCTGATTTCAAGG + Intronic
1027145315 7:75689939-75689961 TGCCATCAGGGCTGCAGACCGGG - Intronic
1028394246 7:90349685-90349707 TCCCTTCCTGGCTTAAATCCTGG + Intronic
1029709021 7:102289532-102289554 TCCCAGCCTGGCTGATCTCCAGG - Intronic
1031805967 7:126306563-126306585 TGCCATCATGGCTGACTTCTTGG + Intergenic
1032389043 7:131543955-131543977 TCCCATGATGCCAGCAGTCCTGG + Intronic
1034886637 7:154803570-154803592 TTCCATCATGGTTGGAGGCCAGG + Intronic
1035292557 7:157849058-157849080 TCCCAGCGTGGCTGGCGTCCAGG + Intronic
1036125783 8:6061013-6061035 TCCCATCAAGGCTGAAGCTGGGG + Intergenic
1036398415 8:8387164-8387186 TCCCAGCATGGTAGAAGGCCAGG - Intergenic
1038723466 8:30058736-30058758 TACCATGTTGGCTGAACTCCTGG - Intergenic
1040590585 8:48789014-48789036 TCCCATCTTGGCTGCAGAGCCGG - Intergenic
1041200022 8:55444595-55444617 TCCCATGATTGCTGAAATGCTGG - Intronic
1043275659 8:78389168-78389190 TCACATCATGGCAGAAGGCAAGG + Intergenic
1044755469 8:95457170-95457192 ACCCATCATGGCTGCAGTGGAGG + Intergenic
1044817989 8:96132425-96132447 TACCATCATGGTGGAATTCCTGG - Intergenic
1048849523 8:138631069-138631091 TCCCATCATAGAGGAAGGCCAGG - Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1057064381 9:92034913-92034935 TACCACCATGTCTGAAGTCCAGG - Intronic
1057414247 9:94847219-94847241 TCCCACCATGCCTGCAGTGCAGG + Intronic
1057557904 9:96102275-96102297 TCCAATCATGACAGAAGGCCAGG + Intergenic
1061945723 9:133907365-133907387 TCCCATCACGGTTCAAGCCCAGG + Intronic
1062491290 9:136806290-136806312 TCCCAGCCTGGCTGCAGCCCGGG - Intronic
1190608211 X:52166953-52166975 TCCCTTCAAGCCTTAAGTCCTGG - Intergenic
1191085669 X:56564586-56564608 TTGCATCATGGCTGGATTCCTGG - Exonic
1194690065 X:96973458-96973480 TGCCATCCTGGCTGGAGTGCAGG - Intronic
1196368417 X:114948137-114948159 TCCAATCATGGCAGAAGACAAGG + Intergenic
1199212625 X:145231808-145231830 CTCCATCATGTGTGAAGTCCTGG + Intergenic
1199896825 X:152134981-152135003 TCCCATCATAGGTGAGGCCCAGG + Exonic
1201233197 Y:11885732-11885754 TCCCATCATGCCAGAAGGCAAGG + Intergenic
1201495014 Y:14583487-14583509 TCCCCTTATGTCTCAAGTCCAGG - Intronic