ID: 999289010

View in Genome Browser
Species Human (GRCh38)
Location 5:150411479-150411501
Sequence GTGTGATGTCAGCTGTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999289010_999289015 23 Left 999289010 5:150411479-150411501 CCTGGCAACAGCTGACATCACAC 0: 1
1: 0
2: 0
3: 5
4: 154
Right 999289015 5:150411525-150411547 GCAAATTACTTTTTGGAGACTGG 0: 1
1: 0
2: 1
3: 20
4: 340
999289010_999289014 16 Left 999289010 5:150411479-150411501 CCTGGCAACAGCTGACATCACAC 0: 1
1: 0
2: 0
3: 5
4: 154
Right 999289014 5:150411518-150411540 GTAGATCGCAAATTACTTTTTGG 0: 1
1: 0
2: 0
3: 2
4: 88
999289010_999289017 25 Left 999289010 5:150411479-150411501 CCTGGCAACAGCTGACATCACAC 0: 1
1: 0
2: 0
3: 5
4: 154
Right 999289017 5:150411527-150411549 AAATTACTTTTTGGAGACTGGGG No data
999289010_999289016 24 Left 999289010 5:150411479-150411501 CCTGGCAACAGCTGACATCACAC 0: 1
1: 0
2: 0
3: 5
4: 154
Right 999289016 5:150411526-150411548 CAAATTACTTTTTGGAGACTGGG No data
999289010_999289018 26 Left 999289010 5:150411479-150411501 CCTGGCAACAGCTGACATCACAC 0: 1
1: 0
2: 0
3: 5
4: 154
Right 999289018 5:150411528-150411550 AATTACTTTTTGGAGACTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999289010 Original CRISPR GTGTGATGTCAGCTGTTGCC AGG (reversed) Intronic
901201193 1:7468377-7468399 TTGTGATGTCTGCTGTGGCAGGG + Intronic
903233185 1:21934113-21934135 GTGTAATTTCAGCTGTTGGGAGG - Intronic
903727355 1:25460181-25460203 GTGTGCTATTTGCTGTTGCCTGG + Intronic
906297279 1:44656588-44656610 GTGTGATTCCAGATGCTGCCAGG - Intronic
906683556 1:47747966-47747988 GTATGATGTCAGGTGGTGACTGG + Intergenic
909279874 1:73736362-73736384 AAGTGATGTCAGCTATTGACTGG + Intergenic
910958484 1:92733852-92733874 GAGTACTGTCAGCTGTTGACTGG + Intronic
911881907 1:103250711-103250733 TTGTGATGCCAGCTTCTGCCTGG + Intergenic
915016541 1:152739256-152739278 TGGTGATGTTAACTGTTGCCAGG - Intronic
916566336 1:165982310-165982332 CTGTGATGTGAGCTGTTTTCAGG + Intergenic
918258434 1:182771417-182771439 GTGTGCAGTCAGCTCTTGCTAGG - Intergenic
919653704 1:200177325-200177347 TTGTCATGTCAGTTCTTGCCAGG + Exonic
921606058 1:217156518-217156540 TAGTTATGTCAGCTGTTACCAGG + Intergenic
922890728 1:229059902-229059924 GTTTGTTGTCAGCTCTTTCCTGG - Intergenic
1062853353 10:763578-763600 GTATGATGTTAGCTGTGGGCTGG - Intergenic
1063192472 10:3709096-3709118 GTCTGATGTGAGCTGTGCCCCGG + Intergenic
1066096130 10:32073913-32073935 CTGTGATCTGTGCTGTTGCCAGG - Intergenic
1066639980 10:37546206-37546228 GTGTAATCACAGCTGATGCCAGG - Intergenic
1069636940 10:69930632-69930654 GCATGATGTGAGCTGCTGCCTGG + Intronic
1075328472 10:121554237-121554259 GTGTGATGTTAGCAGTCACCAGG - Intronic
1075930237 10:126289194-126289216 GTTTGGTGTCAGCTGGGGCCTGG - Intronic
1076761872 10:132610109-132610131 GTTTGTTGGGAGCTGTTGCCGGG - Intronic
1077188080 11:1244341-1244363 GTGGGGTGCCAGCAGTTGCCTGG - Exonic
1077189035 11:1248112-1248134 GTGGGGTGCCAGCAGTTGCCTGG - Exonic
1077189598 11:1250296-1250318 GTGGGGTGCCAGCAGTTGCCTGG - Exonic
1077390201 11:2297255-2297277 GTGGGCTGTCAGCTCCTGCCTGG + Exonic
1078443858 11:11389594-11389616 GACTGATGTCAGCTGTGTCCAGG + Intronic
