ID: 999290182

View in Genome Browser
Species Human (GRCh38)
Location 5:150419855-150419877
Sequence TTGTCCCTCAAGGAGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999290182_999290190 19 Left 999290182 5:150419855-150419877 CCGTCCCCCTCCTTGAGGGACAA No data
Right 999290190 5:150419897-150419919 ACAAATAAAGAACGTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999290182 Original CRISPR TTGTCCCTCAAGGAGGGGGA CGG (reversed) Intergenic
No off target data available for this crispr