1082807094 11:57458402-57458424 GTGTGCTGTCATCGGTTCCCGGG - Intergenic
1086794804 11:91086350-91086372 GTGTGATCTCAGCAGTGTCCTGG - Intergenic
1087632121 11:100662090-100662112 GTGTGATTTCAGATGTGGTCAGG - Intergenic
1088195693 11:107271091-107271113 GGGTTATGTCAGCTGGTCCCAGG + Intergenic
1096488224 12:51998220-51998242 CTGTGATGTCTGCTGATACCTGG - Intergenic
1099838709 12:87939200-87939222 CAGTGATGACAGCTGTAGCCTGG - Intergenic
1100016213 12:90013869-90013891 CTGTGATGTCAGCCGTGTCCAGG + Intergenic
1101512218 12:105403550-105403572 GGGAGATGTCAGCTGGTGGCTGG - Intergenic
1103699918 12:122843747-122843769 GAGTGAGGTCAGCTCCTGCCTGG - Intronic
1104051361 12:125196001-125196023 GTGAGATGGGAGCTGTTGGCAGG + Intronic
1104141033 12:125985711-125985733 GTGTGAGCTCAGGTGTTGGCAGG - Intergenic
1111820972 13:93214752-93214774 CTGCAATGTCAGCTGTTCCCAGG - Intergenic
1114416650 14:22549361-22549383 GTGTGATGGCACATGTGGCCAGG + Intergenic
1114566734 14:23638863-23638885 CTATGCTGTCAGCAGTTGCCCGG + Exonic
1119023517 14:71135020-71135042 GGGTGATGTCAGCTGATCCAGGG - Intergenic
1120835454 14:89035149-89035171 CTCTGACCTCAGCTGTTGCCAGG + Intergenic
1121616170 14:95315208-95315230 GTGCGAGGTCACCTGTGGCCTGG - Intronic
1122805537 14:104254706-104254728 CAGGGATGTCAGCTGTGGCCAGG + Intergenic
1127053942 15:55113106-55113128 GTGTGCTCTCTGCTGCTGCCAGG - Intergenic
1127310115 15:57744987-57745009 GTGGGTTGTCAGCGGTTTCCTGG - Intronic
1135052315 16:19203075-19203097 ATGTGATGTCAGCACATGCCTGG + Intronic
1138033502 16:53579938-53579960 TTCTGATGTCAGCTGCTCCCAGG + Intergenic
1138341663 16:56293544-56293566 GTGTGATGTCAGTGTTTCCCTGG + Intronic
1138662004 16:58526480-58526502 GTGTGATGTCTGGTCTTGCTGGG - Intronic
1143295010 17:5864485-5864507 GTTTGCTGTCAGCTCTTTCCAGG + Intronic
1144053214 17:11515562-11515584 GTGTGGTCTCAGCTGGTGACTGG + Intronic
1144497728 17:15759164-15759186 GAGTGATTTCAGCTGTTCACAGG + Intergenic
1145161097 17:20574214-20574236 GAGTGATTTCAGCTGTTCACAGG + Intergenic
1145965392 17:28913112-28913134 GTGTCTTGTCAGCTGTTTGCAGG + Exonic
1147787980 17:42993822-42993844 GTGTGATGACATCTGTTGTGGGG - Intergenic
1148556630 17:48582339-48582361 GAGAGAGCTCAGCTGTTGCCCGG - Intronic
1148808969 17:50278580-50278602 CTGTGGTGACAGCTGCTGCCAGG + Exonic
1152122026 17:78424729-78424751 GGGTGACGTCAGCTGTTGAAGGG + Intronic
1152866482 17:82726728-82726750 GTGTGCTATCCGCTGCTGCCTGG + Intronic
1153817973 18:8807348-8807370 GTGTGATGACAGCTTCAGCCTGG - Intronic
1156433717 18:37103216-37103238 GTGTGATGTAACCTTTTGCTCGG - Intronic
1158183329 18:54742908-54742930 CTGTGAGGTCAGCTTTTGGCAGG + Intronic
1160265704 18:77339544-77339566 GTGTGGTGGCAGCTGTGACCTGG + Intergenic
1163006074 19:14397427-14397449 GTGAGTCATCAGCTGTTGCCTGG - Intronic
1163061671 19:14766013-14766035 GTGAGTCATCAGCTGTTGCCTGG + Intronic
1166420476 19:42632450-42632472 ATGTGAGGTCAGGTGTTGACAGG - Intronic
1166826598 19:45613696-45613718 GTAAGATGTCAGCTGGAGCCAGG + Intronic
1167596614 19:50431750-50431772 ATGTGATGTCACGGGTTGCCAGG - Intergenic
1168295074 19:55374296-55374318 GTGTGAGGTCAGCAGGTCCCAGG + Intergenic
925018712 2:552000-552022 GTGTGATGTCAGAAGATGGCAGG - Intergenic
925502655 2:4523024-4523046 GTGTGCTGTCACCTGTGGGCAGG + Intergenic
925865811 2:8224858-8224880 GTGTGACGTCAGCACTTCCCTGG - Intergenic
926423784 2:12723262-12723284 GTTTGATATCAGCTGCTACCAGG + Exonic
935723002 2:105996294-105996316 GTGTGATTTATGGTGTTGCCAGG + Intergenic
938213020 2:129484493-129484515 GTGTGGGTTCAGCTGATGCCTGG + Intergenic
939139523 2:138336734-138336756 ATCTGATGTCAGCTATTCCCTGG + Intergenic
946235836 2:218323792-218323814 GGGTGAGGTCAGCAGATGCCCGG + Intronic
946879268 2:224161092-224161114 CTGTGATGTCAGCACTTGCCTGG + Intergenic
948370235 2:237484266-237484288 GTGTCCTGTCAGCTGGTGCATGG - Intergenic
948814977 2:240505879-240505901 GTGTGCTGTGAGCTGATTCCTGG - Intronic
1169864429 20:10184694-10184716 GTGTGATGCCAGCAGAGGCCTGG + Intergenic
1171159829 20:22911121-22911143 GTGTGAGTCCAGCTGTTCCCAGG - Intergenic
1172020213 20:31908615-31908637 GTGTGACGTCAGCTGGCTCCGGG + Exonic
1176179988 20:63745284-63745306 GTGTGATGACAGCTCCAGCCAGG + Exonic
1177285833 21:19048399-19048421 GTGAGATGAAAGCTGTTGGCTGG + Intergenic
1177838846 21:26214614-26214636 GATTGATGTCAGCTCTTTCCTGG + Intergenic
1178978946 21:37244867-37244889 GTGTGGCCTCAGCTGTTCCCAGG - Intronic
1179047910 21:37862830-37862852 GTGTGACATCATTTGTTGCCAGG + Intronic
1183275475 22:36894431-36894453 CAGTGATGTCAGCTGGTTCCTGG + Intergenic
1184098916 22:42331308-42331330 CTGTGAGGCCAGCTGTTTCCAGG - Intronic
1184288329 22:43484437-43484459 TTGTTCTGGCAGCTGTTGCCTGG + Intronic
1185004752 22:48269089-48269111 GTGTGATGCCCGCCGTAGCCAGG - Intergenic
1185099157 22:48828366-48828388 GTATGAGGTGAGCTGTTGGCTGG + Intronic
1185171207 22:49295627-49295649 CAGTGTTGTGAGCTGTTGCCTGG - Intergenic
1185211740 22:49574372-49574394 CTGTGAGGGCAGCTGCTGCCTGG - Intronic
949639230 3:6016089-6016111 GTGTGATGTGAGATGTAGGCTGG - Intergenic
949871966 3:8596676-8596698 GTGGGATGGCAGCTGTTGAGAGG - Intergenic
951925449 3:27904501-27904523 GTTTGAGGTTAGTTGTTGCCAGG - Intergenic
954873261 3:53784030-53784052 GTGTGCTGTGAGGTGTGGCCTGG + Intronic
954882448 3:53845353-53845375 GTGTGTTGTCAGCTGGTGAGAGG - Intronic
958154774 3:89742736-89742758 CTGTTGTGTCAGCTGTTGGCTGG + Intergenic
959324185 3:104915024-104915046 GTATGATTTCATCTGTTGACTGG - Intergenic
961379805 3:126489512-126489534 TTCTGATGTCATCTGTAGCCTGG + Intronic
961678923 3:128585535-128585557 GTTAGATATCAGCTGTTGGCAGG - Intergenic
961952103 3:130761119-130761141 CTGTGATGACAGTTATTGCCTGG - Intergenic
964364610 3:155936242-155936264 ATGTGATTTCAGATATTGCCTGG + Intronic
964494273 3:157271551-157271573 GTTTGATAACAGCTGTGGCCTGG + Intronic
965444370 3:168756841-168756863 GTTTGATGTTAGCTGTGGGCTGG + Intergenic
965742498 3:171890432-171890454 GTCTGAACTCAGCTGATGCCTGG - Intronic
967552850 3:190819372-190819394 GGGTGATTGCAGCTGTTGCATGG - Intergenic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
970218999 4:13788083-13788105 GTGTGATGTTAGCTGTGGGTTGG + Intergenic
975365950 4:73527767-73527789 CTGTGATGTCAGCTTTTGTTGGG + Intergenic
976413904 4:84749074-84749096 ATGGGATTTCACCTGTTGCCCGG + Intronic
982610787 4:157572067-157572089 GTGTGAGGGCAGCTGGTGCAGGG + Intergenic
986647587 5:9933027-9933049 GAGTGATGTCAGATATTCCCAGG + Intergenic
992127403 5:73655943-73655965 GTGTTTTGTCTGCTGTAGCCAGG + Intronic
992521660 5:77558370-77558392 GTGGGCTGTCTGCTGTTGCCTGG - Intronic
994247065 5:97489645-97489667 GTGGGATGTCAGCTGCAGCGGGG - Intergenic
995938716 5:117551453-117551475 CTGTGCAGTCAGCTGTGGCCGGG + Intergenic
997228069 5:132224366-132224388 ATGTGATGACAGATGTTGGCAGG + Intronic
999289010 5:150411479-150411501 GTGTGATGTCAGCTGTTGCCAGG - Intronic
1000228154 5:159289867-159289889 GTGGGAGGTAAGCTGTGGCCTGG + Intergenic
1001156644 5:169278190-169278212 TTGTGATCTCAGTTGCTGCCTGG - Intronic
1001168141 5:169390475-169390497 TTGGGATATCAGCTGTAGCCTGG - Intergenic
1001492458 5:172165214-172165236 CTGTGATATCAGCTATTTCCCGG - Intronic
1001647409 5:173292418-173292440 CTGAGATGTCAGCTGCAGCCTGG + Intergenic
1002923650 6:1592179-1592201 CTGTGATGACTGATGTTGCCAGG - Intergenic
1012175885 6:96083595-96083617 GTGTGATGCCAGCTGCTGAAGGG - Intronic
1013231895 6:108167486-108167508 GTGAGAGGTCAGCTGCGGCCTGG - Intronic
1016450343 6:144175953-144175975 GGGTGAAATCAGCTGTGGCCAGG - Intronic
1016655796 6:146517109-146517131 ATGTGTTGTCAACTGTTGCTGGG + Intergenic
1024169852 7:46773450-46773472 GTGTGAAGTCAGCTGTGTCAAGG - Intergenic
1024889226 7:54181889-54181911 GTTAGATGTCTGCTTTTGCCTGG + Intergenic
1026528818 7:71179522-71179544 TGGAGATGTCAGCTGCTGCCTGG - Intronic
1028262246 7:88680582-88680604 CTCTGATTTCAGCTGTTGCTGGG - Intergenic
1031676871 7:124620929-124620951 GTGTGTTGTTATCTGGTGCCAGG - Intergenic
1033064013 7:138135392-138135414 GTATGATGTTAGCTGTGGGCTGG + Intergenic
1035124062 7:156595135-156595157 GTCTGATGTCAGGTGCTGCAGGG - Intergenic
1037451791 8:19022749-19022771 TGGTGATGACAGCTGTTGCCTGG - Intronic
1038062763 8:23930728-23930750 GTGTGATGGAAGCAGCTGCCAGG + Intergenic
1038734522 8:30156707-30156729 GGGTGACGTCAGCTTTTTCCTGG + Intronic
1042832668 8:73049034-73049056 CTGTCCTCTCAGCTGTTGCCTGG - Intergenic
1043580097 8:81702399-81702421 GGGGGATGTCAGCTGTTGATTGG - Exonic
1044314676 8:90736084-90736106 GTGTGATGTTGGCTGTGGGCTGG - Intronic
1047982943 8:130202256-130202278 TTGTGATGCCAGCTGCTGCCAGG + Intronic
1049459469 8:142717975-142717997 GAGGGATGGCAGCTGCTGCCAGG + Intergenic
1051378852 9:16434756-16434778 GTGTGATGTCATCTGAAGGCTGG + Intronic
1051519420 9:17968646-17968668 GTTTGATTTCATCTGTTTCCAGG + Intergenic
1056060288 9:82878322-82878344 GTGTGATTGTAGCTGTTCCCTGG - Intergenic
1061801533 9:133115700-133115722 ATATGATGTCAGGTGTTGTCCGG - Intronic
1062290103 9:135790563-135790585 GTGTGAGCACAGCTGCTGCCAGG - Intronic
1187587021 X:20674718-20674740 GTGTGGAGTCAGCTACTGCCAGG + Intergenic
1188444419 X:30241768-30241790 TTGTCATGTCAGCTCTTGGCAGG - Intergenic
1189274790 X:39777921-39777943 CTGTGGTGCCAGCTTTTGCCAGG - Intergenic
1192829081 X:74731354-74731376 GTATGATCTCAACTTTTGCCAGG + Intergenic
1197764669 X:130052103-130052125 GTGTGATGGCACTCGTTGCCAGG - Intronic
1202091082 Y:21191222-21191244 GTGTGATGTTATCTGGTGCCAGG + Intergenic